Startseite circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
Artikel Open Access

circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway

  • Jinhua Yang EMAIL logo , Chunping Yang und Ping Li
Veröffentlicht/Copyright: 11. Januar 2023
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 18 Heft 1

Abstract

This study aims to explore the role and mechanism of circ-IARS in non-small-cell lung cancer (NSCLC) progression. Expression of circ-IARS, microRNA (miR)-1252-5p, and hepatoma-derived growth factor (HDGF) was measured by real-time quantitative PCR and western blotting. The interactions among circ-IARS, miR-1252-5p, and HDGF were determined by dual-luciferase reporter assay and RNA immunoprecipitation. Cell behaviors were measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), 5-ethynyl-2′-deoxyuridine (EdU) assay, flow cytometry, scratch wound assay, and transwell assay, and validated in in vivo xenograft model. Exosomes were isolated using commercial kit, and the expression and functions of exosomal circ-IARS (exo-circ-IARS) were analyzed as described above. Results showed that the expression of circ-IARS was upregulated in NSCLC cells, NSCLC tissues, and serum exosomes from NSCLC patients. circ-IARS exhaustion antagonized cell proliferation, cell cycle progression, migration, and invasion and promoted apoptosis in NSCLC. Molecularly, circ-IARS could sponge miR-1252-5p to modulate the expression of the downstream gene HDGF. In addition, miR-1252-5p downregulation attenuated circ-IARS exhaustion-mediated effects in H1299 and A549 cells. MiR-1252-5p mimic-induced effects were relieved by increasing HDGF expression in H1299 and A549 cells. Exo-circ-IARS promoted H460 cell proliferation, migration, and invasion and inhibited cell apoptosis. Silencing circ-IARS retarded tumor growth of NSCLC cells in vivo. Thus, circ-IARS, secreted by exosomes, was a novel oncogene in NSCLC and regulated the malignant development of NSCLC cells via circ-IARS/miR-1252-5p/HDGF competing endogenous RNA regulatory axis.

Keywords: circ-IARS; miR-1252-5p; HDGF; NSCLC; exosome

1 Introduction

Lung cancer is one of the most common causes of cancer incidence and cancer death among men and women in the United States and China [1,2]. Non-small-cell lung cancer (NSCLC) accounts for approximately 85% of all lung cancer cases [3], and other cases are small-cell lung cancer. NSCLC carries a 5 year survival rate of 15% [4], and early detection could offer a favorable prognosis with a 5 year survival rate of 92% [5]. However, more than 75% of NSCLC patients are diagnosed in advanced stage or metastasis [4,6]. The current treatment approaches revolve around targeting oncogenes, and small interfering RNA (siRNA) therapy combined with nanosystems possess extraordinary potential to address the clinical needs for higher efficacy [7]. Due to the stable trend of lung cancer in China [2], it is especially important and imperative to identify novel biomolecules guiding the early detection of NSCLC and the effective treatment.

Exosomes are nano-sized particles secreted from most cells that communicate with surrounding environment by carrying and transferring informative cargos, such as protein, DNA, and RNA [8]. Increasing evidence implies that exosomes participate in physiological and pathological processes, including carcinogenesis [9]. In NSCLC, liquid biopsies have the potential as tools for diagnosis, prognosis, and prediction of response to therapy, as well as disease monitoring [10]. Moreover, exosomes are universally present in the blood and other bodily fluids [9]; their stability in blood and their similarity to the cells of origin make tumor-derived exosomes as candidate biomarkers and immunological effects for lung cancers [8,11,12].

Circular RNAs (circRNAs) are a type of non-coding RNAs that form a covalently closed continuous loop, and circRNAs are enriched and stable in exosomes [13]. Functionally, exosomal circRNAs are involved in malignant behaviors of cancer cells, such as proliferation, invasion, metastasis, and chemoresistance [13]. Previous research shed light on genome-wide transcriptome profiling of coding genes, long noncoding RNAs, and circRNAs in patients with lung adenocarcinoma (LUAD) [14], the major histological type of NSCLC. The circRNA hsa_circ_0006702 is derived from the isoleucyl-tRNA synthetase 1 (IARS) gene, thus termed circ-IARS, which is 3.6-fold higher in LUAD tumors compared with paired nontumor tissues [14]. However, the expression of circ-IARS remains undisclosed in the serum or serum exosome of NSCLC patients; moreover, whether this abnormally expressed circRNA plays important roles in biological processes of NSCLC is unknown. Thus, in this study, we intended to explore the role of circ-IARS and exosomal circ-IARS (exo-circ-IARS) in NSCLC cell growth, migration, and invasion.

CircRNAs are crucial molecules in the regulation of tumorigenesis, progression, invasion, and metastasis in lung cancers via classic circRNA/microRNA (miRNA)/messenger RNA (mRNA) regulatory network [15]. The latent circRNA/miRNA/mRNA interactions have emerged as the mechanism of exosomal circRNAs during their functions in promoting or inhibiting cancer genesis and progression [16,17]. miR-1252-5p is a miRNA that has not been studied until recent years, and hepatoma-derived growth factor (HDGF) is a novel jack-of-all-trades in cancer including NSCLC [18,19]. Through prediction of Circinteractome and StarBase online databases in the preliminary experiment, we found that circ-IARS contained the binding sites for miR-1252-5p and miR-1252-5p potentially targeted HDGF. Based on the prediction, we further analyzed whether the competing endogenous RNA (ceRNA) mechanism related to NSCLC progression involved circ-IARS, miR-1252-5p, and HDGF.

2 Materials and methods

2.1 Cell culture and cell transfection

Bronchial epithelium cell line BEAS-2B (No. KCB200922YJ), NSCLC cell lines including H1299 (No. 25803), A549 (No. 10185), and H460 (No. 30177), and human embryonic kidney (HEK) 293T (No. KCB200744YJ) were from Kunming Cell Bank (Kunming, China) or Korean Cell Line Bank (Seoul, Korea). These cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 (No. M31050; R&D systems, Minneapolis, MN, USA) or Dulbecco’s Modified Eagle Medium (DMEM, M22650; R&D systems) supplemented with 10% fetal bovine serum (No. S11550H; R&D systems). H1299 and A549 cells were exogenously transfected with small interfering RNAs (siRNAs) targeting circ-IARS (si-circ-IARS_1 and _2), miR-1252-5p mimic or inhibitor, and pcDNA3.1/Zeo(+) vector (pcDNA; EK-Bioscience) carrying HDGF (HDGF), and pCD-ciR vector (EK-Bioscience) carrying circ-IARS (circ-IARS), as well as pSilencer 4.1-CMV puro vector (pSilencer) carrying short hairpin RNA (shRNA) targeting circ-IARS (sh-circ-IARS). The siRNA targeting negative control (si-NC), NC mimic or inhibitor, and empty pcDNA and pCD-ciR, as well as pSilencer carrying sh-NC (sh-NC) served as negative controls. The transfection was performed using RNAifectin Transfection Reagent (Applied Biological Materials, Richmond, Canada) following the protocols. The oligo sequences are summarized in Table 1. Post-transfection for 36 h, the cells were harvested for RNA (/protein) isolation or functional analysis.

