Home Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
Article Open Access

Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway

  • Juan Wang , Bangjuan Shang , Li Tang , Min Tian and Junping Liu EMAIL logo
Published/Copyright: March 23, 2023

Abstract

This article focuses on deciphering the effect of myostatin (MSTN) on podocyte apoptosis in membranous nephropathy (MN) and fathoming out its underlying mechanism. Rats received the intravenous injection of cationized-bovine serum albumin to induce MN in vivo, while angiotensin II (Ang II) was exposed to AB8/13 cells to induce MN model in vitro. The mRNA expression of MSTN was detected by qRT-PCR. The effects of MSTN silencing on MN model rats and cells were assessed by cell counting kit-8 assay, flow cytometry, hematoxylin and eosin staining, and TUNEL assay. The expressions of proteins related to apoptosis and Smad3/protein kinase A (PKA)/NADPH oxidase 4 (NOX4) signaling pathway were examined by western blot. As a result, MSTN was highly expressed in MN cell and rat models. Besides, knockdown of MSTN elevated the MN cell viability and dwindled apoptosis rate, as well as attenuated kidney injury in MN rats. Meanwhile, MSTN silencing lessened the expressions of phosphorylated (p)-Smad3 and Nox4, while boosting the p-PKA expression in MN rats and cells. Additionally, Smad3 overexpression reversed the above effects of MSTN silencing on Ang II-induced podocytes. In conclusion, MSTN knockdown restrains the podocyte apoptosis through regulating Smad3/PKA/NOX4 signaling pathway.

Graphical abstract

1 Introduction

Membranous nephropathy (MN) is one of the most common pathological types of adult nephrotic syndrome [1]. With diffuse basement membrane thickening, the immune complex primarily composed of immunoglobulin G and complement is deposited under the glomerular basement membrane (GBM) epithelial cells, which is the main pathological feature of MN [2]. However, the pathogenesis of MN is still vague. Most scholars believe that MN is the glomerular injury against podocyte membrane antigen mediated by autoantibodies, which could eventually elicit renal failure [3]. The duration of MN is lengthy, and renal function damage often occurs 5–10 years after the onset. As such, early diagnosis and treatment of MN play an important role in preventing or delaying its deterioration [3]. Renal biopsy has long deemed as the gold standard for the diagnosis of MN, but it is a traumatic operation, which may lead to serious bleeding complications. In addition to that, renal biopsy also has some contraindications in clinic, such as solitary kidney, psychosis, severe hypertension, etc. [4,5]. These limitations of renal biopsy restrain its wide application in MN. In view of this, it is of great practical significance to find safe, rapid and effective non-invasive indicators for MN diagnosis and treatment.

According to the previous study [6], GSE73953 dataset containing microarray data from MN patients and healthy controls was analyzed to obtain different expressed genes, of which the myostatin (MSTN) gene with the highest expression aroused our great interest. MSTN, located at 2q32.2 in the human genome, is a growth- and differentiation-related factor [7]. The MSTN gene has three putative transcription initiation sites, and is transcribed as a 3.1-kb mRNA species that encodes a 375-aa precursor protein [8]. In addition, it is expressed uniquely in the human skeletal muscle as a 26 kDa mature glycoprotein and secreted into the plasma, which binds to the receptor with the systemic circulation, resulting in a series of biological effects [8,9]. For instance, mature MSTN dimer phosphorylates type I receptors (ALK4 and ALK5), can bind to type II receptors ActRIIB and ActRIIA, and then promote the phosphorylation of Smad2 and Smad3, while phosphorylated (p)-Smad2 and p-Smad3 can form complexes with Smad4 and transfer into the nucleus, thereby activating the transcription and expression of atrophy genes by interacting with DNA and other nuclear factors [10,11]. The current study shows that the inhibition of MSTN has a good therapeutic effect on chronic kidney disease and the expression of MSTN may be associated with renal function [12,13]. However, the detailed role of MSTN in MN requires further exploration.

It has been proved that MSTN is able to activate p-Smad3 [14], and high glucose (HG)-induced increase in p-Smad3 level as well as Smad3-mediated PKA/NOX4 signaling pathway are important causes of podocyte apoptosis [15]. Therefore, this study is committed to further probing into whether MSTN is responsible for advancing podocyte apoptosis in MN through the Smad3/PKA/NOX4 pathway, and investigating the underlying mechanism of MSTN in MN.

2 Materials and methods

2.1 Animals and ethics statement

A total of 40 Sprague-Dawley rats (8–10 weeks) were purchased from Jiangsu ALF Biotechnology (China) and housed in cages. The light duration followed a normal circadian rhythm, room temperature was maintained at 22 ± 2°C, and humidity was set at 45–50%, with food and water supplied ad libitum. All animal experiments were performed in Xianyang Central Hospital, on the premise of complying with the guidelines of the China Council on Animal Care and Use and acquiring the approval from the Committee of Experimental Animals of Xianyang Central Hospital (S202008019).

2.2 Bioinformatics assay

GSE73953 dataset was downloaded from the Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/), which included peripheral blood mononuclear cell samples of IgA nephropathy, MN, and healthy controls. The “limma” R package was used to analyze the samples of MN (n = 8) and healthy controls (n = 16) in the GSE73953 dataset, and then the volcano map and heat map were acquired. The gene functional enrichment and signaling pathway enrichment of upregulated genes were analyzed by Gene Ontology (GO, http://geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG, https://www.kegg.jp/).

2.3 Cell culture

Podocyte cell line AB8/13 (152135, Ximbio, UK) was cultured in RPMI 1640 medium (PM150110, Procell, China) supplemented with 10% fetal bovine serum (164210-500, Procell) and 1% penicillin–streptomycin solution (PB180120, Procell) at 37°C with 5% CO2.

2.4 Cell transfection

Smad3 overexpression plasmid was constructed using pcDNA3.1 (V79520, Invitrogen, USA). Then, Smad3 overexpression plasmid, empty vector (negative control, NC), small interfering RNA (siRNA) targeting MSTN (siMSTN, siG000002660A-1-5, Ribobio, China), and siRNA negative control (siNC, siN0000001-1-5, Ribobio) were transfected into AB8/13 cells by Lipo6000 transfection reagent (C0526, Beyotime, China) according to the supplied instruction. Later, the successful transfection was confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot.

