Startseite Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
Artikel Open Access

Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9

  • Yachen Li , Junjun Duan , Weicheng Lin und Jie Liu EMAIL logo
Veröffentlicht/Copyright: 15. März 2023

Abstract

Osteoarthritis (OA) is a type of common degenerative joint disorder, in which adipose mesenchymal stem cells (ADSCs) and the secreted exosomes play an important role. The purpose of this study was to investigate the role and mechanism of exosomes derived from ADSCs (ADSC-exos) in OA. The gradient of IL-1β concentration was designed to construct the articular chondrocyte model of arthritic mice. The expression of miR-93-5p and ADAMTS9 in articular chondrocytes was detected by reverse transcription quantitative polymerase chain reaction. Dual luciferase reporter gene assay was performed to verify the interaction between them. Monodansylcadaverine staining was used to visualize the autophagosome formation and cell apoptosis was analyzed by flow cytometry. ADSC-exos were authenticated by transmission electron microscope and western blot assay. miR-93-5p was found to be downregulated in IL-1β-treated articular chondrocytes compared with OA cartilage while ADAMTS9 was upregulated, which was identified as a direct target gene of miR-93-5p. Silencing of ADAMTS9 attenuated the effects of miR-93-5p. Exosomal miR-93-5p can reduce the release of inflammatory factors in mouse arthritis cell models. This study first described the mechanism under that ADSC-exos inhibited inflammation and alleviated OA through the innovative targets miR-93-5p/ADAMTS9 signal axis. This provided a new method for the treatment of OA.

Graphical abstract

1 Introduction

Osteoarthritis (OA), a frequently seen degenerative joint disorder, is associated with gradual degradation of articular cartilage, inflammation, and joint malfunction [1,2]. OA displays the consistent degeneration of articular cartilage, causing the imbalanced generation and degeneration of articular chondrocyte extracellular matrix [3]. At present, the clinical treatment for this disease mainly includes non-steroidal anti-inflammatory drugs or joint replacement surgery [4]. It is significant to elucidate the pathogenesis of OA and search for a potential treatment strategy that avoids surgery.

In OA, many inflammatory cytokines, tumor necrosis factor (TNF)-α and interleukin 1 (IL-1), are produced by the synovium and the chondrocytes [5,6]. In OA, the dynamic balance of adjustment mechanism transformation is broken, which is manifested by the generation of the aggrecan [7], as well as type II collagen being depleted [8], while the production of matrix-degenerating enzymes (matrix metalloproteinases [MMPs]) is reinforced [9]. Among them, the protease (aggrecanase) enzymes encoded by ADAMTS are called ADAMTS enzymes [10]. ADAMTS family contains 20 members, and the studies have put forward that the ADAMTS 1, 4, 5, 8, 9, and 15 genes have aggrecanase activities [11]. The analysis of gene expression and methylation datasets identified ADAMTS9 as the biomarkers for OA [12]. Other molecular mechanisms include the change in mediators of apoptosis polymerase and modification of homeostatic processes, which included autophagy [13,14,15]. The research showed that chondrocyte autophagy, as a self-protective mechanism, can recuperate chondrocytes’ viability, while apoptosis of chondrocytes may lead to the degeneration and failed regeneration of the cartilage, which is considered a potential target for regulating the progression of OA [16,17]. Furthermore, OA therapies appear far from satisfactory.

Widely studies found that abnormal gene expression in OA articular chondrocytes leads to its pathogenesis [18]. Recently, microRNAs (miRNAs) are frequently dysregulated in human inflammatory diseases including OA, which possess epigenetic-like properties in the regulation of gene expression after transcription [19,20]. miRNAs play a key role in a variety of biological processes by targeting its 3′-UTR region to inhibit mRNAs’ expression, thereby blocking its translation process or inducing cleavage [21]. For example, miR-103 contributed to OA development by directly targeting and inhibiting the expression of Sox6, which may be an effective treatment for OA [22]. The study also found that miR-375 can inhibit the expression of ATG2B in chondrocytes, suppress autophagy, and promote the endoplasmic reticulum stress [23]. Thus, we inferred that miRNAs play a crucial role in the development of arthritis and joint homeostasis and that their mechanisms of action in the progression of OA may contribute to improving the efficacy of OA treatment.

miR-93-5p is a member of an miRNA family, which is associated with inflammatory diseases [24]. Previous study found that miR-93-5p is involved in the inflammatory and anti-proliferation processes of neodymium oxide-induced human bronchial epithelial cell lines by targeting Nd2O3 [25]. A study also confirmed that miR-93-5p-enhanced adipose mesenchymal stem cell (ADSC)-derived exosomes can prevent cardiac injury by targeting Atg7 and Toll-like receptor 4 (TLR4) and inhibiting hypoxia-induced autophagy and inflammatory cytokine expression [26]. Furthermore, miR-93-5p has been revealed to regulate IL-1β-induced cartilage degradation and chondrocyte apoptosis in OA by targeting TCF4 [27]. However, the role of miR-93-5p in OA remains to be elucidated.

Recent studies have shown that exosomes derived from adipose mesenchymal stem cells (ADSC-exos) play an important role in OA [28,29]. For example, exosomes from ADSCs promote chondrogenesis and suppress inflammation by upregulating miR-145 and miR-221 [30]. Although miR-93-5p has been found to be involved in the regulation of disease progression in a number of studies, the regulatory mechanism of miR-93-5p derived from ADSC exosomes in OA remains unclear.

To elucidate the potential role of ADSC-derived exosomal miR-93-5p in OA, we investigated the expression of miR-93-5p in cell models and analyzed the relationships among apoptosis, inflammation, and autophagy of miR-93-5p by targeting ADAMTS9. These data may provide new evidence that exosomes derived from ADSCs have better therapeutic effects on OA.