Table 1

Sequences of oligos and primers

Name Sequence
si-circ-IARS_1 5′–UUAGAGGAGUGUCUGAUCUGCdTdT–3′
si-circ-IARS_2 5′–AUUAGAGGAGUGUCUGAUCUGdTdT–3′
sh-circ-IARS 5′–UUAGAGGAGUGUCUGAUCUGC–3′
miR-1252-5p mimic 5′-AGAAGGAAAUUGAAUUCAUUUA-3′
miR-1252-5p inhibitor 5′–TAAATGAATTCAATTTCCTTCT–3′
si-NC 5′–UUCUCCGAACGUGUCACGUdTdT–3′
sh-NC 5′–UUCUCCGAACGUGUCACGU–3′
NC mimic 5′–ACGUGACACGUUCGGAGAATT–3′
NC inhibitor 5′–CAGUACUUUUGUGUAGUACAA–3′
circ-IARS (125nt) Forward primer 5′–TTACAGACCGGTGGATCCTG–3′
Reverse primer 5′–TGTTCTCCACTCGCACAAAC–3′
miR-1252-5p (75nt) F 5′–ACACTCCAGCTGGGAGAAGGAAATTGAATT–3′
R 5′–TGTCGTGGAGTCGGCAATTC–3′
HDGF (79nt) Forward primer 5′–AGTACAAATGCGGGGACCTG–3′
Reverse primer 5′–TCAGGCATCTCGTCAATCCG–3′
β-actin (104nt) Forward primer 5′–CTTCGCGGGCGACGAT–3′
Reverse primer 5′–CCACATAGGAATCCTTCTGACC–3′
U6 (87nt) Forward primer 5′–CGCTTCGGCAGCACATATAC–3′
Reverse primer 5′–TTCACGAATTTGCGTGTCATC–3′

2.2 Real-time quantitative PCR (RT-qPCR)

Total RNAs from tissues or cells were isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) referring to the supplier’s direction. These RNAs were reversely transcribed into the first-strand complementary DNA (cDNA) using miScript reverse transcription kit (Qiagen, Nasdaq, NK, USA) and then amplified using miScript SYBR-Green PCR kit (Qiagen) and corresponding primer pairs targeting circ-IARS, miR-1252-5p, or HDGF. Expression of actin beta (β-actin; for circ-IARS and HDGF) and U6 small nuclear RNA (U6; for miR-1252-5p) was used as the internal controls. The 2−ΔΔCt method was used to evaluate the expression levels. The primer sequences are exhibited in Table 1.

2.3 Cell proliferation assay

Cell proliferation was measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and 5-ethynyl-2′-deoxyuridine (EdU) assay using MTT Cell Proliferation and Cytotoxicity Assay Kit (Beyotime, Shanghai, China) and iClickTM EdU Andy FluorTM 555 Imaging Kit (GeneCopoeia, Rockville, MD, USA). For MTT assay, H1299, A549, and H460 cells were re-inoculated in 96-well plates at 2,000 cells/well, and cultured for another 3 days. Post-cultivation, these cells were treated with 10 μL of MTT reagent (5 mg/mL) for 4 h at 1, 2, and 3 days, and then the formazan was dissolved in 100 μL of formazan reagent for 4 h. Optical density (OD) was examined at 490 nm on microplate reader (Molecular devices, Shanghai, China). For EdU assay, cells were labelled with 10 μM EdU and reacted with Andy Fluor488 azide (Component B); then, the labelled cells were subjected to Hoechst 33342 counterstain followed by observation under fluorescence microscopy. The EdU-positive rate was expressed as the percentage of EdU-positive cells to Hoechst-positive cells.

2.4 Cell cycle analysis and apoptosis assay by flow cytometry (FCM)

Cell cycle profile was evaluated by Propidium Iodide (PI; Beyotime) staining using Cell Cycle and Apoptosis Analysis Kit (Beyotime). 1 × 105 H1299 or A549 cells were fixed in ice-cold 70% ethanol overnight and then incubated with 1× PI reagent supplemented with 1× RNase A for 30 min in the dark. DNA contents were examined and analyzed on flow cytometer (BD Biosciences, Franklin Lake, NJ, USA) and Modifit software (BD Biosciences). Cell death was determined using Annexin V-fluorescein isothiocyanate (FITC) Apoptosis Detection Kit (Beyotime). According to the protocols, 1 × 105 H1299, A549, or H460 cells were dual-stained with 5 μL of Annexin V-FITC and 10 μL of PI for 20 min in the dark and then examined on flow cytometer (BD Biosciences). Apoptotic cells were calculated as the percentage of cells in Annexin V-FITC+/PI+ and Annexin V-FITC+/PI- quadrants.

2.5 Cell migration and invasion assays

To measure cell migration, scratch wounds were generated on the surface of 24-well plates by straightly moving a 100 μL of pipette across the center of every well. The remaining 5 × 104 cells (H1299, A549, or H460) were cultured in serum-free medium, and wounds were photographed after wound healing for 0 and 24 h. Wound area was measured on ImageJ v1.52 software (National Institute of Health, Bethesda, MD, USA), and the percentage of wound closure was calculated.

Transwell (Corning, Corning, NY, USA) was utilized to measure cell invasion. First of all, transwell supports were coated with Matrigel (BD Biosciences); then, 5 × 104 H1299, A549, or H460 cells were collected in serum-free medium and seeded in the upper chamber, and the lower chamber was filled with medium containing 10% fetal bovine serum. Transwell invasion assay was incubated at 37°C for 48 h, and invaded cells on the lower surface were fixed with 4% Paraformaldehyde Fix Solution (Beyotime) and stained with Crystal Violet Staining Solution (Beyotime) for 20 min. The stained cells were observed under a microscope (100×; Olympus, Tokyo, Japan).

2.6 Dual-luciferase reporter assay and RNA immunoprecipitation (RIP)

The algorithms of Circinteractome (https://circinteractome.nia.nih.gov/mirna_target_sites.html) and StarBase (http://starbase.sysu.edu.cn/agoClipRNA.php? source = circRNA) were applied for predicting the target miRNAs in circ-IARS sequence. StarBase (http://starbase.sysu.edu.cn/agoClipRNA.php?source = mRNA) also predicted the binding sites of miR-1252-5p in HDGF. The wild type (WT) of circ-IARS and 3′-untranslated region of HDGF (HDGF 3′UTR) were synthesized, annealed, and then inserted into the SacI and HindIII sites of pMIR-REPORTER Luciferase vector (EK-Bioscience) at downstream of the stop codon of the gene for luciferase. Similarly, the mutant types (MUT) of circ-IARS and HDGF 3′UTR were generated with a mutant at the predicted miR-1252-5p-binding sites and then inserted into pMIR-REPORTER Luciferase vector (EK-Bioscience), as well. 5 × 104 HEK293T cells in 24-well plates were co-transfected with the above luciferase vectors, miR-1252-5p (/NC) mimic, and pRL-TK vector (EK-Bioscience) using RNAifectin Transfection Reagent (Applied Biological Materials). After transfection for 48 h, Firefly and Renilla luciferase activities were tested using the Dual-Luciferase Reporter assay system (Promega, Madison, WI, USA), and Renilla was used as an internal control.

Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Billerica, MA, USA) was employed to analyze the interplay between circ-IARS and miR-1252-5p. H1299 and A549 cells were lysed in RIP Lysis Buffer, and the whole cell lysate was incubated with A/G magnetic beads pre-covered with anti-Argonaute 2 (anti-AGO2; ab186733, Abcam) or anti-immunoglobulin G (anti-IgG; ab182931, Abcam) overnight at 4°C with gentle rotation. The precipitated RNA–protein complexes on the beads were washed and treated with proteinase K for 30 min to obtain precipitated RNAs, which were further isolated in TRIzol reagent (Invitrogen) for RT-qPCR analysis. IgG was employed as a negative control, and the input functioned as a positive control.

2.7 Western blotting

Total proteins in tissues and cells were extracted by Radio Immunoprecipitation Assay (RIPA) Lysis Buffer (Beyotime). After measuring protein concentration using bicinchoninic acid assay (BCA) Protein Assay Kit (Beyotime), 30 μg protein samples were separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred onto Immobilon-Nitrocellulose (NC) Transfer Membrane (Millipore), and probed with antibodies including Tumor Susceptibility 101 (TSG101), CD9, CD63, and β-actin. The β-actin was considered as the endogenous control. The antibodies are summarized in Table 2. Eventually, the protein signals were visualized by Immobilon ECL HRP substrate (Millipore) and analyzed on ImageJ v1.52 software (National Institute of Health).

Table 2

Antibodies used in western blotting

Antibody No. Dilution rate Source
HDGF #ab248221 1:1,000/1,100 Abcam
TSG101 #ab83 1:2,500 Abcam
CD63 #ab271286 1:1,000 Abcam
CD9 #ab263019 1:1,000 Abcam
Ki67 #ab15580 1:250 Abcam
β-actin #ab8226 1:2,000 Abcam
Rabbit IgG (HRP) #ab205718 1:50,000 Abcam
Mouse IgG (HRP) #ab97023 1:20,000 Abcam

2.8 Tumorigenesis in nude mice

H1299 cells transfected with shRNAs were selected with 1 µg/mL puromycin (Invitrogen) for 4 weeks to generate stable sh-circ-IARS (/NC)-transfected cells. This animal experiment was approved by the Animal Care Committee of the Zigong First People’s Hospital. According to the Animal Research Reporting of In Vivo Experiments (ARRIVE) Guidelines and the Basel Declaration, 10 BALB/c nude mice (male; Beijing Vital River Laboratory Animal Technology Company, Beijing, China) were housed and subcutaneously injected with the above stably transfected H1299 cells. Briefly, 2 × 106 cells in 100 μL of normal saline were injected into each mouse, and 5 mice were set in each group. The tumor volume was determined every 5 days during a month by measuring the tumor size (length and width) with Vernier caliper: 0.5 × length × width2. Tumor weight was examined on the last day by electronic scales. The xenograft tumor tissues were resected, paraffin-embedded, and stored. Total RNAs (/proteins) were isolated from these tumor tissues from nude mice, and immunohistochemistory (IHC) assay was used to measure the expression of HDGF and Ki67 in situ.

