Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
-
Yanjing You
, Huijuan Wang , Qing Wang , Zongyang Yu , Zhongquan Zhao , Liying Zhuang , Shengyuan Zeng , Jinyang Zheng and Wen Wen
Abstract
Chronic obstructive pulmonary disease (COPD) is commonly caused by smoking. FUN14 domain-containing protein 1 (FUNDC1) plays a fundamental role in mitochondrial autophagy and apoptosis in cigarette smoke extract (CSE)-treated BEAS-2B cells. The present study investigated the mechanism of action of FUNDC1 in mitochondrial dysfunction and apoptosis in CSE-treated BEAS-2B cells. The interaction between ubiquitin-specific peptidase 19 (USP19) and FUNDC1 was analyzed using co-immunoprecipitation. Effects of USP19 knockdown and/or FUNDC1 overexpression on the survival, apoptosis, mitochondrial membrane potential, and oxygen consumption rate (OCR) of BEAS-2B cells treated with 15% CSE were determined. In BEAS-2B cells, CSE inhibited cell survival, promoted apoptosis, increased the expression of USP19 and FUNDC1, increased the ratio of LC3 II to LC3 I (LC3 II/I), and decreased mitochondrial membrane potential and TOM20 levels. In CSE-treated BEAS-2B cells, USP19 knockdown reduced FUNDC1 and LC3 II/I, increased the levels of TOM20, improved cell survival, mitochondrial membrane potential, and OCR, and inhibited apoptosis. USP19 deubiquitinates FUNDC1. FUNDC1 overexpression inhibited the effect of USP19 knockdown in CSE-treated BEAS-2B cells. Overall, decreasing USP19 expression alleviates CSE-induced mitochondrial dysfunction in BEAS-2B cells by downregulating FUNDC1, providing novel insights into the molecular mechanism of FUNDC1 regulation in COPD.
1 Introduction
Chronic obstructive pulmonary disease (COPD) is a leading cause of death worldwide. COPD is a lung disease clinically characterized by chronic respiratory symptoms and airflow limitation associated with airway and/or alveolar damage [1,2]. COPD is caused by prolonged exposure to harmful particles or gases, especially tobacco smoke, and accounts for nearly 90% of cases [3,4]. Therefore, studying the mechanism of action of cigarette smoke extract (CSE) on cells of the respiratory system can contribute to the development of new drugs for COPD.
In patients with COPD, mitochondrial morphological abnormalities are observed, including swelling, elongation, fragmentation, and loss of cristae, leading to mitochondrial dysfunction, such as disruption of the electron transport chain [5,6]. This damage activates the production of excessive reactive oxygen species (ROS) in mitochondria, which are the main ROS producers in cells, and results in oxidative stress [7]. Excessive mitochondrial ROS stimulates inflammatory responses that impair mitophagy [8]. Therefore, investigating the effect of CSE on the mitochondrial function of respiratory system cells advances our understanding of the mechanism of smoking-induced damage to the respiratory system.
Mitophagy is highly associated with the ubiquitin-proteasome system and the autophagy-lysosomal pathway [9,10]. The former is the most well-known mechanism of mitophagy, which is mediated by parkin and phosphatase and tensin homologue (PTEN) and the PTEN-induced putative kinase 1 pathway [11,12]. The latter is mediated by mitophagy receptors localized on the outer membrane that recruit autophagosomes to degrade dysfunctional mitochondria [13]. Recently, FUN14 domain-containing protein 1 (FUNDC1) was identified, and has been confirmed to be a novel mitophagy receptor [14,15]. FUNDC1 expression is upregulated in COPD, and FUNDC1 silencing suppresses mitophagy and alleviates apoptosis in bronchial epithelial cells under hypoxic conditions [16]. These findings indicate that FUNDC1 is a potential therapeutic target. However, the mechanism underlying FUNDC1 regulation in COPD remains unknown. Under hypoxic stress, ubiquitin-specific peptidase (USP) 19 binds to and stabilizes FUNDC1, which is involved in the regulation of mitochondrial dynamics [17,18]. Skeletal muscle atrophy caused by smoking is associated with the upregulation of USP19 [19]. USP19 may interact with FUNDC1, which regulates mitophagy in COPD. However, whether USP19 targets FUNDC1 and functions in the respiratory cells of patients with COPD remains unknown.
In the present study, we investigated the role of USP19 in the regulation of FUNDC1, which is involved in mitophagy and apoptosis, in CSE-treated BEAS-2B cells.