2.5 Establishment of MN model and grouping

An in vivo MN rat model was established by the induction of cationized-bovine serum albumin (c-BSA) with reference to the previous methods [16]. Briefly, c-BSA (BSA; 23210, Thermo Scientific, USA) was prepared according to Border’s method [17], and then each rat was intravenously injected with 50 mg/kg of c-BSA that had been dissolved in 0.5 mL 0.01 M phosphate-buffered saline (PBS; PB180327, Procell, China) through the tail vein every day for 14 days. Thereafter, c-BSA-induced MN model rats were injected with 30 pmol/g of short hairpin RNA targeting MSTN (sh-MSTN, GACTGTACATGCATTAAAATTTT) or shRNA negative control (sh-NC) lentivirus that were constructed by pGLVU6/GFP lentiviral interference vector (C06001, Genepharma, China) via tail vein [18]. All rats were divided into the four groups: control group (rats received equal volume of PBS), model group (c-BSA-induced MN model rats), model + sh-NC group (model rats were injected with sh-NC via tail vein), and model + sh-MSTN group (model rats were injected with sh-MSTN via tail vein), with ten rats in each group. Ten days after c-BSA induction, rats were sacrificed by cervical dislocation to obtain the kidney tissues.

An in vitro MN cell model was established by stimulating AB8/13 cells with 100 nmol/L of Angiotensin II (Ang II, 4474-91-3, MedChemExpress, China) for 24 h [19]. All cells were grouped into two parts. The groups in the first part were as follows: control group (normal cells), model group (Ang II-treated cells), model + siNC group (siNC-transfected cells were treated with Ang II), and model + siMSTN group (siMSTN-transfected cells were treated with Ang II). In the second part, there were four groups: model + siNC + NC, model + siMSTN + NC, model + siNC + Smad3, and model + siMSTN + Smad3 groups. In the model + siNC + NC and model + siMSTN + NC groups, Ang II was administrated on cells transfected with siNC/siMSTN and NC, while in the model + siNC + Smad3 and model + siMSTN + Smad3 groups, cells were transfected with siNC/siMSTN and Smad3 overexpression plasmid, and then exposed to Ang II.

2.6 Hematoxylin and eosin (H&E) staining

The partial kidney tissues of rats were fixed in 4% paraformaldehyde (AR1068, Bosterbio, USA) at room temperature overnight, then dehydrated and embedded in paraffin, and sectioned in serial cross-sections. Next, the 5 µm thick sections were successively stained with hematoxylin (H3136, Sigma-Aldrich, USA) and eosin (E4009, Sigma-Aldrich, USA). Ultimately, the photomicrograph of the stained sections was captured under a microscope (×200, ×600, Leica Microsystems, Germany).

2.7 Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay

The apoptotic cells in rat kidney tissues were identified using TUNEL kit (40306ES20, Qcbio, China) according to the supplied protocol. In short, rat kidney tissue sections were immersed in 4% paraformaldehyde and PBS at room temperature for 15 min, respectively, and then permeabilized with proteinase K for 10 min. Thereafter, the tissue sections were incubated with TUNEL reaction buffer at 37°C for 2 h, and then counterstained with WT-1 staining to visualize podocytes. Eventually, the TUNEL-positive cells and WT-1-positive cells were visualized by Olympus CX43 microscope (Japan) at ×200 magnification. A total of 50 glomeruli per kidney were calculated.

2.8 QRT-RCR

Total RNA of cells and rat kidney tissues was extracted by Triquick Reagent (R1100, Solarbio, China), and reversely transcribed to cDNA using Universal RT-PCR Kit (RP1105, Solarbio, China) according to the manufacturer’s instructions. MSTN expression was determined by SYBR Green PCR Mastermix (SR1110, Solarbio, China) using an ABI7900-HT-Fast device (Applied Biosystems, USA) in according with the protocols of manufacturer, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as the endogenous control. Subsequently, the data calculation was performed by the 2−ΔΔCT method [20]. The sequences of the reverse (R) and forward (F) primers are listed from 5′ to 3′: MSTN, (F) GGCATGGTAATGATTGTTTCCGTG, (R) TTTACCTGTTTGTGCTGATTGCTGC; GAPDH (F) AAATGGTGAAGGTCGGTGTGAAC, (R) CAACAATCTCCACTTTGCCACTG.

2.9 Cell counting Kit-8 (CCK-8) assay

The 5 × 103 cells per well were inoculated into 96-well plate. 24 and 48 h post-transfection, 20 μL CCK-8 reagent (E606335, Sangon, China) was added to each well and incubated the cells for an additional 4 h. The final absorbance was tested by a microplate reader (VL0000D2, ThermoFisher, USA) at a wavelength of 450 nm.

2.10 Flow cytometry

The cell apoptosis was tested by Annexin V-FITC/propidium iodide (PI) Apoptosis Detection Kit (A211-01, Vazyme, China). In brief, AB8/13 cells were plated in a six-well plate and cultured for 48 h. Afterward, the cells were washed with binding buffer and centrifuged at 1,300 rpm for 3 min. Thereafter, the cell pellet was resuspended in 200 μL of binding buffer. Finally, the cells were stained with 5 μL Annexin V-FITC and PI in the dark for 15 min and detected by a CytoFLEX flow cytometer (Beckman Coulter, USA).

2.11 Western blot

The total protein of cells and rat kidney tissues was extracted with RIPA Lysis Buffer (C500007, Sangon, China), and the protein concentration was determined using BCA assay kit (C503021, Sangon, China). An equivalent of 30 μg protein extract and 5 µL marker (PR1910, Solarbio, China) were resolved on the SDS-PAGE, followed by being transferred onto PVDF membrane (IPFL00010, Millipore, USA). Next, the protein blot was blocked with skim milk, and probed with primary antibodies, followed by further incubation with appropriate secondary antibody goat anti-rabbit IgG (1:2,000, ab7090; abcam, UK). Subsequently, immunoreactive bands were detected using an ECL kit (ab133409; abcam). GAPDH served as an internal control. The protein bands on X-ray films were quantified with a Tanon 5200 imaging system (Tanon, China). The primary antibodies from abcam and Cell Signaling Technology (CST) are listed as follows: Bax (1:2,000; Rabbit; ab182733, 21 kDa; abcam), Bcl-2 (1:500; Rabbit; ab194583, 26 kDa; abcam), Cleaved Caspase 3 (1:1,000; Rabbit; #9661, 17 kDa; CST), p-Smad3 (1:2,000; Rabbit; ab52903, 48 kDa; abcam), Smad3 (1:1,000; Rabbit; ab40854, 48 kDa; abcam), p-protein kinase A (p-PKA, 1:1,000; Rabbit; #5661, 42 kDa; CST), PKA (1:1,000; Rabbit; #4782, 42 kDa; CST), NADPH oxidase 4 (Nox4, 1:1,000; Rabbit; ab154244, 67 kDa; abcam), and GAPDH (1:10,000; Rabbit; ab181602, 36 kDa).