2.9 Clinical specimens from patients

The blood and tissue samples were collected from the Zigong First People’s Hospital. A total of 44 paired tumor tissues and adjacent non-tumor tissues were obtained from NSCLC patients during surgery and soaked in liquid nitrogen. Peripheral blood samples (3.5 mL) were from 22 NSCLC patients and 22 healthy people and put into anticoagulant-free tubes. Blood was centrifuged at 3,000 g for 10 min, and the supernatant was harvested as serum samples. Clinicopathological factors of NSCLC patients and healthy volunteers are presented in Table A1. All the experiments were performed in accordance with the Code of Ethics of the World Medical Association. All subjects signed the written informed consents and this study was supported by the Ethics Committee of Zigong First People’s Hospital. Later, tissue samples were used for total RNAs (/proteins) isolation, and serum samples were utilized for exosome isolation.

2.10 Exosomes isolation and treatment

GSTM Exosome Isolation Reagent for serum (Geneseed, Guangzhou, China) and GSTM Exosome Isolation Reagent for cell culture medium (Geneseed) were used for exosome isolation. The extraction processes were in strict accordance with the directions. Transmission electron microscope (TEM) was applied to examine the morphology of extracted exosomes according to the previously described process [20]. Total RNAs and proteins were isolated by TRIzol reagent (Invitrogen) and RIPA (Beyotime), respectively. Expression of the exosomal circ-IARS (exo-circ-IARS) was detected by RT-qPCR, and western blotting was used to detect the expression of exosome markers including TSG101, CD9, and CD63. The antibodies are summarized in Table 2. H1299 cells-based exosomes after circ-IARS or pCD-ciR vector transfection were termed as pCD-ciR-exo or circ-IARS-exo. H460 cells were co-cultured with exosomes for 48 h prior to functional experiments.

2.11 Statistical analysis

Distribution normality was evaluated using Shapiro–Wilk normality test. All the data were expressed as mean value ± standard deviation and analyzed using two-tailed Student’s t test and analysis of variance method with Tukey’s test on GraphPad Prism version 7 (GraphPad Software, La Jolla, CA, USA). It was considered as significant when P < 0.05. Spearman’s rank correlation analysis was used to obtain the bivariate correlations.

  1. Ethics approval and consent to participate: The present study was approved by the ethical review committee of Zigong First People’s Hospital. Written informed consent was obtained from all enrolled patients.

  2. Consent for publication: Patients agreed to participate in this work.

3 Results

3.1 Exhausting circ-IARS antagonized the malignant growth, migration, and invasion of NSCLC cells in vitro

circ-IARS was a circRNA derived from the exons 13–20 of the IARS gene (Figure 1a), and its expression level was higher in NSCLC cells (H1299, A549, and H460) than that in normal BEAS-2B cells (3.92 fold, 3.50 fold, and 1.64 fold, respectively, Figure 1b). Circ-IARS expression was dramatically downregulated by more than 50%, whereas IARS expression was not affected after transfection with si-circ-IARS_1 or si-circ-IARS_2 (Figure 1c and Figure A1), indicating that si-circ-IARS_1 and si-circ-IARS_2 were effective in reducing circ-IARS expression. si-circ-IARS (both _1 and _2) transfection reduced the proliferation of H1299 and A549 cells (Figure 1d and e), accompanied by a lower EdU-positive rate (Figure 1f). Cell cycle distribution in G0/G1 phase was increased, and cells in the S phase were decreased in H1299 and A549 cells after circ-IARS downregulation (Figure 1g). Meanwhile, apoptotic cells were highly induced (more than 4.42 fold) in circ-IARS-silenced H1299 and A549 cells (Figure 1h). Cell migration and invasion were abnormally inhibited by exhausting circ-IARS (Figure 2a and b). Circ-IARS silencing led to the upregulation of c-caspase 9 and the downregulation of PCNA, cyclin D1, and vimentin (Figure 2c). These results demonstrated that exhausting circ-IARS could antagonize the malignant development of NSCLC cells in vitro.

Figure 1 Exhausting circ-IARS could antagonize NSCLC cell growth. (a) Schematic diagram showing the back-splicing of exons 13–20 of the IARS gene generating the circRNA hsa_circ_0006702. (b and c) RT-qPCR is used to measure the relative circ-IARS expression level in (b) H1299, A549, H460, and BEAS-2B cells, and in (c) H1299 and A549 cells transfected with si-circ-IARS_1, si-circ-IARS_2, or si-NC. In transfected H1299 (d) and A549 cells (e), MTT assay monitored the OD value at 490 nm, (f) EdU assay determined the EdU-positive rate, (g and h) FCM method analyzed the cell cycle distribution (%) in G0/G1, S, and G2/M phases, and apoptotic cells (%). *P < 0.05, **P < 0.01, and ***P < 0.001.
Figure 1

Exhausting circ-IARS could antagonize NSCLC cell growth. (a) Schematic diagram showing the back-splicing of exons 13–20 of the IARS gene generating the circRNA hsa_circ_0006702. (b and c) RT-qPCR is used to measure the relative circ-IARS expression level in (b) H1299, A549, H460, and BEAS-2B cells, and in (c) H1299 and A549 cells transfected with si-circ-IARS_1, si-circ-IARS_2, or si-NC. In transfected H1299 (d) and A549 cells (e), MTT assay monitored the OD value at 490 nm, (f) EdU assay determined the EdU-positive rate, (g and h) FCM method analyzed the cell cycle distribution (%) in G0/G1, S, and G2/M phases, and apoptotic cells (%). *P < 0.05, **P < 0.01, and ***P < 0.001.

Figure 2 Exhausting circ-IARS could antagonize cell migration and invasion of NSCLC cells. (a) Scratch wound assay measured wound closure rate in H1299 and A549 cells after transfection. (b) Transwell assay examined the invaded cells per field (100×) after transfection. (c) Western blotting detected the relative protein expression levels of PCNA, cyclin D1, c-caspase 9, and vimentin in transfected cells, normalized to β-actin. ***P < 0.001.
Figure 2

Exhausting circ-IARS could antagonize cell migration and invasion of NSCLC cells. (a) Scratch wound assay measured wound closure rate in H1299 and A549 cells after transfection. (b) Transwell assay examined the invaded cells per field (100×) after transfection. (c) Western blotting detected the relative protein expression levels of PCNA, cyclin D1, c-caspase 9, and vimentin in transfected cells, normalized to β-actin. ***P < 0.001.

3.2 circ-IARS served as a ceRNA for miR-1252-5p to regulate HDGF in NSCLC cells

With bioinformatics algorithm prediction, Circinteractome and StarBase websites presented a total of 12 miRNAs that were potentially complementary to circ-IARS (Figure 3a). Among these miRNAs, 8 miRNAs were downregulated in NSCLC. Besides, miR-1252-5p was the most sensitive one (change, 3.83 fold and 3.54 fold) in response to circ-IARS deficiency in H1299 and A549 cells (Figure 3b and c). Thus, miR-1252-5p was employed as the promising target for circ-IARS. MUT-circ-IARS was generated according to the mutation of the predicted binding sequence in WT-circ-IARS (Figure 3d), and luciferase activity of WT-circ-IARS reporter vector was repressed by 60.00% in HEK293T cells with miR-1252-5p overexpression (Figure 3e). While the luciferase activity of MUT-circ-IARS vector was not affected on miR-1252-5p mimic transfection. Moreover, RIP assay showed a co-enrichment of circ-IARS and miR-1252-5p by AGO2 in both H1299 and A549 cells (Figure 3f and g). Thereby, miR-1252-5p was confirmed as one target for circ-IARS, and this miRNA was shown to be lowly expressed in three NSCLC cells (Figure 3h). Additionally, the promotion of circ-IARS exhaustion on miR-1252-5p could be partially canceled by co-transfection of miR-1252-5p inhibitor (Figure 3i).