2 Materials and methods
2.1 Cell culture
The human bronchial epithelial cell line (BEAS-2B) was purchased from Xiamen Immocell Biotechnology Co., Ltd (Xiamen, China). BEAS-2B cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, NY, USA) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 U/mL streptomycin. BEAS-2B cells were incubated at 37°C with 5% CO2 concentration.
2.2 Treatment of CSE
To induce COPD in vitro, CSE was added to the BEAS-2B cell culture medium. CSE was prepared using a modified syringe-driven apparatus in which one cigarette was combusted, and smoke was bubbled through 5 mL of RPMI-1640 medium to obtain a 100% CSE solution [20]. The 100% CSE solution subsequently was filtered through an aseptic 0.22 μm filter, and diluted into 30, 25, 20, 15, and 10% CSE solution in medium for the culture of BEAS-2B cells. After 24 h, the 2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was used to detect cell survival. A CSE solution that decreased BEAS-2B cells survival by 50% was selected to induce COPD in the present study.
2.3 Grouping of cells
Plasmids encoding FUNDC1 (FUNDC1 OE or Flag-FUNDC1), USP19 (HA-USP19), or short hairpin RNA (shRNA) targeting USP19 (shUSP19-1, -2, and -3) and the corresponding negative control plasmids (shNC and vector) were purchased from XIAMEN Anti-HeLa Biological Technology Trade Co. Ltd (Xiamen, China). BEAS-2B cells were divided into shNC, shNC + 15% CSE, shUSP19 + 15% CSE, and shUSP19 + FUNDC1 OE + 15% CSE groups. After cell transfection of 5 μg of plasmid (2.5 μg of shUSP19 or shNC and 2.5 μg of FUNDC1 OE or vector) in a six-well plate for 16 h, the supernatant of the cells was replaced with medium containing 15% CSE. The cells were cultured for 24 h and collected for subsequent detection. All primers used for plasmid construction are listed in Table 1.
Primers used in this study
| Primers | Sequence (5′–3′) | |
|---|---|---|
| ShUSP19-1 | F | CCGGCTCCACTGCGAGCGAAGTATTCTCGAGAATACTTCGCTCGCAGTGGAGTTTTT |
| R | AATTAAAAACTCCACTGCGAGCGAAGTATTCTCGAGAATACTTCGCTCGCAGTGGAG | |
| ShUSP19 -2 | F | CCGGCCGGTACTCTGTGAGTGTATTCTCGAGAATACACTCACAGAGTACCGGTTTTT |
| R | AATTAAAAACCGGTACTCTGTGAGTGTATTCTCGAGAATACACTCACAGAGTACCGG | |
| ShUSP19 -3 | F | CCGGGCTGCCCAGCTACGATCTATACTCGAGTATAGATCGTAGCTGGGCAGCTTTTT |
| R | AATTAAAAAGCTGCCCAGCTACGATCTATACTCGAGTATAGATCGTAGCTGGGCAGC | |
| FUNDC1 OE | F | TAGAGAATTCGGATCCATGGCGACCCGGAACCCCCC |
| R1 | TGTCGTCATCGTCTTTGTAGTCAGATGCAAGTCCGAGCAAAAAGCCTCCC | |
| R2 | GCTTCCATGGCTCGAGTCACTTGTCGTCATCGTCTTTGTAG | |
| USP19 OE | F | CTAGAGAATTCGGATCCATGTCTGGCGGGGCCAGTG |
| R | AGCTTCCATGGCTCGAGTCATCTCCAGCGACTCTGGG | |
| 18S | QF | AGGCGCGCAAATTACCCAATCC |
| QR | GCCCTCCAATTGTTCCTCGTTAAG | |
| USP19 | QF | GCTGCTATCCTCAGAGTTGGCT |
| QR | TCATCCTCCGACTGTTGCTTCC | |
| FUNDC1 | QF | ATTGAAGAAGCAACAGAA |
| QR | ATAGTTGAATCCGTTATGG | |
Notes: F: forward primer for plasmid, R: reverse primer for plasmid, QF: forward primer for qPCR, QR: reverse primer for qPCR.
2.4 Cell survival assay
BEAS-2B cells at 24 h post-treatment were seeded into 96-well plates (104 cells per well). Cells were harvested and incubated with MTT solution (Beyotime Biotechnology, Shanghai, China). Cell survival was determined by measuring the optical density using an absorbance reader (Bio-Tek, Winooski, USA) at 490 nm.