We present the following article/case in accordance with the CONSORT reporting checklist.

2 Methods

2.1 Cell lines and treatments

Chondrocytes (Lot. 339995, Beina Biology Research Institute, China) were purchased and maintained in Dulbecco’s modified eagle medium containing 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (Gibco, USA). ADSCs were obtained from Procell Life Science & Technology Co., Ltd. (Wuhan, China) and cultured in mouse adipose mesenchymal stem cell complete medium (Procell, China). All media were supplemented with 10% FBS (Gibco, USA) and 1% penicillin/streptomycin. All cells were cultured in a humidified incubator at 37°C with 5% CO2. To construct an in vitro model of inflammation, chondrocytes treated for 2 h with IL-1β, which was acquired from R&D Systems (St. Paul, MN, USA).

2.2 Transient transfection assay

The ADAMTS9 short-interfering RNA (siRNA) came from GenePharma (China). The miR-93-5p mimic, inhibitor, and negative control (NC) oligonucleotides were purchased from Ribobio (China). Chondrocytes were transfected with them using Lipofectamine 2000 (Thermofisher, USA), according to the manufacturer’s instruction.

2.3 RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

According to the manufacturer’s instructions, TRIzol kit (Tiangen Biotech (Beijing, China) Co., Ltd.) was used to separate total RNA from glioma cells. Thereafter, UEIris RT-qPCR System for First-Strand cDNA Synthesis (with Dnase I) (YuhengBio Suzhou, China) and miRNA First-Strand cDNA Synthesis were used. Tail Addition Kit (Sangon Biotech Shanghai, China) was applied to reversely transcribe the RNA into cDNA, and SYBR 2* qPCR Master Mix-qPCR was used to perform PCR (YuhengBio) with glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) adopted for endogenous control. Comparative quantification was detected using the 2−ΔΔCt method. The sequences of the primers were as follows: GAPDH forward, 5′-AATGGTGAAGGTCGGTGTGA-3′; GAPDH reverse, 5′-CGTGAGTGGAGTCATACTGGAA-3′; TNF-α forward, 5′-CTCATTCCTGCTTGTGGC-3′; TNF-α reverse, 5′-TGTGAGTGTGAGGGTCTGG-3′; iNOS forward, 5′-CCTGCTTTGTGCGAAGTGTC-3′; iNOS reverse, 5′-CCCAAACACCAAGCTCATGC-3′; IL-6 forward, 5′-TCGTGGAAATGAGAAAAG-3′; IL-6 reverse, 5′-CTCTGAAGGACTCTGGCT-3′; IL-1β forward, 5′-CTTCAGGCAGGCAGTATC-3′; IL-1β reverse, 5′-GCTTTTTTGTTGTTCATCTC-3′; has-miR-93-5p, CAAAGUGCUGUUCGUGCAGGUAG; Universal primer, 5′-GCGAGCACAGAATTAATACGAC-3′. The PCR was set at the initial denaturation of 5 min at 95°C, following with 5 s at 95°C, 20 s at 72°C in a total of 40 cycles, and finally, 30 s at 95°C, 20 s at 58°C, and 30 s at 95°C.

2.4 Extraction and identification of ADSC-exos

Take the third-generation cells cultured in ADSCs and inoculate 5 × 106 cells in each culture dish. After culturing overnight, discard the culture medium, wash twice with phosphate-buffered saline (PBS) (100–200 μL), culture with Exo-Clear cell Growth Medium (SBI, USA), and collect the cell supernatant for 24 h. A total of 4–5 supernatants in cell culture dishes were collected and centrifuged at 3,000 × g for 15 min, and cells/cell fragments were discarded. These supernatants were transferred to a new centrifuge tube, and exosome extraction reagent was added at a ratio of 4:1 supernatant to ExoQuick TC (SBI, USA) (volume ratio) and mixed and left overnight at 4°C. After centrifugation for 30 min at 1,500 × g, the supernatants were discarded, followed by centrifugation for 5 min at 1,500 × g. The supernatants were carefully absorbed and discarded, and the precipitations were exosomes. As previously reported [31], transmission electron microscope (TEM) could show purified-ADSC-exos double-layer capsule ultrastructure. In addition, biomarkers of exosome (including CD9, CD81, and TSG101) were detected by western blot assay.

2.5 Western blot assay

The protein expression of cells or tissues was detected by western blot assay as previously described [32]. In brief, cells and exosome samples were collected and homogenized using the RIPA buffer. Equal total proteins (30 µg/lane) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Bio-Rad, USA) and transferred onto the polyvinylidene fluoride membrane (Millipore, USA). Next, the membranes were blocked by 5% bovine serum albumin for 2 h at room temperature, followed by incubation with primary antibodies against at 4°C overnight. After washing with 1× PBS for three times, the membranes were incubated with HRP-conjugated secondary antibodies (1:5,000, ABclonal, China) for 2 h at room temperature. The bands were then developed using enhanced chemiluminescence chromogenic substrate (GE Healthcare, UK) and analyzed by the ImageJ software. The primary antibodies used were as follows: anti-CD9, CD81, and TSG101 antibody (1:1,000; ABclonal), anti-P-Akt473 antibody (1:1,000, 4,060; CST), anti-Akt antibody (1:1,000, 4,685; CST), anti-P-PIK3B antibody (1:1,000, AB182651; Abcam), anti-P-mTOR antibody (1:1,000, 5,536; CST), anti-mTOR antibody (1:1,000, 2,983; CST), anti-Bcl-2 antibody (1:1,000, a11025; ABclonal), anti-Bax antibody (1:1,000, A18642; ABclonal), anti-LC3-I/II antibody (1:1,000, A7198; ABclonal), and adopted GAPDH (1:1,000, AC002; ABclonal) as an internal control.