Figure 3 Circ-IARS served as a ceRNA for miR-1252-5p to regulate HDGF in NSCLC cells. (a) Circinteractome website and StarBase website together presented 12 miRNAs that were complementary to circ-IARS. (b and c) RT-qPCR detected the relative expression levels of 8 miRNAs in H1299 and A549 cells transfected with si-circ-IARS_1 or si-NC. (d) Schematic diagram showing the predicted binding sites between WT-circ-IARS and miR-1252-5p sequences. (e) Dual-luciferase reporter assay measured the relative luciferase activity of WT-circ-IARS reporter vector and MUT-circ-IARS reporter vector in HEK293T cells transfected with miR-1252-5p mimic or NC mimic. (f and g) RIP assay evaluated the relative enrichment of circ-IARS and miR-1252-5p by AGO2 or IgG in H1299 and A549 cells, normalized to the input of cells. (h and i) RT-qPCR measured the relative miR-1252-5p expression level in (h) BEAS-2B, H1299, A549, and H460 cells, and (i) H1299 and A549 cells transfected with si-NC, si-circ-IARS_1, si-circ-IARS_1 + miR-1252-5p inhibitor, or si-circ-IARS_1 + NC inhibitor. (j) Schematic diagram showing the predicted binding sites between WT-HDGF 3′UTR and miR-1252-5p sequences. (k) Dual-luciferase reporter assay measured the relative luciferase activity of WT-HDGF 3′UTR reporter vector and MUT-HDGF 3′UTR reporter vector in HEK293T cells transfected with miR-1252-5p mimic or NC mimic. (l and m) RIP assay evaluated the relative enrichment of HDGF and miR-1252-5p by AGO2 or IgG in H1299 and A549 cells, normalized to the input of cells. (n) RT-qPCR measured the relative miR-1252-5p expression level in H1299 and A549 cells transfected with miR-1252-5p mimic, miR-1252-5p inhibitor, NC mimic, or NC inhibitor. (o–r) Western blotting detected the relative HDGF protein expression in (o and p) H1299 and A549 cells transfected with HDGF vector, pcDNA vector, miR-1252-5p mimic, NC mimic, miR-1252-5p mimic + HDGF vector, or miR-1252-5p mimic + pcDNA vector, and (q) BEAS-2B, H1299, A549, and H460 cells, as well as (r) H1299 and A549 cells transfected with si-NC, si-circ-IARS_1, si-circ-IARS_1 + miR-1252-5p inhibitor, or si-circ-IARS_1 + NC inhibitor. *P < 0.05, **P < 0.01, and ***P < 0.001.
Figure 3

Circ-IARS served as a ceRNA for miR-1252-5p to regulate HDGF in NSCLC cells. (a) Circinteractome website and StarBase website together presented 12 miRNAs that were complementary to circ-IARS. (b and c) RT-qPCR detected the relative expression levels of 8 miRNAs in H1299 and A549 cells transfected with si-circ-IARS_1 or si-NC. (d) Schematic diagram showing the predicted binding sites between WT-circ-IARS and miR-1252-5p sequences. (e) Dual-luciferase reporter assay measured the relative luciferase activity of WT-circ-IARS reporter vector and MUT-circ-IARS reporter vector in HEK293T cells transfected with miR-1252-5p mimic or NC mimic. (f and g) RIP assay evaluated the relative enrichment of circ-IARS and miR-1252-5p by AGO2 or IgG in H1299 and A549 cells, normalized to the input of cells. (h and i) RT-qPCR measured the relative miR-1252-5p expression level in (h) BEAS-2B, H1299, A549, and H460 cells, and (i) H1299 and A549 cells transfected with si-NC, si-circ-IARS_1, si-circ-IARS_1 + miR-1252-5p inhibitor, or si-circ-IARS_1 + NC inhibitor. (j) Schematic diagram showing the predicted binding sites between WT-HDGF 3′UTR and miR-1252-5p sequences. (k) Dual-luciferase reporter assay measured the relative luciferase activity of WT-HDGF 3′UTR reporter vector and MUT-HDGF 3′UTR reporter vector in HEK293T cells transfected with miR-1252-5p mimic or NC mimic. (l and m) RIP assay evaluated the relative enrichment of HDGF and miR-1252-5p by AGO2 or IgG in H1299 and A549 cells, normalized to the input of cells. (n) RT-qPCR measured the relative miR-1252-5p expression level in H1299 and A549 cells transfected with miR-1252-5p mimic, miR-1252-5p inhibitor, NC mimic, or NC inhibitor. (o–r) Western blotting detected the relative HDGF protein expression in (o and p) H1299 and A549 cells transfected with HDGF vector, pcDNA vector, miR-1252-5p mimic, NC mimic, miR-1252-5p mimic + HDGF vector, or miR-1252-5p mimic + pcDNA vector, and (q) BEAS-2B, H1299, A549, and H460 cells, as well as (r) H1299 and A549 cells transfected with si-NC, si-circ-IARS_1, si-circ-IARS_1 + miR-1252-5p inhibitor, or si-circ-IARS_1 + NC inhibitor. *P < 0.05, **P < 0.01, and ***P < 0.001.

Subsequently, the downstream target gene of miR-1252-5p was further explored. Here we investigated the relationship between miR-1252-5p and HDGF according to the potential binding sites (Figure 3j). Dual-luciferase reporter assay revealed that miR-1252-5p mimic impaired luciferase activity of WT-HDGF 3′UTR vector by 67.00% and failed to alter the luciferase activity of MUT-HDGF 3′UTR vector in HEK293T cells (Figure 3k). RIP assay revealed that miR-1252-5p and HDGF were synchronously enriched by AGO2 in both H1299 and A549 cells (Figure 3l and m). To abnormally express miR-1252-5p, H1299 and A549 cells were transfected with miR-1252-5p mimic or inhibitor (Figure 3n). Similarly, HDGF was exogenously overexpressed with a change of 3.57 fold and 3.37 fold after transfection with HDGF vector (Figure 3o). The expression of HDGF was inhibited in miR-1252-5p-upregulated or circ-IARS-downregulated H1299 and A549 cells (Figure 3p and r), but this low HDGF expression could be reversed by co-transfection of HDGF vector or miR-1252-5p inhibitor (Figure 3p and r). By the way, HDGF was highly expressed in NSCLC cells when compared with that in BEAS-2B cells (Figure 3q). The above results might indicate that circ-IARS segregated miR-1252-5p to modulate HDGF, suggesting a circ-IARS/miR-1252-5p/HDGF ceRNA axis in NSCLC.

3.3 There was a circ-IARS/miR-1252-5p/HDGF ceRNA axis in the regulation of NSCLC cell growth, migration, and invasion in vitro

Rescue experiments were carried out to measure the interactive effects between miR-1252-5p and circ-IARS or HDGF in NSCLC cells. Cell proliferation analyzed by MTT assay and EdU assay was inhibited by silencing circ-IARS (Figure 4a–c), and it could be similarly attenuated by overexpressing miR-1252-5p (Figure 5a–c); moreover, these anti-proliferative effects in H1299 and A549 cells could be severely mitigated by simultaneously transfecting miR-1252-5p inhibitor and HDGF vector (Figures 4a–c and 5a–c). Blocking circ-IARS arrested cell cycle of H1299 and A549 cells, and this arrested cell cycle progression was rescued by concurrently depleting miR-1252-5p, as indicated by more cells distributed in the S phase and fewer cells in G0/G1 phase (Figure 4d). Similar data were captured in H1299 and A549 cells transfected with miR-1252-5p mimic alone or together with HDGF vector (Figure 5d). Additional downregulation of miR-1252-5p abrogated the apoptosis promotion induced by circ-IARS deficiency (Figure 4e). Contrarily, upregulation of this miRNA via its mimic transfection elevated the percentage of apoptotic cells in H1299 and A549 cells, which was also then abated by additionally restoring HDGF (Figure 5e). Wound closure rate and invaded cells of H1299 and A549 cells could be suppressed by artificially exhausting circ-IARS or supplementing miR-1252-5p (Figures 4f, g and 5f, g), and this suppression was rescued in the co-presence of miR-1252-5p inhibitor and HDGF vector (Figures 4f, g and 5f, g). These results demonstrated that miR-1252-5p downregulation counteracted the tumor-suppressive role of circ-IARS exhaustion in NSCLC cells in vitro, and HDGF restoration abolished the anti-tumor role of miR-1252-5p upregulation in the malignant growth, migration, and invasion as well, suggesting the role of circ-IARS/miR-1252-5p/HDGF ceRNA axis in the regulation of NSCLC malignancy.