2.5 Apoptosis assay
Harvested BEAS-2B cells were stained with annexin V-fluorescein isothiocyanate (Vazyme, Nanjing, China) and propidium iodide (Vazyme). The apoptosis rate was determined based on the fluorescence signals using a flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).
2.6 Mitochondrial membrane potential assay
Harvested BEAS-2B cells were stained with 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (JC-1; Invitrogen), according to the manufacturer’s instructions. The mitochondrial membrane potential was estimated based on fluorescence signals using a flow cytometer (BD Biosciences).
2.7 Oxygen consumption rate (OCR) measurement
The harvested BEAS-2B cells were transferred to an oxygraph chamber containing respiration buffer. The OCR was determined using a Seahorse XF96 analyzer (Seahorse Bioscience, North Billerica, MA, USA) and an XF Cell Mito Stress Test Kit (Seahorse Bioscience). After measuring OCR at basal respiration, 2.5 μM oligomycin was added to measure residual proton leak, 1 μM carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone was added to induce maximum respiration, and 2.5 μM antimycin A/rotenone was added for adenosine triphosphate (ATP) production.
2.8 Quantitative PCR (qPCR)
Total RNA was isolated from BEAS-2B cells using TRIzol reagent (Takara, Dalian, China). The quality of total RNA was verified using gel electrophoresis, and a Nanodrop 2000 spectrometer was used to determine RNA concentration (Thermo Fisher Scientific, USA). A reverse transcription kit (Applied Biosystems, Foster City, CA, USA) was used to obtain cDNA for qPCR. qPCR was performed on a QuantStudio 5 system (Applied Biosystems, USA) using the SYBR Green Master Mix (Thermo Fisher Scientific, USA). The 2−ΔΔCT algorithm was used to determine the relative expression of mRNA. Information on the qPCR primers is provided in Table 1.
2.9 Western blotting
BEAS-2B cells were lysed in radioimmunoprecipitation assay buffer supplemented with protease and phosphatase inhibitors (Beyotime, Shanghai, China). Cell lysates were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subsequently transferred to a polyvinylidene difluoride membrane. The membrane was treated with primary antibodies after blocking with 5% skim milk, and then with secondary antibodies that had been conjugated to horseradish peroxidase (HRP). Protein levels were estimated based on protein intensity. The protein intensity was determined using a film processing system (iBright FL1000; Thermo Fisher Scientific) with an HRP chemiluminescence kit (Tiangen Biotech, Beijing, China). The antibodies used for western blotting are listed in Table 2.
Antibodies for western blotting
| Antibodies | Manufacturer | Catalog no. | Dilution |
|---|---|---|---|
| Actin | Proteintech, Wuhan, China | 81115-1-RR | 1:5,000 |
| USP19 | Proteintech, Wuhan, China | 25768-1-AP | 1:3,000 |
| FUNDC1 | Abcam, Shanghai, China | ab224722 | 1:2,000 |
| TOM20 | Proteintech, Wuhan, China | 11802-1-AP | 1:3,000 |
| LC3 I/II | Proteintech, Wuhan, China | 14600-1-AP | 1:3,000 |
| DYKDDDDK Tag | Proteintech, Wuhan, China | 80010-1-RR | 1:4,000 |
| HA-tag | Proteintech, Wuhan, China | 51064-2-AP | 1:4,000 |
| His-tag | Proteintech, Wuhan, China | 10001-0-AP | 1:4,000 |
| HRP goat anti-rabbit IgG (H + L) | Proteintech, Wuhan, China | SA00001-2 | 1:10,000 |
2.10 Co-immunoprecipitation (co-IP)
Plasmids HA-USP19 and Flag-FUNDC1 were co-transfected into BEAS-2B cells to elucidate the interaction between USP19 and FUNDC1. To understand the deubiquitination of FUNDC1 by USP19, shUSP19 and/or Flag-FUNDC1 expression plasmids were co-transfected with His-Ub expression plasmids into BEAS-2B cells. After 24 h, the BEAS-2B cells were lysed with immunoprecipitation buffer (150 mmol/L NaCl; 50 mmol/L Tris (hydroxymethyl) aminomethane hydrochloride, pH = 7.4; 40 mmol/L glycerophosphate; 1 mmol/L Na4OV3; 10 mmol/L NaF; and 2 mmol/L ethylenediaminetetraacetic acid) supplemented with 1 mmol/L phenylmethylsulphonyl fluoride and a protease inhibitor. Cell lysates were incubated with DYKDDDDK tag antibody (catalog number: 66008-4-Ig; Proteintech) or HA tag antibody (catalog number: 66006-2-Ig; Proteintech) overnight, followed by incubation with Protein A/G beads. Immunoprecipitates were subjected to western blotting, followed by washing with immunoprecipitation buffer.