2.6 Dual luciferase reporter gene assay

Dual luciferase reporter gene assay corroborated the targeting relationships between ADAMTS9 and miR-93-5p. To generate psicheck2-ADAMTS9-WT and psicheck2-ADAMTS9-MUT vectors, the wild type (WT) containing the predicted target site and the mutant type (MUT) with the binding site deleted were amplified and cloned into the psicheck2 plasmid. Afterwards, the luciferase vectors were, respectively, transfected into HEK293T cells along with miR-93-5p mimic or mimic NC. After 24 h of transfection, following the manufacturer’s protocol, we measured the relative luciferase activity by normalizing the firefly luminescence to the Renilla luminescence using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA).

2.7 Detection of nitric oxide (NO) content

When the chondrocytes in arthritis of articular mouse models were successfully constructed, the cell supernatants were collected. The nitrite concentration was spectrophotometrically determined using Griess reagent (1% sulfanilamide and 0.1% naphthylethylenediamide in 5% phosphoric acid).

2.8 Monodansylcadaverine (MDC) staining

MDC staining was used as a tracer of autophagic vesicles for autophagy detection. Positive cells were colored in their perinuclear region, cellular autophagy was observed, and all acidic vacuoles were stained. Cell climbing sheets were prepared overnight for group treatments, and 0.05 mmol/L MDC (Shanghai, Huzheng, Industrial Co., Ltd.) was added to the water bath at 37°C for 15 min and washed three times with PBS, followed by immobilization with 4% paraformaldehyde for 15 min. Fluorescence microscope observation was then performed on an anti-fluorescence quenching slide to avoid light.

2.9 Flow cytometry

Rat articular chondrocytes with corresponding treatments of each group were stained with propidium iodide (PI, 50 mg/mL). After 24 h of treatment, the cells were digested with EDTA-free trypsin at 37°C for 5 min, and another addition of 1 mL culture medium with serum was added to terminate digestion. The cells were collected and centrifuged at 1,000 rpm for 10 min with the supernatant being discarded. PI (50 mg/mL) staining was conducted according to the provided kit (Invitrogen, USA) and cell cycle was detected by flow cytometer (BD, USA).

2.10 Statistical analyses

All experiments were repeated three times and the data were presented as the mean ± standard deviation using SPSS 18.0 (SPSS, inc.). One-way analysis of variance and post hoc Dunnett’s T3 test were performed to compare the differences among and between groups, respectively. P < 0.05 was considered to indicate a statistically significant result.

3 Results

3.1 Construction of a mouse chondrocyte model of arthritis by IL-1β

When IL-1β concentration was 10 μg/mL (Figure 1a), the articular chondrocyte model of arthritic mice was constructed, and the expression of miR-93-5p in IL-1β induced chondrocytes was significantly decreased while ADAMTS9 was significantly increased (Figure 1b).

Figure 1 
                  Construction of a mouse chondrocyte model of arthritis by IL-1β. Note: (a) when IL-1β concentration was 10 μg/mL, the articular chondrocyte model of arthritic mice was constructed. (b) RT-qPCR was performed to detect the expression of miR-93-5p and ADAMTS9 in IL-1β-induced chondrocytes. *P < 0.05; **P < 0.01.
Figure 1

Construction of a mouse chondrocyte model of arthritis by IL-1β. Note: (a) when IL-1β concentration was 10 μg/mL, the articular chondrocyte model of arthritic mice was constructed. (b) RT-qPCR was performed to detect the expression of miR-93-5p and ADAMTS9 in IL-1β-induced chondrocytes. *P < 0.05; **P < 0.01.

3.2 Validation of ADAMTS9 as a direct target gene of miR-93-5p

miR-93-5p mimic and miR-93-5p inhibitor were transfected into OA chondrocytes to overexpress and knock down miR-93-5p, respectively. As shown in Figure 2a, compared with the control group (mimic NC), the mRNA expression level of ADAMTS9 in the overexpression group (miR-93-5p mimic) was markedly downregulated. On the contrary, the expression level of ADAMTS9 in the knockdown group (miR-93-5p inhibitor) was dramatically upregulated compared with the control group (inhibitor NC). The interaction between ADAMTS9 and miR-93-5p was detected with dual luciferase reporter gene assay, which revealed targeted binding of miR-93-5p to ADAMTS9 and downregulation of ADAMTS9 expression (Figure 2b). Finally, the results of RT-qPCR are all demonstrated in Figure 2c, and silencing ADAMTS9 reversed the facilitation of miR-93-5p inhibitor on the expression of pro-inflammatory factors (IL-6, IL-1β, TNF-α) and iNOS.

Figure 2 
                  Validation of ADAMTS9 as a direct target gene of miR-93-5p. Note: (a) miR-93-5p mimic and miR-93-5p inhibitor were transfected into OA chondrocytes to overexpress and knockdown miR-93-5p, respectively. (b) The interaction between ADAMTS9 and miR-93-5p was detected with dual luciferase reporter gene assay. (c) RT-qPCR was performed to detect the expression of pro-inflammatory factors (IL-6, IL-1β, TNF-α) and iNOS. *P < 0.05; **P < 0.01; ***P < 0.001.
Figure 2

Validation of ADAMTS9 as a direct target gene of miR-93-5p. Note: (a) miR-93-5p mimic and miR-93-5p inhibitor were transfected into OA chondrocytes to overexpress and knockdown miR-93-5p, respectively. (b) The interaction between ADAMTS9 and miR-93-5p was detected with dual luciferase reporter gene assay. (c) RT-qPCR was performed to detect the expression of pro-inflammatory factors (IL-6, IL-1β, TNF-α) and iNOS. *P < 0.05; **P < 0.01; ***P < 0.001.