2.12 Statistical analysis

Statistical analysis was performed using GraphPad Prism 8.0. The measurement data were expressed as mean ± standard deviation. One-way analysis of variance was adopted for multiple group comparisons, and Bonferroni test was applied for further analyses. Differences with p < 0.05 were considered to be statistically significant.

3 Results

3.1 MSTN was an upregulated gene in MN and was related to apoptosis

Through the analysis on GSE73953 dataset comprising of microarray data from MN patients and healthy controls, we discovered from the volcano map that a large number of aberrantly expressed genes met the screening conditions (|logFC| > 1, p < 0.05, Figure 1a). In addition, the heat map (Figure 1b) displayed the differential genes in peripheral blood mononuclear cells from healthy controls (G1 group) or MN patients (G2 group). Combined the results of these two figures, it could be observed that MSTN presented the most obvious upregulation (Figure 1). Meanwhile, the upregulated genes in GSE73953 were analyzed by KEGG and GO. It turned out that upregulated genes were closely related to the biological processes including autophagy (animal) and apoptosis (Figure 2a). In addition, the gene enrichment ratio was remarkably increased during the ribonucleoprotein complex biogenesis, neutrophil degranulation, ncRNA metabolic process, and other processes (Figure 2b). Based on the above results, it could be concluded that MSTN with upregulated expression in MN may be related to autophagy, apoptosis, and other biological changes. Accordingly, we hereby focused on its effect on apoptosis.

Figure 1 
                  Differentially expressed genes in GSE73953 dataset. (a) Volcano map of differentially expressed genes in GSE73953 dataset. Fold change represents the degree of gene upregulation or downregulation in the dataset, while the dash-dotted lines are used to distinguish the genes (|logFC| > 1). p < 0.05. (b) Heat map of differentially expressed genes in GSE73953 dataset. G1 group represents the peripheral blood mononuclear cells from 16 healthy controls, while G2 group refers to peripheral blood mononuclear cells from eight membranous nephropathy patients. Each row denotes different samples in G1 and G2 groups, and each column represents differential genes in the G1 and G2 group.
Figure 1

Differentially expressed genes in GSE73953 dataset. (a) Volcano map of differentially expressed genes in GSE73953 dataset. Fold change represents the degree of gene upregulation or downregulation in the dataset, while the dash-dotted lines are used to distinguish the genes (|logFC| > 1). p < 0.05. (b) Heat map of differentially expressed genes in GSE73953 dataset. G1 group represents the peripheral blood mononuclear cells from 16 healthy controls, while G2 group refers to peripheral blood mononuclear cells from eight membranous nephropathy patients. Each row denotes different samples in G1 and G2 groups, and each column represents differential genes in the G1 and G2 group.

Figure 2 
                  KEGG and GO analyses of upregulated genes in GSE73953 dataset. (a) KEGG analysis of signaling pathway enrichment in upregulated genes (https://www.kegg.jp/). (b) GO analysis of upregulated gene functional enrichment (http://geneontology.org/). Abbreviation: KEGG, Kyoto encyclopedia of genes and genomes; GO, gene ontology.
Figure 2

KEGG and GO analyses of upregulated genes in GSE73953 dataset. (a) KEGG analysis of signaling pathway enrichment in upregulated genes (https://www.kegg.jp/). (b) GO analysis of upregulated gene functional enrichment (http://geneontology.org/). Abbreviation: KEGG, Kyoto encyclopedia of genes and genomes; GO, gene ontology.

3.2 Silenced MSTN alleviated Ang II-induced AB8/13 cell injury via regulating Smad3/PKA/Nox4 signaling pathway

Next, siMSTN was transfected into AB8/13 cells and then resulted in the marked decrease in MSTN expression (p < 0.001, Figure A1), which evidenced the specificity of MSTN knockdown. To assess the function of MSTN in MN model cells, MSTN expression level was also knocked down in Ang II-induced AB8/13 cells. As depicted in Figure 3a, the expression of MSTN was largely increased in the model group, while being lessened in model + siMSTN group, indicating that the knockdown of MSTN suppressed the Ang II-induced MSTN expression (p < 0.001). After the modeling, Ang II stimulation prominently reduced the viability yet enhanced the apoptosis of AB8/13 cells (p < 0.01, Figure 3b–d). Based on the treatment of Ang II, silenced MSTN evidently increased the viability and suppressed the apoptosis of AB8/13 cells (p < 0.05, Figure 3b–d).

Figure 3 
                  Effects of siMTSN on the viability and apoptosis of Ang II-induced AB8/13 cells. AB8/13 cells were treated with Ang II (100 nmol/L) to induce MN cell model, followed by the transfection of siNC or siMSTN. (a) Expression of MSTN in the control, model, model + siNC, and model + siMSTN groups was quantified by qRT-PCR, with GAPDH serving as the internal reference. (b) OD value of AB8/13 cells at 24 and 48 h was assessed by CCK-8 assay. (c and d) AB8/13 cell apoptosis was determined by flow cytometry. All experiments were repeated three times to obtain average values. The data are presented as the mean ± SD of three independent experiments; &&
                     p < 0.01, &&&
                     p < 0.001 vs Control; +
                     p < 0.05; ++
                     p < 0.01; +++
                     p < 0.001 vs Model + siNC. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; Ang II, angiotensin II; qRT-PCR, quantitative real-time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OD, optical density; CCK-8, cell counting kit-8; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.
Figure 3

Effects of siMTSN on the viability and apoptosis of Ang II-induced AB8/13 cells. AB8/13 cells were treated with Ang II (100 nmol/L) to induce MN cell model, followed by the transfection of siNC or siMSTN. (a) Expression of MSTN in the control, model, model + siNC, and model + siMSTN groups was quantified by qRT-PCR, with GAPDH serving as the internal reference. (b) OD value of AB8/13 cells at 24 and 48 h was assessed by CCK-8 assay. (c and d) AB8/13 cell apoptosis was determined by flow cytometry. All experiments were repeated three times to obtain average values. The data are presented as the mean ± SD of three independent experiments; && p < 0.01, &&& p < 0.001 vs Control; + p < 0.05; ++ p < 0.01; +++ p < 0.001 vs Model + siNC. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; Ang II, angiotensin II; qRT-PCR, quantitative real-time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OD, optical density; CCK-8, cell counting kit-8; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.