2.11 Analysis of USP19-stabilizing FUNDC1 protein
To understand the effect of USP19 on FUNDC1 protein level, shUSP19 and Flag-FUNDC1 expression plasmid co-transfected cells were treated with 50 μg/mL cycloheximide. After 0, 2, 4, 8, and 12 h, cells were harvested for western blotting.
2.12 Statistical analysis
All statistical analyses were conducted using GraphPad Prism (version 5.0; San Diego, California, USA). Student’s t-test was used to compare the differences between two groups, the student’s t test was utilized. A one-way analysis of variance was used to compare multiple groups. P < 0.05 indicated a significant difference. Prior to the parameter tests, the normality of the data was verified using the Shapiro–Wilk test.
3 Results
3.1 CSE inhibits cell survival, enhances cell apoptosis, decreases mitochondrial membrane potential, and increases the expression of USP19 and FUNDC1
To construct a COPD cell model, BEAS-2B cells were stimulated with CSE. CSE treatment showed that the survival of BEAS-2B cells was decreased by CSE (Figure 1a). The decrease was positively correlated with the CSE concentration from 10 to 30%, and the median inhibitory concentration (IC50) was 15%. The CSE solution (15%) increased the percentage of apoptotic cells (Figure 1b and c). CSE of 15% also significantly increased the mean fluorescence intensity (MFI) ratio of green to red in BEAS-2B cells, indicating that CSE reduced the mitochondrial membrane potential in cells (Figure 1d and e). Moreover, studies have shown that FUNDC1 is involved in COPD progression and is stabilized by USP19 [16,17]. Therefore, we examined the expression of USP19 and FUNDC1 in CSE-treated cells. The results showed that 15% CSE significantly increased the relative mRNA and protein expression levels of USP19 and FUNDC1 in BEAS-2B cells (Figure 1f–j). These results revealed that 15% CSE can be used to construct a cell model of COPD and that 15% CSE increases USP19 and FUNDC1 expression.

CSE inhibits cell survival, enhances cell apoptosis, decreases mitochondrial membrane potential, and increases the expression of USP19 and FUNDC1. (a) Survival of BEAS-2B cells treated with 10, 15, 20, 25 and 30% CSE. (b) Effect of 15% CSE treatment on the apoptosis of BEAS-2B cells. (c) Apoptosis rates of BEAS-2B cells in each group. (d) Effect of 15% CSE on the mitochondrial membrane potential of BEAS-2B cells. (e) MFI of each group. (f)–(j) mRNA (f) and (g) and protein (h)–(j) levels of USP19 and FUNDC1 in BEAS-2B cells treated with 15% CSE. Data are expressed as mean ± standard deviation (SD) (a), (c), (e)–(j). *, **, ***, **** indicated P <0.05, <0.01, <0.001, and <0.0001, respectively.
3.2 USP19 is involved in apoptosis and mitochondrial dysfunction in BEAS-2B cells stimulated with CSE
To further explore the role of USP19 in COPD development, we knocked down USP19 in CSE-stimulated BEAS-2B cells. The USP19 mRNA and protein expression levels were significantly decreased by shUSP19-1, -2, and -3 in BEAS-2B cells (Figure 2a–c). Among these, shUSP19-1 was the most efficient for USP19 knockdown; therefore, the following experiments were carried out using shUSP19-1. USP19 and FUNDC1 protein levels and the ratio of LC3 II to LC3 I (LC3 II/I) were lower and TOM20 protein expression was higher in the shUSP19 + 15% CSE group than in the shNC + 15% CSE group (Figure 2d and e). shUSP19 significantly improved cell survival (Figure 2f), suppressed apoptosis (Figure 2g and h), and alleviated mitochondrial membrane potential reduction (Figure 2i and j) in CSE-stimulated BEAS-2B cells. Moreover, CSE significantly reduced the OCR in BEAS-2B cells, whereas shUSP19 mitigated this effect (Figure 2k). In BEAS-2B cells treated with CSE, OCR was significantly increased by shUSP19 in terms of ATP production, basal respiration, maximal respiration, proton leakage, and spare respiration capacity (Figure 2l–p). These findings implied that USP19 knockdown alleviated CSE-induced apoptosis and impaired mitochondrial function.