Figure 4 Downregulation of miR-1252-5p counteracted the effects of circ-IARS exhaustion in NSCLC cells. H1299 and A549 cells transfected with si-NC, si-circ-IARS_1, si-circ-IARS_1 + miR-1252-5p inhibitor, or si-circ-IARS_1 + NC inhibitor. (a and b) MTT assay monitored the OD value at 490 nm. (c) EdU assay determined the EdU-positive rate. (d) FCM method analyzed the cell cycle distribution (%) in G0/G1, S, and G2/M phases. (e) FCM method analyzed the apoptotic cells (%). (f) Scratch wound assay measured the wound closure rate. (g) Transwell assay examined the invaded cells per field (100×). (h) Western blotting detected the relative protein expression level of PCNA, cyclin D1, c-caspase 9, and vimentin in transfected cells, normalized to β-actin. *P < 0.05, **P < 0.01, and ***P < 0.001.
Figure 4

Downregulation of miR-1252-5p counteracted the effects of circ-IARS exhaustion in NSCLC cells. H1299 and A549 cells transfected with si-NC, si-circ-IARS_1, si-circ-IARS_1 + miR-1252-5p inhibitor, or si-circ-IARS_1 + NC inhibitor. (a and b) MTT assay monitored the OD value at 490 nm. (c) EdU assay determined the EdU-positive rate. (d) FCM method analyzed the cell cycle distribution (%) in G0/G1, S, and G2/M phases. (e) FCM method analyzed the apoptotic cells (%). (f) Scratch wound assay measured the wound closure rate. (g) Transwell assay examined the invaded cells per field (100×). (h) Western blotting detected the relative protein expression level of PCNA, cyclin D1, c-caspase 9, and vimentin in transfected cells, normalized to β-actin. *P < 0.05, **P < 0.01, and ***P < 0.001.

Figure 5 Overexpressing miR-1252-5p suppressed the development of NSCLC cells through HDGF. H1299 and A549 cells transfected with NC mimic, miR-1252-5p mimic, miR-1252-5p mimic + HDGF vector, or miR-1252-5p mimic + pcDNA vector. (a and b) MTT assay monitored the OD value at 490 nm. (c) EdU assay determined the EdU positive rate. (d and e) FCM method analyzed the cell cycle distribution (%) and apoptotic cells (%). (f) Scratch wound assay measured the percentage of wound closure rate. (g) Transwell assay examined the invaded cells per field (100×). (h) Western blotting detected the relative protein expression levels of PCNA, cyclin D1, c-caspase 9, and vimentin in transfected cells, normalized to β-actin. *P < 0.05, **P < 0.01, and ***P < 0.001.
Figure 5

Overexpressing miR-1252-5p suppressed the development of NSCLC cells through HDGF. H1299 and A549 cells transfected with NC mimic, miR-1252-5p mimic, miR-1252-5p mimic + HDGF vector, or miR-1252-5p mimic + pcDNA vector. (a and b) MTT assay monitored the OD value at 490 nm. (c) EdU assay determined the EdU positive rate. (d and e) FCM method analyzed the cell cycle distribution (%) and apoptotic cells (%). (f) Scratch wound assay measured the percentage of wound closure rate. (g) Transwell assay examined the invaded cells per field (100×). (h) Western blotting detected the relative protein expression levels of PCNA, cyclin D1, c-caspase 9, and vimentin in transfected cells, normalized to β-actin. *P < 0.05, **P < 0.01, and ***P < 0.001.

3.4 Silencing circ-IARS retarded tumor growth of NSCLC in vivo by upregulating miR-1252-5p and downregulating HDGF

Furthermore, H1299 cells stably transfected with sh-circ-IARS or sh-NC were used to induce xenograft tumors in nude mice. After cell inoculation, tumor volume was monitored every 5 days, and tumors were smaller or lighter in the sh-circ-IARS group than in the sh-NC group (Figure 6a and b). Moreover, circ-IARS expression was reduced by 62.00% in xenograft tumor tissues than in the sh-circ-IARS group (Figure 6c), which was accompanied by 2.89-fold upregulation of miR-1252-5p and 65.00% downregulation of HDGF (Figure 6d and e). Besides, expression of HDGF and Ki67 was simultaneously inhibited in xenograft tumors (Figure 6f). These outcomes revealed a suppressive role of circ-IARS knockdown in tumor growth of NSCLC in vivo via regulating miR-1252-5p and HDGF.

Figure 6 Silencing circ-IARS retarded the tumor growth of NSCLC in vivo. (a) Tumor volume was monitored every 5 days after inoculation of sh-circ-IARS or sh-NC-transfected H1299 cells into nude mice (N = 5). (b) Tumor weight was examined at the end day of the xenograft experiment. (c and d) RT-qPCR detected the relative circ-IARS and miR-1252-5p expression, and (e) western blotting measured the relative HDGF protein expression in tumor tissues from nude mice. (f) IHC examined the HDGF and Ki67 expression in paraffin-embedded xenograft tumor tissues. ***P < 0.001.
Figure 6

Silencing circ-IARS retarded the tumor growth of NSCLC in vivo. (a) Tumor volume was monitored every 5 days after inoculation of sh-circ-IARS or sh-NC-transfected H1299 cells into nude mice (N = 5). (b) Tumor weight was examined at the end day of the xenograft experiment. (c and d) RT-qPCR detected the relative circ-IARS and miR-1252-5p expression, and (e) western blotting measured the relative HDGF protein expression in tumor tissues from nude mice. (f) IHC examined the HDGF and Ki67 expression in paraffin-embedded xenograft tumor tissues. ***P < 0.001.

3.5 Circ-IARS was upregulated in NSCLC patients’ tissues and serum exosomes

Paired tissues were recruited from 44 NSCLC patients, and circ-IARS and HDGF were upregulated, while miR-1252-5p was downregulated in NSCLC tumor tissues (Figure 7a–c). In addition, miR-1252-5p expression in NSCLC tumors was negatively correlated with either circ-IARS or HDGF mRNA (Figure 7d and e), there was a positive correlation between circ-IARS and HDGF mRNA expression, as well (Figure 7f). Accidently, exosomes were isolated from NSCLC patients’ serum, and TEM showed a nearly spherical shape and size (Figure 7g). Markers of exosomes (TSG101, CD9, and CD63) were expressed in isolated exosomes from both NSCLC serum and cultured NSCLC cell medium, as indicated by western blotting (Figure 7h). Expression of circ-IARS was also detected in serum exosomes, and the results showed that exo-circ-IARS was highly expressed in the serum of NSCLC patients (N = 22) than in the serum of healthy people (N = 22) (Figure 7i). These results presented an upregulation of circ-IARS in NSCLC patients’ tissues and serum exosomes, suggesting that exo-circ-IARS has the potential as a diagnostic biomarker in NSCLC.

Figure 7 Circ-IARS was upregulated in NSCLC patients. (a–c) RT-qPCR detected the relative expression of circ-IARS, miR-1252-5p, and HDGF mRNA in NSCLC tumor tissues (NSCLC; N = 44), normalized to that in normal para-carcinoma tissues (Normal; N = 44). (d–f) Spearman’s rank correlation analysis determined the linear correlation among circ-IARS, miR-1252-5p, and HDGF mRNA expression in NSCLC tumors. (g) TEM showed the exosomes isolated from the serum of NSCLC patients. (h) Western blotting measured the expression of TSG101, CD9, and CD63 in isolated exosomes from NSCLC serum and NSCLC cell medium. (i) RT-qPCR detected the relative exo-circ-IARS expression in the serum of NSCLC patients (NSCLC; N = 22), normalized to serum from healthy people (Healthy; N = 22). ***P < 0.001.
Figure 7

Circ-IARS was upregulated in NSCLC patients. (a–c) RT-qPCR detected the relative expression of circ-IARS, miR-1252-5p, and HDGF mRNA in NSCLC tumor tissues (NSCLC; N = 44), normalized to that in normal para-carcinoma tissues (Normal; N = 44). (d–f) Spearman’s rank correlation analysis determined the linear correlation among circ-IARS, miR-1252-5p, and HDGF mRNA expression in NSCLC tumors. (g) TEM showed the exosomes isolated from the serum of NSCLC patients. (h) Western blotting measured the expression of TSG101, CD9, and CD63 in isolated exosomes from NSCLC serum and NSCLC cell medium. (i) RT-qPCR detected the relative exo-circ-IARS expression in the serum of NSCLC patients (NSCLC; N = 22), normalized to serum from healthy people (Healthy; N = 22). ***P < 0.001.