3.3 miR-93-5p inhibited autophagy and apoptosis of IL-1β-treated chondrocytes by targeting ADAMTS9 to activate the PI3K/AKT/mTOR pathway

To analyze the contribution of miR-93-5p to the autophagy and apoptosis of IL-1β-treated chondrocytes, the cells were transfected with an miR-93-5p repressor and constructed a lentiviral vector silencing ADAMTS9. As shown in Figure 3a, autophagy chondrocytes were remarkably decreased after miR-93-5p inhibitor transfection in the condition of IL-1β treated, whereas silencing ADAMTS9 was the opposite. Finally, we conducted a functional rescue experiment. IL-1β-treated chondrocytes were simultaneously transfected with siRNA of ADAMTS9 (si-ADAMTS9) and miR-93-5p inhibitor to knock down both ADAMTS9 and miR-93-5p (si-ADAMTS9 + miR-93-5p inhibitor). The results showed that the inhibition of autophagy of miR-93-5p inhibitor could be partially reversed by si-ADAMTS9 in IL-1β-treated chondrocytes (Figure 3a). The results of flow cytometry are all demonstrated in Figure 3b; the inhibition effect of miR-93-5p inhibitor on apoptosis could be partially reversed by si-ADAMTS9 in IL-1β-treated chondrocytes. As determined by the western blot assay, the inhibition of miR-93-5p inhibitor on PI3K, P-mTOR, P-AKT, Bcl-2/Bax and LC3B-I/II expressions could be partially reversed by si-ADAMTS9 in IL-1β-treated chondrocytes (Figure 3c).

Figure 3 
                  miR-93-5p inhibited autophagy and apoptosis of IL-1β-treated chondrocytes by targeting ADAMTS9 to activate the PI3K/AKT/mTOR pathway. Note: (a) MDC staining was used to detect the autophagy of control, IL-1β, IL-1β + miR-93-5p inhibitor, IL-1β + si-ADAMTS9, and IL-1β + miR-93-5p inhibitor + si-ADAMTS9 group in chondrocytes. (b) Flow cytometry was used to detect the apoptosis of control, IL-1β, IL-1β + miR-93-5p inhibitor, IL-1β + si-ADAMTS9, and IL-1β + miR-93-5p inhibitor + si-ADAMTS9 group in chondrocytes. (c) Western blot assay was used to detect the expression of PI3K, P-mTOR, P-AKT, Bcl-2/Bax, and LC3B-I/II expression of control, IL-1β, IL-1β + miR-93-5p inhibitor, IL-1β + si-ADAMTS9, and IL-1β + miR-93-5p inhibitor + si-ADAMTS9 group.
Figure 3

miR-93-5p inhibited autophagy and apoptosis of IL-1β-treated chondrocytes by targeting ADAMTS9 to activate the PI3K/AKT/mTOR pathway. Note: (a) MDC staining was used to detect the autophagy of control, IL-1β, IL-1β + miR-93-5p inhibitor, IL-1β + si-ADAMTS9, and IL-1β + miR-93-5p inhibitor + si-ADAMTS9 group in chondrocytes. (b) Flow cytometry was used to detect the apoptosis of control, IL-1β, IL-1β + miR-93-5p inhibitor, IL-1β + si-ADAMTS9, and IL-1β + miR-93-5p inhibitor + si-ADAMTS9 group in chondrocytes. (c) Western blot assay was used to detect the expression of PI3K, P-mTOR, P-AKT, Bcl-2/Bax, and LC3B-I/II expression of control, IL-1β, IL-1β + miR-93-5p inhibitor, IL-1β + si-ADAMTS9, and IL-1β + miR-93-5p inhibitor + si-ADAMTS9 group.

3.4 miR-93-5p derived from ADSC-exos inhibited autophagy and apoptosis of IL-1β-treated chondrocytes

Recent studies have shown that ADSC-exos play an important role in OA [28,29]. To further clarify the protective effect of ADSC-exos after OA, we isolated and identified exosomes from ADSCs. TEM analysis of isolated exosomes showed round structures with diameters between 30 and 150 nm (Figure 4a). As shown in Figure 4b, exosome markers CD9, CD81, and TSG101 in ADSC-exos were characterized by the western blot assay. Previous study confirmed that miR-93-5p-enhanced ADSC-derived exosomes can prevent cardiac injury by targeting Atg7 and Toll-like receptor 4 (TLR4) and inhibiting hypoxia-induced autophagy and inflammatory cytokine expression [26]. To further clarify the protective effect of ADSC-exos after OA, we co-incubated ADSC-exos with the IL-1β-treated chondrocytes. As shown in Figure 4c, compared with IL-1β-treated chondrocytes, the expression of pro-inflammatory factors (IL-6, IL-1β, TNF-α) and iNOS in the experimental group (IL-1β + exosomes and IL-1β + miR-93-5p mimic) was significantly downregulated, while significantly upregulated in the IL-1β + miR-93-5p inhibitor group.

Figure 4 
                  miR-93-5p derived from ADSC-exos inhibited autophagy and apoptosis of IL-1β-treated chondrocytes. Note: (a) the structure of isolated exosomes was analyzed by TEM. (b) Exosome markers CD9, CD81, and TSG101 in ADSC-exos were characterized by the western blot assay. *P < 0.05; **P < 0.01; ***P < 0.001. (c) RT-qPCR was performed to detect the expression of pro-inflammatory factors (IL-6, IL-1β, TNF-α) and iNOS in IL-1β, IL-1β + exo, IL-1β + exo + inhibitor/mimic NC, and IL-1β + exo + miR-93-5p inhibitor/mimic group. *P < 0.05; **P < 0.01; ***P < 0.001.
Figure 4

miR-93-5p derived from ADSC-exos inhibited autophagy and apoptosis of IL-1β-treated chondrocytes. Note: (a) the structure of isolated exosomes was analyzed by TEM. (b) Exosome markers CD9, CD81, and TSG101 in ADSC-exos were characterized by the western blot assay. *P < 0.05; **P < 0.01; ***P < 0.001. (c) RT-qPCR was performed to detect the expression of pro-inflammatory factors (IL-6, IL-1β, TNF-α) and iNOS in IL-1β, IL-1β + exo, IL-1β + exo + inhibitor/mimic NC, and IL-1β + exo + miR-93-5p inhibitor/mimic group. *P < 0.05; **P < 0.01; ***P < 0.001.