USP19 is involved in apoptosis and mitochondrial dysfunction in BEAS-2B cells stimulated with CSE. (a)–(c) Knockdown efficiency of USP19 shRNA (shUSP19-1, -2, and -3) at the mRNA (a) and protein (b) and (c) levels. (d)–(p) Effects of shUSP19 and CSE treatment on the protein levels of FUNDC1, LC3 II/I, and TOM20 (d) and (e), cell survival (f), cell apoptosis (g) and (h), mitochondrial membrane potential (i) and (j), and OCR (k)–(p) in BEAS-2B cells. Ns: not significantly different. Data are expressed as the mean ± SD (a), (c), (e), (f), (h), (j), (k)–(p). *, **, ***, and **** denoted P <0.05, <0.01, <0.001, and <0.0001, respectively.
3.3 USP19 stabilized FUNDC1 in BEAS-2B cells
A previous study demonstrated that USP19 interacts with FUNDC1 and stabilizes FUNDC1 [17]. In the present study, we verified this using exogenous co-IP. Flag-FUNDC1 was successfully expressed in BEAS-2B cells transfected with Flag-FUNDC1 plasmid (Figure 3a). In co-transfected BEAS-2B cells, FUNDC1 was pulled down by USP19 using an anti-HA antibody and USP19 was pulled down by FUNDC1 using an anti-Flag antibody (Figure 3b). These results indicated that FUNDC1 interacts with USP19. In BEAS-2B cells co-transfected with FUNDC1, shUSP19, and ubiquitin, ubiquitin was pulled down by FUNDC1 using an anti-FLAG antibody and the protein levels of both FUNDC1 and ubiquitin were increased by shUSP19 (Figure 3c). FUNDC1 protein levels decreased from 0 to 12 h after cycloheximide treatment, which was significantly accelerated by shUSP19 in BEAS-2B cells (Figure 3d and e). Collectively, these results showed that USP19 interacts with FUNDC1 and stabilizes FUNDC1 in BEAS-2B cells.

USP19 stabilized FUNDC1 through deubiquitination. (a) Detection of Flag-FUNDC1 protein expressed by the plasmid flag-FUNDC1. (b) Interaction between USP19 and FUNDC1 was determined by co-IP assay. (c) FUNDC1 ubiquitination was measured using co-IP assay after depletion of USP19 in BEAS-2B cells. (d) and (e) FUNDC1 degradation is detected after USP19 expression is reduced in BEAS-2B cells. Data are expressed as the mean ± SD (e). **** denoted P < 0.0001.
3.4 USP19 regulates apoptosis and mitochondrial dysfunction through FUNDC1 in BEAS-2B cells stimulated with CSE
To investigate whether USP19 is involved in the development and progression of COPD through FUNDC1, we overexpressed FUNDC1 while knocking down USP19 in CSE-treated BEAS-2B cells. FUNDC1 overexpression significantly increased the protein levels of USP19, FUNDC1, and LC3 II/I, and decreased TOM20 protein level in BEAS-2B cells co-transfected with shUSP19 and FUNDC1 OE and treated with CSE (Figure 4a and b). Moreover, FUNDC1 overexpression significantly alleviated the effects of shUSP19 on cell survival (Figure 4c), apoptosis (Figure 4d and e), and mitochondrial expression (Figure 4f and g) in CSE-treated BEAS-2B cells. Additionally, FUNDC1 overexpression significantly alleviated the effects of shUSP19 on OCR during basal respiration, maximal respiration, proton leakage, spare respiration, and ATP production in CSE-treated BEAS-2B cells (Figure 5a–f). USP19 promotes CSE-induced apoptosis and impairs mitochondrial function by stabilizing FUNDC1.

USP19 regulate apoptosis and mitochondrial membrane potential through FUNDC1 in BEAS-2B cells stimulated with CSE. (a)–(g) After CSE-treated BEAS-2B cells were transfected with plasmids shUSP19 and FUNDC1 OE, protein levels of FUNDC1, LC3 II/I, TOM20 (a) and (b), cell survival (c), cell apoptosis (d) and (e), and mitochondrial membrane potential (f) and (g) were detected. Data are expressed as the mean ± SD (b), (c), (e), and (g). P <0.05, <0.01, <0.001, and <0.0001 are represented by *, **, ****, and ****, respectively. Ns: not significantly different.