Next, the protein expressions related to apoptosis and Smad3/PKA/Nox4 signaling pathway were detected to probe how MSTN silencing affected the viability and apoptosis of AB8/13 cells. Consequently, the increased expressions of Bax and cleaved Caspase-3 as well as the decreased expression of Bcl-2 that were induced by Ang II treatment were all reversely regulated by siMSTN (p < 0.05, Figure 4a–d). Similarly, lower levels of Nox4 expression and p-Smad3/Smad3 and higher level of p-PKA/PKA were observed in the model + siMSTN group than those in the model group (p < 0.01, Figure 4e–h). The above data illustrated that MSTN silencing may alleviate Ang II-induced podocyte injury through inhibiting the activation of Smad3/PKA/Nox4 signaling pathway.

Figure 4 
                  Effects of siMTSN on the protein expressions related to apoptosis and Smad3/PKA/Nox4 signaling pathway in Ang II-induced AB8/13 cells. AB8/13 cells were treated with Ang II (100 nmol/L) to induce MN cell model, followed by the transfection of siNC or siMSTN. (a–d) Expressions of apoptosis-related proteins (Bax, Bcl-2, and cleaved Caspase-3) in the control, model, model + siNC, and model + siMSTN groups were examined by western blot. GAPDH acted as the internal reference. (e–h) Expressions of Smad3/PKA/Nox4 signaling pathway-related proteins (p-Smad3, Smad3, p-PKA, PKA, and Nox4) were determined by western blot, with GAPDH serving as the internal reference. All experiments were repeated three times to obtain average values. The data are described as the mean ± SD of three independent experiments; &&
                     p < 0.01, &&&
                     p < 0.001 vs Control; +
                     p < 0.05; ++
                     p < 0.01; +++
                     p < 0.001 vs Model + siNC. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; Ang II, angiotensin II; p-PKA, phosphorylated-protein kinase A; Nox4, NADPH oxidase 4; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.
Figure 4

Effects of siMTSN on the protein expressions related to apoptosis and Smad3/PKA/Nox4 signaling pathway in Ang II-induced AB8/13 cells. AB8/13 cells were treated with Ang II (100 nmol/L) to induce MN cell model, followed by the transfection of siNC or siMSTN. (a–d) Expressions of apoptosis-related proteins (Bax, Bcl-2, and cleaved Caspase-3) in the control, model, model + siNC, and model + siMSTN groups were examined by western blot. GAPDH acted as the internal reference. (e–h) Expressions of Smad3/PKA/Nox4 signaling pathway-related proteins (p-Smad3, Smad3, p-PKA, PKA, and Nox4) were determined by western blot, with GAPDH serving as the internal reference. All experiments were repeated three times to obtain average values. The data are described as the mean ± SD of three independent experiments; && p < 0.01, &&& p < 0.001 vs Control; + p < 0.05; ++ p < 0.01; +++ p < 0.001 vs Model + siNC. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; Ang II, angiotensin II; p-PKA, phosphorylated-protein kinase A; Nox4, NADPH oxidase 4; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.

3.3 Smad3 overexpression reversed the effects of siMSTN on the viability, apoptosis, and PKA/Nox4 signaling pathway in AB8/13 cells

To further uncover the interaction between MSTN and Smad3 in MN model cells, we overexpressed Smad3 in AB8/13 cells and found that Smad3 overexpression promoted the expressions of p-Smad3 and Smad3 (p < 0.01, Figure 5a–d), which illustrated that the transfection was successful. Additionally, the cell viability was reduced but the apoptosis rate was induced in the model + siNC + Smad3 group in comparison with those in the model + siNC + NC group (p < 0.05, Figure 5e–g). Meanwhile, the impacts of MSTN silencing on increasing the cell viability and decreasing the cell apoptosis were negated by Smad3 overexpression (p < 0.05, Figure 5e–g).

Figure 5 
                  Effects of overexpressed Smad3 on the viability and apoptosis of MN model cells. AB8/13 cells were treated with Ang II (100 nmol/L) to induce MN cell model, followed by the transfection of siNC or siMSTN and NC or Smad3 overexpression plasmid. (a–d) Protein expressions of p-Smad3 and Smad3 as well as p-Smad3/Smad3 ratio were detected by western blot. GAPDH functioned as the internal reference. (e) CCK-8 assay was employed to measure the cell viability after the transfection and modeling. (f and g) Flow cytometry was applied to test the apoptosis of AB8/13 cells after the transfection and modeling. All experiments were repeated three times to obtain average values. The data are exhibited as the mean ± SD of three independent experiments; &
                     p < 0.05, &&
                     p < 0.01, &&&
                     p < 0.001 vs Model + siNC + NC; +
                     p < 0.05; ++
                     p < 0.01; +++
                     p < 0.001 vs Model + siMSTN + NC; ^^
                     p < 0.01, ^^^
                     p < 0.001 vs Model + siNC + Smad3. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CCK-8, cell counting kit-8; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.
Figure 5

Effects of overexpressed Smad3 on the viability and apoptosis of MN model cells. AB8/13 cells were treated with Ang II (100 nmol/L) to induce MN cell model, followed by the transfection of siNC or siMSTN and NC or Smad3 overexpression plasmid. (a–d) Protein expressions of p-Smad3 and Smad3 as well as p-Smad3/Smad3 ratio were detected by western blot. GAPDH functioned as the internal reference. (e) CCK-8 assay was employed to measure the cell viability after the transfection and modeling. (f and g) Flow cytometry was applied to test the apoptosis of AB8/13 cells after the transfection and modeling. All experiments were repeated three times to obtain average values. The data are exhibited as the mean ± SD of three independent experiments; & p < 0.05, && p < 0.01, &&& p < 0.001 vs Model + siNC + NC; + p < 0.05; ++ p < 0.01; +++ p < 0.001 vs Model + siMSTN + NC; ^^ p < 0.01, ^^^ p < 0.001 vs Model + siNC + Smad3. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CCK-8, cell counting kit-8; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.