4 Discussion

In this study, miR-93-5p inhibited the autophagy and apoptosis of IL-1β-treated chondrocytes by targeting ADAMTS9 to activate the PI3K/AKT/mTOR pathway. Furthermore, ADSC-derived exosomal miR-93-5p inhibited autophagy and apoptosis of IL-1β-treated chondrocytes. Therefore, this study first suggested that the ADSC-exos/miR-93-5p/ADAMTS9 axis represents a promising therapeutic strategy for OA.

OA is known as a progressive degeneration of articular cartilage, resulting in the abnormal metabolism of subchondral bone osteoblast [33]. Although both pharmacologic therapies administrated intra-articular, orally and topically and non-pharmacologic treatments including exercise have been applied in OA therapy, the efficacy has been short-lived or not immediately [34]. At present, OA is mainly diagnosed by radiography, computed tomography, ultrasound, and magnetic resonance imaging. Using current methods, OA is usually diagnosed at a late stage of disease development, meaning that the lesions in the joint tissues have progressed to irreversible damage, missing the best time for intervention [35]. The development of new biomarkers may facilitate early detection of the disease and subsequent more effective treatment [36]. Abnormal regulation of miRNA levels is closely related to many diseases including OA [37,38]. Consequently, it is crucial to reveal genetic networks modulated via these miRNAs in OA and develop a new treatment method to suppress inflammation after OA.

miR-93, a member of the miR-106b-25 family, located within an intron of MCM7 gene, is highly expressed in a variety of cancers and acts as an oncogene [39]. Previous studies found that BMSC-exos exert a protective role in wound healing by upregulating miR-93-3p [40]. Moreover, miR-93-5p is involved in the inflammatory cytokine expression and autophagy [25,26]. miR-93-5p has been revealed to regulate IL-1β-induced cartilage degradation and chondrocyte apoptosis in OA by targeting TCF4 [27]. The previous investigation has found that IL-1β plays a critical role in cartilage degeneration, which is associated with the etiology of OA [41]. According to available studies, IL-1β is increased in osteoarthritic joint tissues and contributes to the development of OA. And it was able to induce the decrease of the generation of collagen type II and aggrecan and increased the production of MMPs [42]. Precious studies identified two aggrecanase proteins, ADAMTS-4 and ADAMTS-5 [43,44]. They are both the members of the ADAMTS family of zinc metalloproteinases. The analysis of gene expression and methylation datasets identified ADAMTS9 as biomarkers for OA [12,45]. In this study, we found that the expression of miR-93-5p in IL-1β induced chondrocytes was significantly decreased, while ADAMTS9 was significantly increased. The dual luciferase reporter gene assay showed that ADAMTS9 was the target gene of miR-93-5p. And then, we testified that the inhibition of autophagy and apoptosis of miR-93-5p inhibitor could be partially reversed by si-ADAMTS9 in IL-1β-treated chondrocytes. According to available evidence, the PI3K/AKT/mTOR signaling pathway plays a key role in cartilage degradation, subchondral bone dysfunction, and synovial inflammation and participates in the development of OA [46]. Previous research has also indicated that the PI3K/AKT/mTOR pathway may be associated with various aspects of autophagy [47,48]. And several studies have demonstrated that the PI3K/Akt/mTOR signaling pathway is closely related to the autophagy and apoptosis of IL-1β-treated articular chondrocytes [49,50,51]. In this study, PI3K expression was found to be decreased following the inhibition of miR-93-5p in IL-1β-treated chondrocytes, along with the increase of apoptosis and autophagy. In addition, the inhibition of miR-93-5p inhibitor on PI3K, P-mTOR, and P-AKT expressions could be partially reversed by si-ADAMTS9. Taken together, the results suggested that miR-93-5p may considerably inhibit the development of OA by modulating the PI3K/AKT/mTOR pathway.

Recent studies have shown that ADSC-exos play an important role in OA [28,29]. For example, ADSC-exos increased Prdx6 expression in OA chondrocytes stimulated with IL-1β- and Prdx6-protected OA chondrocytes against the consequences of IL-1β stimulation [52]. ADSC-exos inhibited the inflammation and promoted chondrogenesis by upregulating miR-145/miR-221 [53]. In our study, the expression of pro-inflammatory factors (IL-6, IL-1β, TNF-α) and iNOS in the experimental group (IL-1β + exosomes and IL-1β + miR-93-5p mimic) was significantly downregulated, while significantly upregulated in the IL-1β + miR-93-5p inhibitor group.

5 Conclusion

In summary, within the scope of our understanding, this study first demonstrated that ADSC-derived exosomal miR-93-5p inhibited the autophagy and apoptosis of IL-1β-treated chondrocytes through PI3K/AKT/mTOR signaling pathway, thereby inhibiting inflammation and alleviating OA. This provides a new method for the treatment of OA.

Abbreviations

OA

osteoarthritis

MDC

monodansylcadaverine

TEM

transmission electron microscopy

ADAMTS9

ADAM metallopeptidase with thrombospondin type 1 motif, 9

siRNA

small-interfering RNA

RT-qPCR

reverse transcription quantitative polymerase chain reaction

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

NC

negative control

WT

wild type

MUT

mutant type

DMEM

Dulbecco’s modified eagle medium

SDS-PAGE

Sodium dodecyl sulfate–polyacrylamide gel electrophoresis

PVDF

Polyvinylidene fluoride

BSA

Bovine serum albumin


# These authors contributed equally to the work.


Acknowledgements

Not applicable.