USP19 is involved in mitochondrial OCR through FUNDC1. (a)–(f) Effects of USP19 knockdown and/or FUNDC1 expression on cell OCR (a) and OCR for ATP production (b), basal respiration (c), maximal respiration (d), proton leak (e), and spare respiration capacity (f) of CSE-treated BEAS-2B cells. Data are expressed as mean ± SD (a)–(f). P <0.05, <0.01, <0.001, and <0.0001 are represented by *, **, ***, and ****, respectively. Ns: not significantly different.
4 Discussion
The significant upregulation of FUNDC1 expression in CSE-treated BEAS-2B cells is consistent with previous findings [14,15], confirming that FUNDC1 is involved in the regulation of mitophagy in COPD. In agreement with previous findings [17,18], the mRNA and protein levels of USP19 were also stimulated in these cells. A pattern similar to that of FUNDC1 implied that USP19 may be involved in the regulation of mitophagy in COPD. USP19 localizes to the endoplasmic reticulum membrane and plays a critical role in the endoplasmic reticulum protein degradation (ERAD) pathway [21]. The ubiquitin-proteasome system is involved in the regulation of mitochondrial function [22,23]. USP19 is a crucial regulator of mitophagy in HEK293T cells [24]. USP19 knockdown in CSE-treated BEAS-2B cells increased cell survival, OCR, and protein levels of LC3 II/I, reduced TOM20 protein level, and mitigated the reduction in mitochondrial membrane potential. These findings indicated that USP19 plays an important role in the regulation of mitochondrial function in patients with COPD. Specifically, USP19 removes the K11 linked ubiquitin chains that stabilizes beclin1 and promotes mitophagy. In the present study, FUNDC1 protein levels were decreased by USP19 knockdown, indicating that USP19 may be involved in mitophagy by regulating FUNDC1 expression in CSE-treated BEAS-2B cells.
The interaction between USP19 and FUNDC1 was confirmed using the co-IP assays. The degradation of FUNDC1 was increased by USP19 knockdown, indicating that USP19 contributes to FUNDC1 stabilization. USP19, a deubiquitination enzyme in the ERAD pathway, prevents protein degradation through the proteasome [21], indicating that USP19 stabilizes FUNDC1 through deubiquitination. Moreover, the increased protein levels of LC3 II/I and cell survival induced by USP19 knockdown were alleviated by FUNDC1 overexpression in CSE-treated BEAS-2B cells. In addition, the effects of USP19 knockdown on MMP and OCR were eliminated by FUNDC1 overexpression in CSE-treated BEAS-2B cells. FUNDC1 is a positive regulator of mitophagy COPD [16]. These findings indicate that USP19 promotes mitophagy by stabilizing FUNDC1 in CSE-treated BEAS-2B cells. In addition to FUNDC1, USP19 may regulate the stabilization of beclin1, leading to increased mitophagy in COPD [24]. Further investigations are required to explore these regulatory effects in COPD.
In the present study, apoptosis was stimulated by CSE in BEAS-2B cells, which is consistent with previous findings [25]. The rate of stimulated apoptosis was alleviated by USP19 knockdown, which is consistent with mitophagy. A similar pattern implies that mitophagy and apoptosis interact during COPD. In general, mitophagy and autophagy decrease oxidative stress and maintain cell survival, leading to the suppression of apoptosis. However, excessive mitophagy and autophagy promotes apoptosis [13]. A previous report has confirmed that autophagy is involved in apoptosis regulation in CSE-treated BEAS-2B cells [26]. Macroautophagy promotes apoptosis in BEAS2-B cells, whereas chaperone-mediated autophagy inhibits apoptosis. Therefore, the interplay between mitophagy and autophagy requires further investigation in patients with COPD.
COPD is the fourth leading cause of death worldwide. Although numerous therapeutic approaches and management strategies have been developed, COPD appears to be difficult to reverse and patients are at high risk of exacerbation [4,27]. Our findings revealed that USP19 is a positive regulator of FUNDC1, which is involved in mitochondrial dysfunction and apoptosis in CSE-treated BEAS-2B cells through deubiquitination. The knockdown of USP19 alleviated mitochondrial dysfunction and apoptosis in CSE-treated BEAS-2B cells. These findings suggest that USP19 is a potential therapeutic target for COPD. However, the clinical effects and value of targeting USP19 remain to be investigated in patients in the further study.