3.6 Exo-circ-IARS contributed to the proliferation, migration, and invasion of NSCLC cells in vitro

Expression of exo-circ-IARS was overall more than 1.44 fold higher in the cell medium of NSCLC cell lines than that in BEAS-2B cells (Figure 8a). Among these NSCLC cells, exo-circ-IARS was highest in H1299 cells and was lowest in H460 cells (Figure 8a). Circ-IARS vector was transfected into H1299 cells to obtain a higher level of exo-circ-IARS, with a 2.98-fold change (Figure 8b). With co-culture with exosomes from H1299 cell medium, H460 cells showed an increase in circ-IARS expression in the pCD-ciR-exo group than in the control group, and a more increase (2.89 fold) in the circ-IARS-exo group (Figure 8c). Functionally, H460 cell proliferation was promoted by incubating with pCD-ciR-exo and was further promoted by incubating with circ-IARS-exo (Figure 8d–f). On the contrary, pCD-ciR-exo treatment could diminish the percentage of apoptotic cells with a change of 34.47%, and apoptotic cells were even reduced by 57.04% with circ-IARS-exo treatment (Figure 8g). In terms of cell motility, cell migration and invasion were augmented in pCD-ciR-exo-cultured H460 cells and were excessively augmented in circ-IARS-exo-cultured H460 cells (Figure 8h and i). These data demonstrated that NSCLC cell proliferation, migration, and invasion were promoted with the increase in circ-IARS level via exosome secretion, suggesting exo-circ-IARS contributed to malignant behaviors of NSCLC cells in vitro.

Figure 8 Ex-circ-IARS contributed to the growth, migration, and invasion of NSCLC cells in vitro. (a and b) RT-qPCR detected the relative exo-circ-IARS expression level in (a) BEAS-2B, H1299, A549, and H460 cells, and (b) H1299 cells transfected with circ-IARS or pCD-ciR vector. (c–i) H460 cells were co-cultured with H1299 cells-based exosomes after circ-IARS or pCD-ciR vector transfection (pCD-ciR-exo or circ-IARS-exo), normalized to control cells (without exosome treatment). (c) RT-qPCR detected the relative circ-IARS expression level. (d) MTT assay monitored the OD value at 490 nm. (e) EdU assay determined the EdU-positive rate. (f and g) FCM method analyzed the cell cycle distribution (%) and apoptotic cells (%). (h) Scratch wound assay measured the wound closure rate. (i) Transwell assay examined the number of invaded cells per field (100×). *P < 0.05, **P < 0.01, and ***P < 0.001.
Figure 8

Ex-circ-IARS contributed to the growth, migration, and invasion of NSCLC cells in vitro. (a and b) RT-qPCR detected the relative exo-circ-IARS expression level in (a) BEAS-2B, H1299, A549, and H460 cells, and (b) H1299 cells transfected with circ-IARS or pCD-ciR vector. (c–i) H460 cells were co-cultured with H1299 cells-based exosomes after circ-IARS or pCD-ciR vector transfection (pCD-ciR-exo or circ-IARS-exo), normalized to control cells (without exosome treatment). (c) RT-qPCR detected the relative circ-IARS expression level. (d) MTT assay monitored the OD value at 490 nm. (e) EdU assay determined the EdU-positive rate. (f and g) FCM method analyzed the cell cycle distribution (%) and apoptotic cells (%). (h) Scratch wound assay measured the wound closure rate. (i) Transwell assay examined the number of invaded cells per field (100×). *P < 0.05, **P < 0.01, and ***P < 0.001.

4 Discussion

Serum exosomes and several exosomal circRNAs have been identified as diagnostic biomarkers for NSCLC [17,21,22], lymph node metastasis, and chemoresistance in NSCLC [23,24]. In this study, we found that circ-IARS expression was increased in NSCLC cells, NSCLC tissues, and serum exosomes from NSCLC patients. Circ-IARS silencing inhibited NSCLC cell proliferation, migration, and invasion and promoted cell apoptosis. In terms of mechanism, circ-IARS combined with miR-1252-5p to induce the expression of the downstream gene HDGF. In addition, exo-circ-IARS promoted H460 cell proliferation, migration, and invasion and inhibited cell apoptosis. Silencing circ-IARS retarded tumor growth of NSCLC cells in vivo. Thus, circ-IARS, secreted by exosomes, contributed to NSCLC progression through circ-IARS/miR-1252-5p/HDGF pathway.

According to Gene Expression Omnibus database (GSE104854), circ-IARS was abnormally expressed in LUAD tumors than in paired non-tumor tissues. Consistent with that RNA sequencing data [14], we observed an upregulation of circ-IARS in this cohort of NSCLC patients’ tumors and cells; moreover, its expression was also higher in the exosomes from NSCLC patients’ serum and cell medium. Silencing circ-IARS via siRNA transfection suppressed the excessive proliferation, migration, invasion, and cell cycle progression of H1299 and A549 cells, as well as impeded tumor growth in vivo. Apoptosis of NSCLC cells in vitro was inversely controlled by circ-IARS expression. Promoting circ-IARS via exosome secretion facilitated the proliferation, migration, and invasion of H460 cells. These aforementioned outcomes implied similar patterns between circulating exosomal circRNA and tumor-derived circRNA. The phenomenon that circ-IARS was delivered from H1299 cells via exosomes to H460 cells suggested that exo-circ-IARS regulated tumor microenvironment and intercellular communication of NSCLC. This study considered that circ-IARS, secreted by exosomes, was an oncogenic driver in NSCLC via circ-IARS/miR-1252-5p/HDGF ceRNA axis. Furthermore, the difference in exo-circ-IARS expression in different NSCLC cell lines endowed itself a property of potential target for personalized treatment. Collectively, exo-circ-IARS might be a potent blood-based biomarker in NSCLC, and the relationship between exo-circ-IARS expression and clinical characteristics of NSCLC patients remained to be further confirmed.

Studies focusing on miR-1252-5p have been emerging and ongoing in human cancers in recent years, and miR-1252-5p could be sponged by different circRNAs. For example, hsa_circ_0011290 [25], hsa_circ_0000190 [26], and circ-ABCB10 [27,28] regulated proliferation, apoptosis, and migration of cancer cells through mode-of-action of sponging miR-1252-5p. Besides, glycolysis and chemoresistance were also affected by the circRNA/miR-1252-5p/mRNA crosstalk [26,29]. In NSCLC, miR-1252-5p was implicated in Cinnamaldehyde function against NSCLC via hsa_circ_0043256/miR-1252-5p/Itchy E3 ubiquitin protein ligase (ITCH) axis and Wnt/β-catenin signaling pathway [30]. Here expression of miR-1252-5p was downregulated in NSCLC patients’ tumors and cells, and restoring miR-1252-5p restrained proliferation and migration whereas enhanced apoptosis of NSCLC cells, which were in favor with the previous findings [28,30]. Additionally, cell cycle profile and invasion could also be altered by miR-1252-5p dysregulation in NSCLC, which might be first demonstrated in this study. A novel miR-1252-5p/HDGF interaction was further discovered in NSCLC cells and was the downstream target of circ-IARS.