  1. Funding information: This work is supported by Yunnan Basic Research Projects [No. 202101AT070228] and The First People’s Hospital of Yunnan Province Research Projects [KHBS-2020-002].

  2. Author contributions: Conception and design: Yachen Li and Junjun Duan. Administrative support: Jie Liu. Provision of study materials or patients: all authors. Collection and assembly of data: Weicheng Lin. Data analysis and interpretation: Jie Liu. Writing – original draft: Yachen Li and Junjun Duan. Writing – review & editing: Jie Liu. Manuscript writing: all authors. Final approval of manuscript: all authors.

  3. Conflict of interest: All authors have completed the ICMJE uniform disclosure form. The authors have no conflict of interest to declare.

  4. Data availability statement: The data will be available from all authors on reasonable request.

References

[1] Yu C, Chen WP, Wang XH. MicroRNA in Osteoarthritis. J Int Med Res. 2011;39(1):1–9.10.1177/147323001103900101Suche in Google Scholar PubMed

[2] Urban H, Little CB. The role of fat and inflammation in the pathogenesis and management of osteoarthritis. Rheumatol (Oxf). 2018;57(suppl_4):iv10–21.10.1093/rheumatology/kex399Suche in Google Scholar PubMed

[3] Goldring MB. The role of the chondrocyte in osteoarthritis. Arthritis Rheum. 2000;43(9):1916–26.10.1002/1529-0131(200009)43:9<1916::AID-ANR2>3.0.CO;2-ISuche in Google Scholar

[4] Litwic A, Edwards MH, Dennison EM, Cooper C. Epidemiology and burden of osteoarthritis. Br Med Bull. 2013;105:185–99.10.1093/bmb/lds038Suche in Google Scholar

[5] Goldring MB. The role of cytokines as inflammatory mediators in osteoarthritis: lessons from animal models. Connect Tissue Res. 1999;40(1):1–11.10.3109/03008209909005273Suche in Google Scholar

[6] Goldring MB. Osteoarthritis and cartilage: the role of cytokines. Curr Rheumatol Rep. 2000;2(6):459–65.10.1007/s11926-000-0021-ySuche in Google Scholar

[7] Huang K, Wu LD. Aggrecanase and aggrecan degradation in osteoarthritis: A review. J Int Med Res. 2008;36(6):1149–60.10.1177/147323000803600601Suche in Google Scholar

[8] Poole AR, Kobayashi M, Yasuda T, Laverty S, Mwale F, Kojima T, et al. Type II collagen degradation and its regulation in articular cartilage in osteoarthritis. Ann Rheumatic Dis. 2002;61(suppl 2):ii78–81.10.1136/ard.61.suppl_2.ii78Suche in Google Scholar

[9] Sandell LJ, Aigner T. Articular cartilage and changes in Arthritis: Cell biology of osteoarthritis. Arthritis Res Ther. 2001;3(2):107–13.10.1186/ar148Suche in Google Scholar

[10] Apte SS. A disintegrin-like and metalloprotease (reprolysin-type) with thrombospondin type 1 motif (ADAMTS) superfamily: functions and mechanisms. J Biol Chem. 2009;284(46):31493–7.10.1074/jbc.R109.052340Suche in Google Scholar

[11] Glasson SS, Askew R, Sheppard B, Carito B, Blanchet T, Ma HL, et al. Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis. Nature. 2005;434(7033):644–8.10.1038/nature03369Suche in Google Scholar PubMed

[12] Li Z, Zhang R, Yang X, Zhang D, Li B, Zhang D, et al. Analysis of gene expression and methylation datasets identified ADAMTS9, FKBP5, and PFKBF3 as biomarkers for osteoarthritis. J Cell Physiol. 2019;234(6):8908–17.10.1002/jcp.27557Suche in Google Scholar PubMed

[13] Caramés B, Taniguchi N, Otsuki S, Blanco FJ, Lotz M. Autophagy is a protective mechanism in normal cartilage, and its aging-related loss is linked with cell death and osteoarthritis. Arthritis Rheum. 2010;62(3):791–801.10.1002/art.27305Suche in Google Scholar PubMed PubMed Central

[14] Thomas CM, Fuller CJ, Whittles CE, Sharif M. Chondrocyte death by apoptosis is associated with cartilage matrix degradation. Osteoarthr Cartil. 2007;15(1):27–34.10.1016/j.joca.2006.06.012Suche in Google Scholar PubMed

[15] Xue JF, Shi ZM, Zou J, Li XL. Inhibition of PI3K/AKT/mTOR signaling pathway promotes autophagy of articular chondrocytes and attenuates inflammatory response in rats with osteoarthritis. Biomed Pharmacother. 2017;89:1252–61.10.1016/j.biopha.2017.01.130Suche in Google Scholar PubMed

[16] Zamli Z, Sharif M. Chondrocyte apoptosis: a cause or consequence of osteoarthritis. Int J Rheum Dis. 2011;14(2):159–66.10.1111/j.1756-185X.2011.01618.xSuche in Google Scholar PubMed

[17] Jeon H, Im GI. Autophagy in osteoarthritis. Connect Tissue Res. 2017;58(6):497–508.10.1080/03008207.2016.1240790Suche in Google Scholar PubMed

[18] Xie F, Liu YL, Chen XY, Li Q, Zhong J, Dai BY, et al. Role of MicroRNA, LncRNA, and exosomes in the progression of osteoarthritis: A review of recent literature. Orthop Surg. 2020;12(3):708–16.10.1111/os.12690Suche in Google Scholar PubMed PubMed Central