Acknowledgements
This work was supported by Natural Science Foundation of Fujian Province (2020J011137).
-
Funding information: This study was supported by the Natural Science Foundation of Fujian Province (grant number: 2020J011137).
-
Author contributions: YY, ZY, and WW: conceptualization. HW, SZ and QW: methodology. ZZ: investigation. LZ: formal analysis. YY: writing–original draft. WW: writing–review & editing. WW: funding acquisition. ZY: supervision. All authors contributed to the article and approved the submitted version.
-
Conflict of interest: The authors declare no competing interests.
-
Data availability statement: All data generated or analyzed in this study are included in this article. Any inquiries can be directed at the corresponding author.
References
[1] Celli BR, Agustí A. COPD: time to improve its taxonomy. ERJ Open Res. 2018;4(1):00132–2017.10.1183/23120541.00132-2017Search in Google Scholar PubMed PubMed Central
[2] Pauwels RA, Buist AS, Calverley PM, Jenkins CR, Hurd SS. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO global initiative for chronic obstructive lung disease (GOLD) workshop summary. Am J Respir Crit Care Med. 2001;163(5):1256–76.10.1164/ajrccm.163.5.2101039Search in Google Scholar PubMed
[3] Boucher RC. Muco-obstructive lung diseases. N Engl J Med. 2019;380(20):1941–53.10.1056/NEJMra1813799Search in Google Scholar PubMed
[4] Agustí A, Hogg JC. Update on the pathogenesis of chronic obstructive pulmonary disease. N Engl J Med. 2019;381(13):1248–56.10.1056/NEJMra1900475Search in Google Scholar PubMed
[5] Hoffmann RF, Zarrintan S, Brandenburg SM, Kol A, de Bruin HG, Jafari S, et al. Prolonged cigarette smoke exposure alters mitochondrial structure and function in airway epithelial cells. Respir Res. 2013;14(1):97.10.1186/1465-9921-14-97Search in Google Scholar PubMed PubMed Central
[6] Liu JY, Zhang MY, Qu YQ. The underlying role of mitophagy in different regulatory mechanisms of chronic obstructive pulmonary disease. Int J Chronic Obstr Pulm Dis. 2020;15:2167–77.10.2147/COPD.S265728Search in Google Scholar PubMed PubMed Central
[7] Cho DH, Kim JK, Jo EK. Mitophagy and innate immunity in infection. Mol Cell. 2020;43(1):10–22.Search in Google Scholar
[8] Park J, Choi H, Min JS, Park SJ, Kim JH, Park HJ, et al. Mitochondrial dynamics modulate the expression of pro-inflammatory mediators in microglial cells. J Neurochem. 2013;127(2):221–32.10.1111/jnc.12361Search in Google Scholar PubMed
[9] Tahrir FG, Langford D, Amini S, Mohseni Ahooyi T, Khalili K. Mitochondrial quality control in cardiac cells: mechanisms and role in cardiac cell injury and disease. J Cell Physiol. 2019;234(6):8122–33.10.1002/jcp.27597Search in Google Scholar PubMed PubMed Central
[10] Hammerling BC, Gustafsson ÅB. Mitochondrial quality control in the myocardium: cooperation between protein degradation and mitophagy. J Mol Cell Cardiol. 2014;75:122–30.10.1016/j.yjmcc.2014.07.013Search in Google Scholar PubMed PubMed Central
[11] Palikaras K, Lionaki E, Tavernarakis N. Mechanisms of mitophagy in cellular homeostasis, physiology and pathology. Nat Cell Biol. 2018;20(9):1013–22.10.1038/s41556-018-0176-2Search in Google Scholar PubMed
[12] Ma K, Chen G, Li W, Kepp O, Zhu Y, Chen Q. Mitophagy, mitochondrial homeostasis, and cell fate. Front Cell Dev Biol. 2020;8:467.10.3389/fcell.2020.00467Search in Google Scholar PubMed PubMed Central
[13] Liu H, Zang C, Yuan F, Ju C, Shang M, Ning J, et al. The role of FUNDC1 in mitophagy, mitochondrial dynamics and human diseases. Biochem Pharmacol. 2022;197:114891.10.1016/j.bcp.2021.114891Search in Google Scholar PubMed