HDGF was a well-recognized prognostic marker for patients with early-stage NSCLC, and it was correlated with poor overall, disease-specific, and disease-free survivals [31]. A previous study has revealed that HDGF silencing inhibited bladder cancer cell tumorigenesis and induced cell apoptosis through the PI3K-AKT signaling pathway [32]. Liang et al. also explained that HDGF combined with PI3K-AKT signaling pathway to promote colon cancer cell proliferation [33]. Antibody targeting HDGF was a novel effective strategy in treating lung cancers [19,34]. HDGF is also a pro-metastatic factor in NSCLC and promotes cell growth, motility, glycolysis, angiogenesis, and chemoresistance [35,36,37,38]. Here we noticed an upregulation of HDGF mRNA in NSCLC patients’ tumors and cells, and higher HDGF was associated with increased cell proliferation, cell cycle progression, migration, and invasion of NSCLC cells, as well as reduced apoptosis. MiRNAs including miR-16, miR-497, and miR-139-5p targeting HDGF in NSCLC cells participate in the malignant progression [35,37,39]. Moreover, Fu et al. [40] declared that suppression of HDGF/DEAD-Box Helicase 5 (DDX5)/β-catenin/c-Myc signaling could activate miR-296-3p in LUAD cell proliferation, metastasis, and chemoresistance. We identified a novel miR-1252-5p/HDGF interaction in NSCLC; however, the downstream targeted genes for HDGF need to be further analyzed, such as p53 [41] and DDX5 [40].

In conclusion, we showed that circ-IARS was upregulated in NSCLC patients and that circ-IARS and exo-circ-IARS synchronously contributed to cell growth, migration, and invasion of NSCLC via regulating miR-1252-5p/HDGF axis. This study suggested that exo-circ-IARS was a potential diagnostic biomarker for NSCLC and a potential target for the treatment of NSCLC. Interfering circ-IARS might be a promising therapeutic approach to NSCLC.

tel: +86-13795575801

Acknowledgement

Not applicable.

  1. Funding information: This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

  2. Conflict of interest: The authors declare that they have no competing interest.

  3. Data availability statement: The analyzed datasets generated during the present study are available from the corresponding author on reasonable request.

Appendix

Table A1

Clinicopathological factors of NSCLC patients and healthy volunteers

Parameters NSCLC (n = 44) Healthy (n = 22)
Age (n, %)
<60 25 (56.8%) 12 (54.5%)
≥60 19 (43.2%) 10 (45.5%)
Gender (n, %)
Female 18 (40.9%) 9 (40.9%)
Male 26 (59.1%) 13 (59.1%)
Body mass index (kg/m2, mean ± SD) 23.28 ± 4.42 25.12 ± 5.10
Smoking status (n, %)
Smoker 25 (56.8%) 12 (54.5%)
Non-smoker 19 (43.2%) 10 (45.5%)
Histological subtype (n, %)
ADC 35 (79.5%)
LCC 1 (2.3%)
SCC 8 (18.2%)
Stage
I 2 (4.6%)
II 14 (31.8%)
III 28 (63.6%)
Lymph node metastasis (n, %)
Positive 21 (47.7%)
Negative 23 (52.3%)
Tumor differentiation (n, %)
Well + moderate 24 (54.5%)
Poor 20 (45.5%)

ADC: lung adenocarcinoma; LCC: lung large-cell carcinoma; SCC: lung squamous carcinoma.

Figure A1 The effects of si-circ-IARS_1 and si-circ-IARS_2 on IARS mRNA and protein expression were analyzed by RT-qPCR (A) and Western blotting (B) in H1299 and A549 cells. ns: no significant difference.
Figure A1

The effects of si-circ-IARS_1 and si-circ-IARS_2 on IARS mRNA and protein expression were analyzed by RT-qPCR (A) and Western blotting (B) in H1299 and A549 cells. ns: no significant difference.

References

[1] Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin. 2018;68(1):7–30.10.3322/caac.21442Suche in Google Scholar PubMed

[2] Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics in China, 2015. CA Cancer J Clin. 2016;66(2):115–32.10.3322/caac.21338Suche in Google Scholar PubMed

[3] Blandin Knight S, Crosbie PA, Balata H, Chudziak J, Hussell T, Dive C. Progress and prospects of early detection in lung cancer. Open Biol. 2017;7(9):170070.10.1098/rsob.170070Suche in Google Scholar PubMed PubMed Central

[4] Molina JR, Yang P, Cassivi SD, Schild SE, Adjei AA. Non-small cell lung cancer: epidemiology, risk factors, treatment, and survivorship. Mayo Clin Proc. 2008;83(5):584–94.10.1016/S0025-6196(11)60735-0Suche in Google Scholar

[5] Mesko S, Gomez D. Proton therapy in non-small cell lung cancer. Curr Treat Options Oncol. 2018;19(12):76.10.1007/s11864-018-0588-zSuche in Google Scholar PubMed

[6] Walters S, Maringe C, Coleman MP, Peake MD, Butler J, Young N, et al. Lung cancer survival and stage at diagnosis in Australia, Canada, Denmark, Norway, Sweden and the UK: a population-based study, 2004-2007. Thorax. 2013;68(6):551–64.10.1136/thoraxjnl-2012-202297Suche in Google Scholar PubMed

[7] Kumar V, Yadavilli S, Kannan R. A review on RNAi therapy for NSCLC: Opportunities and challenges. Wiley Interdiscip Rev Nanomed Nanobiotechnol. 2020;13(2):e1677.10.1002/wnan.1677Suche in Google Scholar PubMed

[8] Reclusa P, Sirera R, Araujo A, Giallombardo M, Valentino A, Sorber L, et al. Exosomes genetic cargo in lung cancer: a truly Pandora’s box. Transl Lung Cancer Res. 2016;5(5):483–91.10.21037/tlcr.2016.10.06Suche in Google Scholar PubMed PubMed Central

[9] Liu S, Zhan Y, Luo J, Feng J, Lu J, Zheng H, et al. Roles of exosomes in the carcinogenesis and clinical therapy of non-small cell lung cancer. Biomed Pharmacother = Biomedecine Pharmacotherapie. 2019;111:338–46.10.1016/j.biopha.2018.12.088Suche in Google Scholar PubMed

[10] Bracht JWP, Mayo-de-Las-Casas C, Berenguer J, Karachaliou N, Rosell R. The present and future of liquid biopsies in non-small cell lung cancer: Combining four biosources for diagnosis, prognosis, prediction, and disease monitoring. Curr Oncol Rep. 2018;20(9):70.10.1007/s11912-018-0720-zSuche in Google Scholar PubMed

[11] Alipoor SD, Mortaz E, Varahram M, Movassaghi M, Kraneveld AD, Garssen J, et al. The potential biomarkers and immunological effects of tumor-derived exosomes in lung cancer. Front Immunol. 2018;9:819.10.3389/fimmu.2018.00819Suche in Google Scholar PubMed PubMed Central

[12] Masaoutis C, Mihailidou C, Tsourouflis G, Theocharis S. Exosomes in lung cancer diagnosis and treatment. From the translating research into future clinical practice. Biochimie. 2018;151:27–36.10.1016/j.biochi.2018.05.014Suche in Google Scholar PubMed

[13] Seimiya T, Otsuka M, Iwata T, Shibata C, Tanaka E, Suzuki T, et al. Emerging roles of exosomal circular RNAs in cancer. Front Cell Dev Biol. 2020;8:568366.10.3389/fcell.2020.568366Suche in Google Scholar PubMed PubMed Central

[14] Ding X, Zhang S, Li X, Feng C, Huang Q, Wang S, et al. Profiling expression of coding genes, long noncoding RNA, and circular RNA in lung adenocarcinoma by ribosomal RNA-depleted RNA sequencing. FEBS Open Bio. 2018;8(4):544–55.10.1002/2211-5463.12397Suche in Google Scholar PubMed PubMed Central

[15] Liang ZZ, Guo C, Zou MM, Meng P, Zhang TT. circRNA-miRNA-mRNA regulatory network in human lung cancer: an update. Cancer Cell Int. 2020;20:173.10.1186/s12935-020-01245-4Suche in Google Scholar PubMed PubMed Central

[16] Geng X, Lin X, Zhang Y, Li Q, Guo Y, Fang C, et al. Exosomal circular RNA sorting mechanisms and their function in promoting or inhibiting cancer. Oncol Lett. 2020;19(5):3369–80.10.3892/ol.2020.11449Suche in Google Scholar PubMed PubMed Central

[17] Chen F, Huang C, Wu Q, Jiang L, Chen S, Chen L. Circular RNAs expression profiles in plasma exosomes from early-stage lung adenocarcinoma and the potential biomarkers. J Cell Biochem. 2020;121(3):2525–33.10.1002/jcb.29475Suche in Google Scholar PubMed

[18] Bao CH, Liu K, Wang XT, Ma W, Wang JB, Wang C, et al. Prognostic role of hepatoma-derived growth factor in solid tumors of Eastern Asia: a systematic review and meta-analysis. Asian Pac J Cancer Prev: APJCP. 2015;16(5):1803–11.10.7314/APJCP.2015.16.5.1803Suche in Google Scholar PubMed

[19] Zhao J, Ma MZ, Ren H, Liu Z, Edelman MJ, Pan H, et al. Anti-HDGF targets cancer and cancer stromal stem cells resistant to chemotherapy targeting HDGF to inhibit cancer stem cells. Clin Cancer Res. 2013;19(13):3567–76.10.1158/1078-0432.CCR-12-3478Suche in Google Scholar PubMed PubMed Central

[20] Lasser C, Eldh M, Lotvall J. Isolation and characterization of RNA-containing exosomes. J Visualized Exp: JoVE. 2012;59:e3037.10.3791/3037Suche in Google Scholar PubMed PubMed Central

[21] Xian J, Su W, Liu L, Rao B, Lin M, Feng Y, et al. Identification of Three Circular RNA Cargoes in Serum Exosomes as Diagnostic Biomarkers of Non-Small-Cell Lung Cancer in the Chinese Population. J Mol Diagn: JMD. 2020;22(8):1096–108.10.1016/j.jmoldx.2020.05.011Suche in Google Scholar PubMed

[22] Wang Y, Zhang H, Wang J, Li B, Wang X. Circular RNA expression profile of lung squamous cell carcinoma: identification of potential biomarkers and therapeutic targets. Biosci Rep. 2020;40(4):BSR20194512.10.1042/BSR20194512Suche in Google Scholar PubMed PubMed Central

[23] He F, Zhong X, Lin Z, Lin J, Qiu M, Li X, et al. Plasma exo-hsa_circRNA_0056616: A potential biomarker for lymph node metastasis in lung adenocarcinoma. J Cancer. 2020;11(14):4037–46.10.7150/jca.30360Suche in Google Scholar PubMed PubMed Central

[24] Ma J, Qi G, Li L. A novel serum exosomes-based biomarker hsa_circ_0002130 facilitates Osimertinib-resistance in non-small cell lung cancer by sponging miR-498. OncoTargets Ther. 2020;13:5293–307.10.2147/OTT.S243214Suche in Google Scholar PubMed PubMed Central

[25] Wang GJ, Yu TY, Li YR, Liu YJ, Deng BB. Circ_0000190 suppresses gastric cancer progression potentially via inhibiting miR-1252/PAK3 pathway. Cancer Cell Int. 2020;20:351.10.1186/s12935-020-01422-5Suche in Google Scholar PubMed PubMed Central

[26] Hu Z, Zhao P, Zhang K, Zang L, Liao H, Ma W. Hsa_circ_0011290 regulates proliferation, apoptosis and glycolytic phenotype in papillary thyroid cancer via miR-1252/FSTL1 signal pathway. Arch Biochem Biophysics. 2020;685:108353.10.1016/j.abb.2020.108353Suche in Google Scholar PubMed

[27] Chen Y, Ye X, Xia X, Lin X. Circular RNA ABCB10 correlates with advanced clinicopathological features and unfavorable survival, and promotes cell proliferation while reduces cell apoptosis in epithelial ovarian cancer. Cancer Biomarkers. 2019;26(2):151–61.10.3233/CBM-190064Suche in Google Scholar PubMed

[28] Tian X, Zhang L, Jiao Y, Chen J, Shan Y, Yang W. CircABCB10 promotes nonsmall cell lung cancer cell proliferation and migration by regulating the miR-1252/FOXR2 axis. J Cell Biochem. 2019;120(3):3765–72.10.1002/jcb.27657Suche in Google Scholar PubMed PubMed Central

[29] Zhang S, Cheng J, Quan C, Wen H, Feng Z, Hu Q, et al. circCELSR1 (hsa_circ_0063809) Contributes to Paclitaxel Resistance of Ovarian Cancer Cells by Regulating FOXR2 Expression via miR-1252. Molecular therapy. Nucleic Acids. 2020;19:718–30.10.1016/j.omtn.2019.12.005Suche in Google Scholar PubMed PubMed Central

[30] Tian F, Yu CT, Ye WD, Wang Q. Cinnamaldehyde induces cell apoptosis mediated by a novel circular RNA hsa_circ_0043256 in non-small cell lung cancer. Biochem Biophys Res Commun. 2017;493(3):1260–6.10.1016/j.bbrc.2017.09.136Suche in Google Scholar PubMed

[31] Ren H, Tang X, Lee JJ, Feng L, Everett AD, Hong WK, et al. Expression of hepatoma-derived growth factor is a strong prognostic predictor for patients with early-stage non-small-cell lung cancer. J Clin Oncol. 2004;22(16):3230–7.10.1200/JCO.2004.02.080Suche in Google Scholar PubMed

[32] Zhang C, Chang X, Chen D, Yang F, Li Z, Li D, et al. Downregulation of HDGF inhibits the tumorigenesis of bladder cancer cells by inactivating the PI3K-AKT signaling pathway. Cancer Manag Res. 2019;11:7909–23.10.2147/CMAR.S215341Suche in Google Scholar PubMed PubMed Central

[33] Liang X, Tang Z, Zhang Y, Sun Y, Wang J. NAP1L1 promotes the growth of colon cancer by activating HDGF/DDX5. Acta Biochim Biophys Sin (Shanghai). 2022.10.3724/abbs.2022124Suche in Google Scholar PubMed PubMed Central

[34] Ren H, Chu Z, Mao L. Antibodies targeting hepatoma-derived growth factor as a novel strategy in treating lung cancer. Mol Cancer Ther. 2009;8(5):1106–12.10.1158/1535-7163.MCT-08-0779Suche in Google Scholar PubMed PubMed Central

[35] Zhao WY, Wang Y, An ZJ, Shi CG, Zhu GA, Wang B, et al. Downregulation of miR-497 promotes tumor growth and angiogenesis by targeting HDGF in non-small cell lung cancer. Biochem Biophys Res Commun. 2013;435(3):466–71.10.1016/j.bbrc.2013.05.010Suche in Google Scholar PubMed

[36] Guo F, Li S, Guo C, Xu X, Zhou X, Ma D, et al. Circular RNA circMAGI3 accelerates the glycolysis of non-small cell lung cancer through miR-515-5p/HDGF. Am J Transl Res. 2020;12(7):3953–63.Suche in Google Scholar

[37] Ke Y, Zhao W, Xiong J, Cao R. Downregulation of miR-16 promotes growth and motility by targeting HDGF in non-small cell lung cancer cells. FEBS Lett. 2013;587(18):3153–7.10.1016/j.febslet.2013.08.010Suche in Google Scholar PubMed

[38] Flores-Perez A, Marchat LA, Sanchez LL, Romero-Zamora D, Arechaga-Ocampo E, Ramirez-Torres N, et al. Differential proteomic analysis reveals that EGCG inhibits HDGF and activates apoptosis to increase the sensitivity of non-small cells lung cancer to chemotherapy. Proteom Clin Appl. 2016;10(2):172–82.10.1002/prca.201500008Suche in Google Scholar PubMed

[39] Zhang Z, Li W, Jiang D, Liu C, Lai Z. MicroRNA-139-5p inhibits cell viability, migration and invasion and suppresses tumor growth by targeting HDGF in non-small cell lung cancer. Oncol Lett. 2020;19(3):1806–14.10.3892/ol.2020.11296Suche in Google Scholar PubMed PubMed Central

[40] Fu Q, Song X, Liu Z, Deng X, Luo R, Ge C, et al. miRomics and proteomics reveal a miR-296-3p/PRKCA/FAK/Ras/c-Myc feedback loop modulated by HDGF/DDX5/beta-catenin complex in lung adenocarcinoma. Clin Cancer Res. 2017;23(20):6336–50.10.1158/1078-0432.CCR-16-2813Suche in Google Scholar PubMed

[41] Sasaki Y, Negishi H, Idogawa M, Yokota I, Koyama R, Kusano M, et al. p53 negatively regulates the hepatoma growth factor HDGF. Cancer Res. 2011;71(22):7038–47.10.1158/0008-5472.CAN-11-1053Suche in Google Scholar PubMed

Received: 2022-04-24
Revised: 2022-10-26
Accepted: 2022-11-03
Published Online: 2023-01-11

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2022-0613
Schlagwörter für diesen Artikel
circ-IARS; miR-1252-5p; HDGF; NSCLC; exosome
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 10.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0613/html
Button zum nach oben scrollen