[19] Tao SC, Yuan T, Zhang YL, Yin WJ, Guo SC, Zhang CQ. Exosomes derived from miR-140-5p-overexpressing human synovial mesenchymal stem cells enhance cartilage tissue regeneration and prevent osteoarthritis of the knee in a rat model. Theranostics. 2017;7(1):180–95.10.7150/thno.17133Suche in Google Scholar PubMed PubMed Central

[20] Ren T, Wei P, Song Q, Ye Z, Wang Y, Huang L. MiR-140-3p ameliorates the progression of osteoarthritis via targeting CXCR4. Biol Pharm Bull. 2020;43(5):810–6.10.1248/bpb.b19-00959Suche in Google Scholar PubMed

[21] Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136(2):215–33.10.1016/j.cell.2009.01.002Suche in Google Scholar PubMed PubMed Central

[22] Chen J, Wu X. MicroRNA-103 contributes to osteoarthritis development by targeting Sox6. Biomed Pharmacother. 2019;118:109186–92.10.1016/j.biopha.2019.109186Suche in Google Scholar PubMed

[23] Li H, Li Z, Pi Y, Chen Y, Mei L, Luo Y, et al. MicroRNA-375 exacerbates knee osteoarthritis through repressing chondrocyte autophagy by targeting ATG2B. Aging (Albany NY). 2020;12(8):7248–61.10.18632/aging.103073Suche in Google Scholar PubMed PubMed Central

[24] Yan XT, Ji LJ, Wang Z, Wu X, Wang Q, Sun S, et al. MicroRNA-93 alleviates neuropathic pain through targeting signal transducer and activator of transcription 3. Int Immunopharmacol. 2017;46:156–62.10.1016/j.intimp.2017.01.027Suche in Google Scholar PubMed

[25] Hua Q, Chen Y, Liu Y, Li M, Diao Q, Xue H, et al. Circular RNA 0039411 is involved in neodymium oxide-induced inflammation and antiproliferation in a human bronchial epithelial cell line via sponging miR-93-5p. Toxicol Sci. 2019;170(1):69–81.10.1093/toxsci/kfz074Suche in Google Scholar PubMed

[26] Liu J, Jiang M, Deng S, Lu J, Huang H, Zhang Y, et al. miR-93-5p-containing exosomes treatment attenuates acute myocardial infarction-induced myocardial damage. Mol Ther Nucleic Acids. 2018;11:103–15.10.1016/j.omtn.2018.01.010Suche in Google Scholar PubMed PubMed Central

[27] Xue H, Tu Y, Ma T, Wen T, Yang T, Xue L, et al. miR-93-5p attenuates IL-1β-induced chondrocyte apoptosis and cartilage degradation in osteoarthritis partially by targeting TCF4. Bone. 2019;123:129–36.10.1016/j.bone.2019.03.035Suche in Google Scholar PubMed

[28] Zhang R, Ma J, Han J, Zhang W, Ma J. Mesenchymal stem cell related therapies for cartilage lesions and osteoarthritis. Am J Transl Res. 2019;11(10):6275–89.Suche in Google Scholar

[29] Wu J, Kuang L, Chen C, Yang J, Zeng WN, Li T, et al. miR-100-5p-abundant exosomes derived from infrapatellar fat pad MSCs protect articular cartilage and ameliorate gait abnormalities via inhibition of mTOR in osteoarthritis. Biomaterials. 2019;206:87–100.10.1016/j.biomaterials.2019.03.022Suche in Google Scholar PubMed

[30] Zhao C, Chen JY, Peng WM, Yuan B, Bi Q, Xu YJ. Exosomes from adipose‑derived stem cells promote chondrogenesis and suppress inflammation by upregulating miR‑145 and miR‑221. Mol Med Rep. 2020;21(4):1881–9.Suche in Google Scholar

[31] Shin K-O, Ha DH, Kim JO, Crumrine DA, Meyer JM, Wakefield JS, et al. Exosomes from human adipose tissue-derived mesenchymal stem cells promote epidermal barrier repair by inducing de novo synthesis of ceramides in atopic dermatitis. Cells. 2020;9(3):680–702.10.3390/cells9030680Suche in Google Scholar PubMed PubMed Central

[32] Lu T, Peng W, Liang Y, Li M, Li D-S, Du K-H, et al. PTEN-silencing combined with ChABC-overexpression in adipose-derived stem cells promotes functional recovery of spinal cord injury in rats. Biochem Biophys Res Commun. 2020;532(3):420–6.10.1016/j.bbrc.2020.08.085Suche in Google Scholar PubMed

[33] Prasadam I, Friis T, Shi W, van Gennip S, Crawford R, Xiao Y. Osteoarthritic cartilage chondrocytes alter subchondral bone osteoblast differentiation via MAPK signalling pathway involving ERK1/2. Bone. 2010;46(1):226–35.10.1016/j.bone.2009.10.014Suche in Google Scholar PubMed

[34] Nelson AE. Osteoarthritis year in review 2017: clinical. Osteoarthr Cartil. 2018;26(3):319–25.10.1016/j.joca.2017.11.014Suche in Google Scholar PubMed PubMed Central

[35] McAllister MJ, Chemaly M, Eakin AJ, Gibson DS, McGilligan VE. NLRP3 as a potentially novel biomarker for the management of osteoarthritis. Osteoarthr Cartil. 2018;26(5):612–9.10.1016/j.joca.2018.02.901Suche in Google Scholar PubMed

[36] Kraus VB, Burnett B, Coindreau J, Cottrell S, Eyre D, Gendreau M, et al. Application of biomarkers in the development of drugs intended for the treatment of osteoarthritis. Osteoarthr Cartil. 2011;19(5):515–42.10.1016/j.joca.2010.08.019Suche in Google Scholar PubMed PubMed Central

[37] Nugent M. MicroRNAs: exploring new horizons in osteoarthritis. Osteoarthr Cartil. 2016;24(4):573–80.10.1016/j.joca.2015.10.018Suche in Google Scholar PubMed

[38] Ha TY. MicroRNAs in human diseases: From cancer to cardiovascular disease. Immune Netw. 2011;11(3):135–54.10.4110/in.2011.11.3.135Suche in Google Scholar PubMed PubMed Central

[39] Mehlich D, Garbicz F, Wlodarski PK. The emerging roles of the polycistronic miR-106b approximately 25 cluster in cancer – A comprehensive review. Biomed Pharmacother. 2018;107:1183–95.10.1016/j.biopha.2018.08.097Suche in Google Scholar PubMed

[40] Shen C, Tao C, Zhang A, Li X, Guo Y, Wei H, et al. Exosomal microRNA rectangle93 rectangle3p secreted by bone marrow mesenchymal stem cells downregulates apoptotic peptidase activating factor 1 to promote wound healing. Bioengineered. 2022;13(1):27–37.10.1080/21655979.2021.1997077Suche in Google Scholar PubMed PubMed Central

[41] Hashimoto M, Nakasa T, Hikata T, Asahara H. Molecular network of cartilage homeostasis and osteoarthritis. Med Res Rev. 2008;28(3):464–81.10.1002/med.20113Suche in Google Scholar PubMed

[42] Yang B, Kang X, Xing Y, Dou C, Kang F, Li J, et al. Effect of microRNA-145 on IL-1β-induced cartilage degradation in human chondrocytes. FEBS Lett. 2014;588(14):2344–52.10.1016/j.febslet.2014.05.033Suche in Google Scholar PubMed

[43] Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, et al. Purification and cloning of aggrecanase-1: a member of the ADAMTS family of proteins. Science. 1999;284(5420):1664–6.10.1126/science.284.5420.1664Suche in Google Scholar PubMed

[44] Bondeson J, Wainwright S, Hughes C, Caterson B. The regulation of the ADAMTS4 and ADAMTS5 aggrecanases in osteoarthritis: a review. Clin Exp Rheumatol. 2008;26(1):139–45.Suche in Google Scholar

[45] Ohtsuki T, Shinaoka A, Kumagishi-Shinaoka K, Asano K, Hatipoglu OF, Inagaki J, et al. Mechanical strain attenuates cytokine-induced ADAMTS9 expression via transient receptor potential vanilloid type 1. Exp Cell Res. 2019;383(2):111556.10.1016/j.yexcr.2019.111556Suche in Google Scholar PubMed

[46] Sun K, Luo J, Guo J, Yao X, Jing X, Guo F. The PI3K/AKT/mTOR signaling pathway in osteoarthritis: a narrative review. Osteoarthr Cartil. 2020;28(4):400–9.10.1016/j.joca.2020.02.027Suche in Google Scholar PubMed

[47] Huang H, Song J, Liu Z, Pan L, Xu G. Autophagy activation promotes bevacizumab resistance in glioblastoma by suppressing Akt/mTOR signaling pathway. Oncol Lett. 2018;15(2):1487–94.10.3892/ol.2017.7446Suche in Google Scholar PubMed PubMed Central

[48] Li W, Jiang Y, Wang Y, Yang S, Bi X, Pan X, et al. MiR-181b regulates autophagy in a model of Parkinson’s disease by targeting the PTEN/Akt/mTOR signaling pathway. Neurosci Lett. 2018;675:83–8.10.1016/j.neulet.2018.03.041Suche in Google Scholar PubMed

[49] Shi X, Han L, Sun T, Zhang F, Ji S, Zhang M, et al. Silencing UHRF1 enhances cell autophagy to prevent articular chondrocytes from apoptosis in osteoarthritis through PI3K/AKT/mTOR signaling pathway. Biochem Biophys Res Commun. 2020;529(4):1018–24.10.1016/j.bbrc.2020.06.032Suche in Google Scholar PubMed

[50] Xu K, He Y, Moqbel SAA, Zhou X, Wu L, Bao J. SIRT3 ameliorates osteoarthritis via regulating chondrocyte autophagy and apoptosis through the PI3K/Akt/mTOR pathway. Int J Biol Macromol. 2021;175:351–60.10.1016/j.ijbiomac.2021.02.029Suche in Google Scholar PubMed

[51] Feng FB, Qiu HY. Effects of Artesunate on chondrocyte proliferation, apoptosis and autophagy through the PI3K/AKT/mTOR signaling pathway in rat models with rheumatoid arthritis. Biomed Pharmacother. 2018;102:1209–20.10.1016/j.biopha.2018.03.142Suche in Google Scholar PubMed

[52] Guillén MI, Tofiño-Vian M, Silvestre A, Castejón MA, Alcaraz MJ. Role of peroxiredoxin 6 in the chondroprotective effects of microvesicles from human adipose tissue-derived mesenchymal stem cells. J Orthop Transl. 2021;30:61–9.10.1016/j.jot.2021.08.003Suche in Google Scholar PubMed PubMed Central

[53] Zhao C, Chen JY, Peng WM, Yuan B, Bi Q, Xu YJ. Exosomes from adiposederived stem cells promote chondrogenesis and suppress inflammation by upregulating miR145 and miR221. Mol Med Rep. 2020;21(4):1881–9.10.3892/mmr.2020.10982Suche in Google Scholar PubMed PubMed Central

Received: 2022-07-14
Revised: 2023-02-08
Accepted: 2023-02-13
Published Online: 2023-03-15

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Heruntergeladen am 13.10.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0668/html
Button zum nach oben scrollen