Moreover, the downregulation of Bax and cleaved Caspase-3 and the upregulation of Bcl-2 induced by siMSTN was also counteracted by Smad3 overexpression (p < 0.05, Figure 6a–d). The similar effect was seen with overexpressed Smad3 on PKA/Nox4 signaling pathway. In detail, Smad3 overexpression neutralized the effect of siMSTN and promoted the expression of Nox4 but reduced p-PKA/PKA level (p < 0.01, Figure 6e–g). To conclude, overexpressed Smad3 could reverse the effects of siMSTN on regulating the viability, apoptosis, and PKA/Nox4 signaling pathway in AB8/13 cells.

Figure 6 
                  Effects of overexpressed Smad3 on the protein expressions related to apoptosis and PKA/Nox4 signaling pathway in MN model cells. AB8/13 cells were treated with Ang II (100 nmol/L) to induce MN cell model, followed by the transfection of siNC or siMSTN and NC or Smad3 overexpression plasmid. (a–d) Expressions of apoptosis-related proteins in the model + siNC + NC, model + siMSTN + NC, model + siNC + Smad3, and model + siMSTN + Smad3 groups were determined by western blot, with GAPDH serving as the internal reference. (e–g) After the transfection, the PKA/Nox4 signaling pathway-related protein expressions were detected by western blot, with GAPDH acting as the internal reference. All experiments were repeated three times to obtain average values. The data are displayed as the mean ± SD of three independent experiments; &
                     p < 0.05, &&
                     p < 0.01, &&&
                     p < 0.001 vs Model + siNC + NC; +
                     p < 0.05; ++
                     p < 0.01; +++
                     p < 0.001 vs Model + siMSTN + NC; ^
                     p < 0.05, ^^
                     p < 0.01, ^^^
                     p < 0.001 vs Model + siNC + Smad3. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; p-PKA, phosphorylated-protein kinase A; Nox4, NADPH oxidase 4; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.
Figure 6

Effects of overexpressed Smad3 on the protein expressions related to apoptosis and PKA/Nox4 signaling pathway in MN model cells. AB8/13 cells were treated with Ang II (100 nmol/L) to induce MN cell model, followed by the transfection of siNC or siMSTN and NC or Smad3 overexpression plasmid. (a–d) Expressions of apoptosis-related proteins in the model + siNC + NC, model + siMSTN + NC, model + siNC + Smad3, and model + siMSTN + Smad3 groups were determined by western blot, with GAPDH serving as the internal reference. (e–g) After the transfection, the PKA/Nox4 signaling pathway-related protein expressions were detected by western blot, with GAPDH acting as the internal reference. All experiments were repeated three times to obtain average values. The data are displayed as the mean ± SD of three independent experiments; & p < 0.05, && p < 0.01, &&& p < 0.001 vs Model + siNC + NC; + p < 0.05; ++ p < 0.01; +++ p < 0.001 vs Model + siMSTN + NC; ^ p < 0.05, ^^ p < 0.01, ^^^ p < 0.001 vs Model + siNC + Smad3. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; p-PKA, phosphorylated-protein kinase A; Nox4, NADPH oxidase 4; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.

3.4 MSTN silencing alleviated renal tissue injury and cell apoptosis in MN model rats via Smad3/PKA/Nox4 signaling pathway

As depicted in Figure 7a, there was a high expression of MSTN in the model group (p < 0.001, Figure 7a), while the treatment of sh-MSTN diminished the MSTN expression in model rats (p < 0.001, Figure 7a). The results of H&E staining assay mirrored that in the kidney tissues of model rats, the glomerulus was obviously swollen, the GBM was thickened, the capillary ring was compressed, the lumen was narrow or even closed, the balloon lumen became narrow or even adhesion occurred, mesangial cells and matrix proliferated, part of renal tubular epithelium was swollen, interstitial collagen fiber deposition was obvious, and the degree of fibrosis was high, while the renal tissue injury was dramatically mitigated in the rats of model + sh-MSTN group (Figure 7b). Concurrently, the number of TUNEL-positive rat renal cells was increased by a large margin after modeling (Figure 7c). Moreover, the podocytes stained with WT-1 were decreased in the model group as compared with those in the control group (Figure 7c). After the modeling, these changes in TUNEL-positive cells and WT-1-positive cells were remarkably reversed by sh-MSTN (Figure 7c).

Figure 7 
                  Effect of sh-MSTN on the kidney injury in MN model rats. MN model rats were induced by c-BSA and then injected with 30 pmol/g of sh-MSTN or sh-NC. (a) Expression of MSTN in kidney tissues of rats in the control, model, model+sh-NC and model+sh-MSTN groups was detected by qRT-PCR, with GAPDH serving as the internal reference. (b) H&E staining was adopted to evaluate the renal pathological status of rats in each group (magnification ×200, ×600, scale bar = 200 µm). (c) TUNEL assay was utilized to determine the apoptosis of rat renal cells in each group (magnification ×200, scale bar = 200 µm). All experiments were repeated three times to obtain average values. The data are expressed as the mean ± SD of three independent experiments; &&&
                     p < 0.001 vs control; +++
                     p < 0.001 vs Model+sh-NC. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; H&E, hematoxylin and eosin; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling; sh-MSTN, short hairpin RNA targeting MSTN; sh-NC, shRNA negative control.
Figure 7

Effect of sh-MSTN on the kidney injury in MN model rats. MN model rats were induced by c-BSA and then injected with 30 pmol/g of sh-MSTN or sh-NC. (a) Expression of MSTN in kidney tissues of rats in the control, model, model+sh-NC and model+sh-MSTN groups was detected by qRT-PCR, with GAPDH serving as the internal reference. (b) H&E staining was adopted to evaluate the renal pathological status of rats in each group (magnification ×200, ×600, scale bar = 200 µm). (c) TUNEL assay was utilized to determine the apoptosis of rat renal cells in each group (magnification ×200, scale bar = 200 µm). All experiments were repeated three times to obtain average values. The data are expressed as the mean ± SD of three independent experiments; &&& p < 0.001 vs control; +++ p < 0.001 vs Model+sh-NC. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; H&E, hematoxylin and eosin; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling; sh-MSTN, short hairpin RNA targeting MSTN; sh-NC, shRNA negative control.

In addition, sh-MSTN had the reversal effect on the high expressions of Bax and cleaved Caspase-3 and low expression of Bcl-2 in the kidney tissues of model rats (p < 0.05, Figure 8a–d). The enhancement of Nox4 and p-Smad3/Smad3 levels, together with the inhibition of p-PKA/PKA level, was observable in model rat kidney tissues (p < 0.05, Figure 8e–h), whereas sh-MSTN offset these alterations of protein expression levels (p < 0.05, Figure 8e–h). All in all, MSTN silencing alleviated renal tissue injury and cell apoptosis in MN model rats through blocking Smad3/PKA/Nox4 signaling pathway.

Figure 8 
                  Effects of sh-MSTN on the apoptosis and expressions of Smad3/PKA/Nox4 signaling pathway-related proteins in MN model rats. MN model rats were induced by c-BSA and then subjected to injection with 30 pmol/g of sh-MSTN or sh-NC. (a–d) Expression levels of the apoptosis-related proteins in rat renal tissues were examined by western blot, with GAPDH acting as the internal reference. (e–h) Western blot was also performed to measure the expressions of Smad3/PKA/Nox4 signaling pathway-related proteins in rat renal tissues, with GAPDH functioning as the internal reference. All experiments were repeated three times to obtain average values. The data are presented as the mean ± SD of three independent experiments; &
                     p < 0.05, &&
                     p < 0.01, &&&
                     p < 0.001 vs Control; +
                     p < 0.05, ++
                     p < 0.01, +++
                     p < 0.001 vs Model + sh-NC. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; p-PKA, phosphorylated-protein kinase A; Nox4, NADPH oxidase 4; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; sh-MSTN, short hairpin RNA targeting MSTN; sh-NC, shRNA negative control.
Figure 8

Effects of sh-MSTN on the apoptosis and expressions of Smad3/PKA/Nox4 signaling pathway-related proteins in MN model rats. MN model rats were induced by c-BSA and then subjected to injection with 30 pmol/g of sh-MSTN or sh-NC. (a–d) Expression levels of the apoptosis-related proteins in rat renal tissues were examined by western blot, with GAPDH acting as the internal reference. (e–h) Western blot was also performed to measure the expressions of Smad3/PKA/Nox4 signaling pathway-related proteins in rat renal tissues, with GAPDH functioning as the internal reference. All experiments were repeated three times to obtain average values. The data are presented as the mean ± SD of three independent experiments; & p < 0.05, && p < 0.01, &&& p < 0.001 vs Control; + p < 0.05, ++ p < 0.01, +++ p < 0.001 vs Model + sh-NC. Abbreviation: MN, membranous nephropathy; MSTN, myostatin; p-PKA, phosphorylated-protein kinase A; Nox4, NADPH oxidase 4; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; sh-MSTN, short hairpin RNA targeting MSTN; sh-NC, shRNA negative control.

4 Discussion

MN is a glomerular disease caused by multiple etiologies, and a decrease in podocyte number is a contributing factor to the pathogenesis of MN, while podocyte apoptosis can lead to podocyte decrease, signifying that podocyte apoptosis is related to the occurrence of MN [21]. Through the bioinformatics analyses, we found the strong correlation between the upregulated genes in GSE73953 dataset and apoptosis, and MSTN was the most apparently upregulated gene. Accordingly, we speculated that MSTN may participate in the pathological process of MN by regulating podocyte apoptosis. Our experimental results proved that MSTN silencing hindered the apoptosis in MN model cells and rats, and alleviated the rat kidney injury, confirming its potential as a target for the treatment of MN.

MSTN belongs to the transforming growth factor-β (TGF-β) superfamily, TGF-β is currently known as the most predominant factor leading to fibrosis, which is involved in the regulation of cell growth, glomerular mesangial cell proliferation, and extracellular matrix formation [22]. Smad protein family is directly involved in the signal transduction of TGF-β superfamily members and is the initiating factor in the intracellular signaling of TGF-β, while activated TGF-β receptors can regulate the transcription of substances in the nucleus through Smad 2, 3, and 4 [23]. It has been proved that negative auto-regulation of MSTN expression is mediated by Smad3 [24], and long noncoding RNA TSI could inhibit renal fibrogenesis through negatively regulating the TGF-β/Smad3 pathway [25]. In this study, we found that the protein expression of p-Smad3 was activated in model cells, while MSTN silencing inhibited the activation of p-Smad3, which was consistent to the results in the study by Retamales et al. [14]. Therefore, MSTN silencing may repress the podocyte apoptosis in MN model via regulating Smad3 and its downstream pathways, while this mechanism has never been revealed before.

It has been elucidated that TGF-β is one of the targets of cyclic adenosine monophosphate (cAMP)/PKA/cAMP-responsive element binding protein (CREB) signaling pathway [26]. As previously documented, upregulation of cAMP inhibits fibroblast proliferation, blocks the transformation of AngII/TGF-β1-induced fibroblast to myofibroblasts, and reduces extracellular matrix deposition [27]. PKA is the key downstream target of cAMP, and activated PKA can phosphorylate serine 133 (Ser133) of CREB [28]. Besides, p-CREB can competitively bind to CREB binding protein with the Smad complex, leading to the decrease in the level of p-Smad3 [29,30]. In addition, NOX is a kind of NADPH oxidase homolog that consists of seven different subunits (Nox1, NOX2, NOX3, NOX4, NOX5, Duox1, and Duox 2), which is an important inducer of oxidative stress [31]. In rat podocytes, NOX4 is mainly located in the mitochondria, and the mitochondrial membrane potential is signally depolarized by the TGF-β1-mediated upregulation of NOX4. TGF-β1 can cause an increase in NOX4 expression, ROS generation, loss of mitochondrial membrane potential, and caspase-3 activation, while these effects of TGF-β1 can be offset by knockdown of either Smad2 or Smad3 [32]. Also, the study of Guo et al. mentioned that Smad3 could upregulate the expression of Nox4 and suppress PKA activity to regulate the podocyte apoptosis triggered by HG [15]. Similar to the previous literature, our research revealed that knockdown of MSTN reduced the expression of Nox4 but augmented p-PKA/PKA level in both MN cells and rat models, whereas Smad3 overexpression reversed its function and contributed to the upregulation of Nox4 and the decline of p-PKA/PKA. These results implied that the MSTN knockdown exerted its anti-apoptotic effect through the Smad3/PKA/Nox4 pathway. Notably, our study was the first to elucidate the association between MSTN and Smad3/PKA/Nox4 signaling pathway in the progression of MN.

Besides, the occurrence of apoptosis is usually regulated by Bcl-2 and Bax inside the mitochondria, in which Bcl-2 can prevent the release of cytochrome c into the cytosol to inhibit apoptosis, whereas the effect of Bax is exactly the opposite [33]. Caspase-3 is the final executor in the process of apoptosis, and its activation can directly lead to cell apoptosis [34]. The results of western blot in the present study demonstrated that Bax and cleaved Caspase-3 expressions were upregulated, while the expression of Bcl-2 was downregulated in Ang-II-stimulated podocytes, suggesting the promotion of apoptosis in model cells. Moreover, MSTN knockdown hindered the apoptosis by reversely regulating these protein expressions, and Smad3 upregulation was able to countervail its effect.

Collectively, MSTN silencing mitigates the podocyte apoptosis in MN models by modulating Smad3/PKA/Nox4 pathway, hinting its potential as an indicator in molecular targeted therapy of MN. Nevertheless, only one podocyte cell line was selected in this article, and more podocyte cell lines will be chosen in our future study.


# These authors contributed equally to this work.


Acknowledgements

Not applicable.

  1. Funding information: Not applicable.

  2. Conflict of interest: The authors declare no conflicts of interest.

  3. Data availability statement: The analyzed data sets generated during the study are available from the corresponding author on reasonable request.

Appendix

Figure A1 
                  Effects of siMTSN on the expression of MTSN in AB8/13 cells. &&&
                     p < 0.001 vs. control + siNC. Abbreviation: MSTN, myostatin; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.
Figure A1

Effects of siMTSN on the expression of MTSN in AB8/13 cells. &&& p < 0.001 vs. control + siNC. Abbreviation: MSTN, myostatin; siMSTN, small interfering RNA targeting MSTN; siNC, siRNA negative control.

References

[1] Ronco P, Debiec H. Pathophysiological advances in membranous nephropathy: time for a shift in patient’s care. Lancet. 2015;385(9981):1983–92.10.1016/S0140-6736(15)60731-0Search in Google Scholar PubMed

[2] Sinico RA, Mezzina N, Trezzi B, Ghiggeri GM, Radice A. Immunology of membranous nephropathy: from animal models to humans. Clin Exp Immunol. 2016;183(2):157–65.10.1111/cei.12729Search in Google Scholar PubMed PubMed Central

[3] Seitz-Polski B, Lambeau G, Esnault V. Membranous nephropathy: pathophysiology and natural history. Nephrol Ther. 2017;13(Suppl 1):S75–81.10.1016/j.nephro.2017.01.012Search in Google Scholar PubMed

[4] Ponticelli C, Glassock RJ. Glomerular diseases: membranous nephropathy–a modern view. Clin J Am Soc Nephrol. 2014;9(3):609–16.10.2215/CJN.04160413Search in Google Scholar PubMed PubMed Central

[5] Cattran DC, Brenchley PE. Membranous nephropathy: integrating basic science into improved clinical management. Kidney Int. 2017;91(3):566–74.10.1016/j.kint.2016.09.048Search in Google Scholar PubMed

[6] Zhou G, Zhang X, Wang W, Zhang W, Wang H, Xin G. Both peripheral blood and urinary miR-195-5p, miR-192-3p, miR-328-5p and their target genes PPM1A, RAB1A and BRSK1 may be potential biomarkers for membranous nephropathy. Med Sci Monit. 2019;25:1903–16.10.12659/MSM.913057Search in Google Scholar PubMed PubMed Central

[7] Sharma M, McFarlane C, Kambadur R, Kukreti H, Bonala S, Srinivasan S. Myostatin: expanding horizons. IUBMB Life. 2015;67(8):589–600.10.1002/iub.1392Search in Google Scholar PubMed

[8] Gonzalez-Cadavid NF, Taylor WE, Yarasheski K, Sinha-Hikim I, Ma K, Ezzat S, et al. Organization of the human myostatin gene and expression in healthy men and HIV-infected men with muscle wasting. Proc Natl Acad Sci U S A. 1998;95(25):14938–43.10.1073/pnas.95.25.14938Search in Google Scholar PubMed PubMed Central

[9] Aiello D, Patel K, Lasagna E. The myostatin gene: an overview of mechanisms of action and its relevance to livestock animals. Anim Genet. 2018;49(6):505–19.10.1111/age.12696Search in Google Scholar PubMed

[10] Gao L, Yang M, Wei Z, Gu M, Yang L, Bai C, et al. MSTN mutant promotes myogenic differentiation by increasing demethylase TET1 expression via the SMAD2/SMAD3 pathway. Int J Biol Sci. 2020;16(8):1324–34.10.7150/ijbs.40551Search in Google Scholar PubMed PubMed Central

[11] Zhu X, Topouzis S, Liang LF, Stotish RL. Myostatin signaling through Smad2, Smad3 and Smad4 is regulated by the inhibitory Smad7 by a negative feedback mechanism. Cytokine. 2004;26(6):262–72.10.1016/j.cyto.2004.03.007Search in Google Scholar PubMed

[12] Verzola D, Barisione C, Picciotto D, Garibotto G, Koppe L. Emerging role of myostatin and its inhibition in the setting of chronic kidney disease. Kidney Int. 2019;95(3):506–17.10.1016/j.kint.2018.10.010Search in Google Scholar PubMed

[13] Yano S, Nagai A, Isomura M, Yamasaki M, Kijima T, Takeda M, et al. Relationship between blood myostatin levels and kidney function: shimane CoHRE study. PLoS One. 2015;10(10):e0141035.10.1371/journal.pone.0141035Search in Google Scholar PubMed PubMed Central

[14] Retamales A, Zuloaga R, Valenzuela CA, Gallardo-Escarate C, Molina A, Valdés JA. Insulin-like growth factor-1 suppresses the Myostatin signaling pathway during myogenic differentiation. Biochem Biophys Res Commun. 2015;464(2):596–602.10.1016/j.bbrc.2015.07.018Search in Google Scholar PubMed

[15] Guo W, Gao H, Pan W, Yu P, Che G. High glucose induces Nox4 expression and podocyte apoptosis through the Smad3/ezrin/PKA pathway. Biol Open. 2021;10(5):bio055012.10.1242/bio.055012Search in Google Scholar PubMed PubMed Central

[16] Wang W, Li Z, Chen Y, Wu H, Zhang S, Chen X. Prediction value of serum NGAL in the diagnosis and prognosis of experimental acute and chronic kidney injuries. Biomolecules. 2020;10(7):981.10.3390/biom10070981Search in Google Scholar PubMed PubMed Central

[17] Border WA, Ward HJ, Kamil ES, Cohen AH. Induction of membranous nephropathy in rabbits by administration of an exogenous cationic antigen. J Clin Invest. 1982;69(2):451–61.10.1172/JCI110469Search in Google Scholar

[18] Li J, Chen Y, Shen L, Deng Y. Improvement of membranous nephropathy by inhibition of miR-193a to affect podocytosis via targeting WT1. J Cell Biochem. 2019;120(3):3438–46.10.1002/jcb.27616Search in Google Scholar PubMed

[19] Liu D, Liu F, Wang X, Qiao Y, Pan S, Yang Y, et al. MiR-130a-5p prevents angiotensin II-induced podocyte apoptosis by modulating M-type phospholipase A2 receptor. Cell Cycle. 2018;17(21–22):2484–95.10.1080/15384101.2018.1542901Search in Google Scholar PubMed PubMed Central

[20] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed

[21] Sun Z, Xu Q, Ma Y, Yang S, Shi J. Circ_0000524/miR-500a-5p/CXCL16 axis promotes podocyte apoptosis in membranous nephropathy. Eur J Clin Invest. 2021;51(3):e13414.10.1111/eci.13414Search in Google Scholar PubMed

[22] Isaka Y. Targeting TGF-β signaling in kidney fibrosis. Int J Mol Sci. 2018;19(9):2532.10.3390/ijms19092532Search in Google Scholar PubMed PubMed Central

[23] Ma TT, Meng XM. TGF-β/Smad and renal fibrosis. Adv Exp Med Biol. 2019;1165:347–64.10.1007/978-981-13-8871-2_16Search in Google Scholar PubMed

[24] McFarlane C, Vajjala A, Arigela H, Lokireddy S, Ge X, Bonala S, et al. Negative auto-regulation of myostatin expression is mediated by Smad3 and microRNA-27. PLoS One. 2014;9(1):e87687.10.1371/journal.pone.0087687Search in Google Scholar PubMed PubMed Central

[25] Wang P, Luo ML, Song E, Zhou Z, Ma T, Wang J, et al. Long noncoding RNA lnc-TSI inhibits renal fibrogenesis by negatively regulating the TGF-β/Smad3 pathway. Sci Transl Med. 2018;10(462):eaat2039.10.1126/scitranslmed.aat2039Search in Google Scholar PubMed

[26] Ohta Y, Nakagawa K, Imai Y, Katagiri T, Koike T, Takaoka K. Cyclic AMP enhances Smad-mediated BMP signaling through PKA-CREB pathway. J Bone Min Metab. 2008;26(5):478–84.10.1007/s00774-008-0850-8Search in Google Scholar PubMed

[27] Penke LR, Huang SK, White ES, Peters-Golden M. Prostaglandin E2 inhibits α-smooth muscle actin transcription during myofibroblast differentiation via distinct mechanisms of modulation of serum response factor and myocardin-related transcription factor-A. J Biol Chem. 2014;289(24):17151–62.10.1074/jbc.M114.558130Search in Google Scholar PubMed PubMed Central

[28] Liu Y, Xu H, Geng Y, Xu D, Zhang L, Yang Y, et al. Dibutyryl-cAMP attenuates pulmonary fibrosis by blocking myofibroblast differentiation via PKA/CREB/CBP signaling in rats with silicosis. Respir Res. 2017;18(1):38.10.1186/s12931-017-0523-zSearch in Google Scholar PubMed PubMed Central

[29] Lee HJ, Seo GY, Kim JH, Lee MR, Kim PH. Activin A stimulates mouse macrophages to express APRIL via the Smad3 and ERK/CREB pathways. Immunol Lett. 2011;140(1–2):92–6.10.1016/j.imlet.2011.07.001Search in Google Scholar PubMed

[30] Furumatsu T, Tsuda M, Taniguchi N, Tajima Y, Asahara H. Smad3 induces chondrogenesis through the activation of SOX9 via CREB-binding protein/p300 recruitment. J Biol Chem. 2005;280(9):8343–50.10.1074/jbc.M413913200Search in Google Scholar PubMed

[31] Drummond GR, Selemidis S, Griendling KK, Sobey CG. Combating oxidative stress in vascular disease: NADPH oxidases as therapeutic targets. Nat Rev Drug Discov. 2011;10(6):453–71.10.1038/nrd3403Search in Google Scholar PubMed PubMed Central

[32] Das R, Xu S, Quan X, Nguyen TT, Kong ID, Chung CH, et al. Upregulation of mitochondrial Nox4 mediates TGF-β-induced apoptosis in cultured mouse podocytes. Am J Physiol Ren Physiol. 2014;306(2):F155–67.10.1152/ajprenal.00438.2013Search in Google Scholar PubMed

[33] Hassan M, Watari H, AbuAlmaaty A, Ohba Y, Sakuragi N. Apoptosis and molecular targeting therapy in cancer. Biomed Res Int. 2014;2014:150845.10.1155/2014/150845Search in Google Scholar PubMed PubMed Central

[34] Xu H, Guan N, Ren YL, Wei QJ, Tao YH, Yang GS, et al. IP(3)R-Grp75-VDAC1-MCU calcium regulation axis antagonists protect podocytes from apoptosis and decrease proteinuria in an Adriamycin nephropathy rat model. BMC Nephrol. 2018;19(1):140.10.1186/s12882-018-0940-3Search in Google Scholar PubMed PubMed Central

Received: 2022-03-09
Revised: 2022-11-08
Accepted: 2022-11-09
Published Online: 2023-03-23

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Downloaded on 11.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0615/html
Scroll to top button