[14] Wang L, Wang P, Dong H, Wang S, Chu H, Yan W, et al. Ulk1/FUNDC1 prevents nerve cells from hypoxia-induced apoptosis by promoting cell autophagy. Neurochem Res. 2018;43(8):1539–48.10.1007/s11064-018-2568-xSearch in Google Scholar PubMed
[15] Leermakers PA, Schols A, Kneppers AEM, Kelders M, de Theije CC, Lainscak M, et al. Molecular signalling towards mitochondrial breakdown is enhanced in skeletal muscle of patients with chronic obstructive pulmonary disease (COPD). Sci Rep. 2018;8(1):15007.10.1038/s41598-018-33471-2Search in Google Scholar PubMed PubMed Central
[16] Wen W, Yu G, Liu W, Gu L, Chu J, Zhou X, et al. Silencing FUNDC1 alleviates chronic obstructive pulmonary disease by inhibiting mitochondrial autophagy and bronchial epithelium cell apoptosis under hypoxic environment. J Cell Biochem. 2019;120(10):17602–15.10.1002/jcb.29028Search in Google Scholar PubMed
[17] Chai P, Cheng Y, Hou C, Yin L, Zhang D, Hu Y, et al. USP19 promotes hypoxia-induced mitochondrial division via FUNDC1 at ER-mitochondria contact sites. J Cell Biol. 2021;220(7):e202010006.10.1083/jcb.202010006Search in Google Scholar PubMed PubMed Central
[18] Zhang Y, Zhuang H, Liu H, Feng D. Molecular regulations of FUNDC1 at ER-mitochondria contacts under hypoxic stress. Contact. 2022;5:25152564221092487.10.1177/25152564221092487Search in Google Scholar PubMed PubMed Central
[19] Liu Q, Xu WG, Luo Y, Han FF, Yao XH, Yang TY, et al. Cigarette smoke-induced skeletal muscle atrophy is associated with up-regulation of USP-19 via p38 and ERK MAPKs. J Cell Biochem. 2011;112(9):2307–16.10.1002/jcb.23151Search in Google Scholar PubMed
[20] Otsu W, Ishida K, Chinen N, Nakamura S, Shimazawa M, Tsusaki H, et al. Cigarette smoke extract and heated tobacco products promote ferritin cleavage and iron accumulation in human corneal epithelial cells. Sci Rep. 2021;11(1):18555.10.1038/s41598-021-97956-3Search in Google Scholar PubMed PubMed Central
[21] Hassink GC, Zhao B, Sompallae R, Altun M, Gastaldello S, Zinin NV, et al. The ER-resident ubiquitin-specific protease 19 participates in the UPR and rescues ERAD substrates. EMBO Rep. 2009;10(7):755–61.10.1038/embor.2009.69Search in Google Scholar PubMed PubMed Central
[22] Jacomin AC, Taillebourg E, Fauvarque MO. Deubiquitinating enzymes related to autophagy: new therapeutic opportunities? Cells. 2018;7(8):112.10.3390/cells7080112Search in Google Scholar PubMed PubMed Central
[23] Chen RH, Chen YH, Huang TY. Ubiquitin-mediated regulation of autophagy. J Biomed Sci. 2019;26(1):80.10.1186/s12929-019-0569-ySearch in Google Scholar PubMed PubMed Central
[24] Jin S, Tian S, Chen Y, Zhang C, Xie W, Xia X, et al. USP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1. EMBO J. 2016;35(8):866–80.10.15252/embj.201593596Search in Google Scholar PubMed PubMed Central
[25] Son ES, Kim SH, Ryter SW, Yeo EJ, Kyung SY, Kim YJ, et al. Quercetogetin protects against cigarette smoke extract-induced apoptosis in epithelial cells by inhibiting mitophagy. Toxicol In Vitro An Int J Published Assoc BIBRA. 2018;48:170–8.10.1016/j.tiv.2018.01.011Search in Google Scholar PubMed
[26] Lee CH, Lee KH, Jang AH, Yoo CG. The impact of autophagy on the cigarette smoke extract-induced apoptosis of bronchial epithelial cells. Tuberc Respir Dis. 2017;80(1):83–9.10.4046/trd.2017.80.1.83Search in Google Scholar PubMed PubMed Central
[27] Ritchie AI, Wedzicha JA. Definition, causes, pathogenesis, and consequences of chronic obstructive pulmonary disease exacerbations. ClChest Med. 2020;41(3):421–38.10.1016/j.ccm.2020.06.007Search in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer