Home The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
Article Open Access

The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer

  • Chengzhe Lai , Jinghu Liu , Jingna Zhou and Haokun Zhou EMAIL logo
Published/Copyright: February 12, 2025
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 20 Issue 1

Abstract

Background

Oxaliplatin (OXA) is among the most common chemotherapy drugs and is the base component of the FOLFOX regimen (OXA + leucovorin + 5-fluorouracil) and CapeOX regimen (OXA + capecitabine). Resistance to and failure of these two OXA-based regimens often results in poor outcomes in patients with colorectal cancer (CRC). Nitrendipine (NTD) is a first-line antihypertensive drug commonly used in hypertension and coronary heart disease with confirmed low toxicity and side effects. However, the potential benefits of NTD for CRC progression and therapy remain unclear.

Methods

Cell counting kit-8 (CCK-8) detection, colony formation assay, wound-healing assay, Transwell assay, SynergyFinder webtool, and subcutaneous tumor models were used to assess the effect of NTD with OXA on CRC inhibition in vitro and in vivo. Bioinformatics tools including Human Protein Atlas (HPA), quantitative real-time polymerase chain reaction, western blotting analyses, lentivirus transfection, and rescue experiment were used to investigate the mechanism(s) of the related action.

Results

Utilizing murine and human CRC cell lines, the in vitro and in vivo experiment demonstrated that NTD inhibited cell proliferation, migration, and invasion, and the synergy scores calculated by SynergyFinder indicated that NTD exhibited synergistic activity with the chemotherapeutic drug OXA. The CCK-8 detection, animal model, and rescue experiment results demonstrated that NTD suppressed CRC progression and potentiated OXA therapeutic effect by downregulating calcium voltage-gated channel subunit alpha1 D (CACNA1D).

Conclusions

This study presents novel data on first-line antihypertensive NTD, exerting inhibitory effects on cell proliferation and migration in CRC and revealing synergistic activity with OXA by downregulating CACNA1D. NTD may be a candidate as a promising chemosensitizer as an OXA new combination to improve the efficacy and safety of CRC therapy.

Keywords: antihypertensive; nitrendipine; oxaliplatin; colorectal cancer; CACNA1D

1 Introduction

Colorectal cancer (CRC) remains a major public health problem worldwide and is the second most frequent malignancy, with a high case–fatality ratio [1]. Currently, surgery, chemotherapy, antiangiogenic therapy, and radiotherapy have greatly benefited patients with CRC by prolonging survival time, improving quality of life, and achieving a complete cure [2]. Many early-stage patients with CRC could receive considerable therapeutic benefits from surgery, such as total colorectal resection [3]. Nevertheless, due to the lack of easily distinguishable symptoms, precise diagnosis of early-stage CRC remains difficult, and most patients often have a confirmed diagnosis of advanced-stage CRC and need to receive combined therapeutic regimens, including surgery and chemotherapy [4,5]. The present situation may indicate that metastatic or advanced patients demonstrate a very poor 5-year survival rate of approximately 10% due to chemotherapy resistance and failure [6]. Therefore, there is an urgent need to identify and develop effective therapeutic strategies to reduce recurrence and improve CRC prognosis.

Oxaliplatin (OXA) is among the most common chemotherapy drugs used in advanced patients with CRC, which is the basic agent of the FOLFOX regimen (OXA + leucovorin + 5-fluorouracil) and CapeOx regimen (OXA + capecitabine). It markedly impedes CRC progression and brings considerable therapeutic benefits to patients with CRC [7,8,9]. However, long-term repeated use of OXA combination regimens often results in chemotherapy resistance and failure [10]. Moreover, the significant toxicities of the current chemotherapy regimens (CapeOx or FOLFOX), including gastrointestinal, hematological, and neurological toxicities, could further block the continuity of the therapy regimen [11,12]. Consequently, there is a need to identify and develop novel chemosensitizers as new OXA combinations to enhance overall clinical efficacy.

Nitrendipine (NTD) is a first-line antihypertensive agent of dihydropyridine calcium channel blockers (CCBs). It has been widely used in clinical practice for many years for its high efficiency and low toxicity [13]. Recently, many researchers have focused on exploring and identifying the potential anticancer activities of CCBs, such as amlodipine and nifedipine [14,15]. For example, Wu et al. [15] reported that another CCB, nifedipine, prevents immune escape and enhances immune checkpoint blockade in CRC. However, the role and clinical significance of the more commonly used CCBs NTD in CRC progression and chemotherapy remains largely unknown.

In this study, we aimed to explore the role of NTD in CRC progression in combination with OXA and to elucidate the specific molecular mechanisms that may be involved. Our results indicated that by downregulating the expression of calcium voltage-gated channel subunit alpha1 D (CACNA1D), NTD significantly inhibited the proliferation and migration of CRC cells and enhanced OXA efficacy in vitro and in vivo.

2 Materials and methods

2.1 Chemicals and reagents

The NTD was bought from Yuanye Biotechnology Co., Ltd (Cat # B27254, Shanghai, China). Oxaliplatin was obtained from Macklin Biotechnology Co., Ltd (Cat # O815347, Shanghai, China). NTD and OXA were dissolved in dimethyl sulfoxide and stored at –20°C.

2.2 Cell culture

The murine CRC cell line MC38 was procured from Bohui Biological Technology Co., Ltd (Cat # BH-C459, Guangzhou, China), and human CRC cell lines RKO, LOVO, SW-620, and HT29 were acquired from Bohui Biological Technology Co., Ltd (Cat # BH-C459, Cat # BH-C113, Cat # BH-C226, Cat # BH-C132, and Cat # BH-C062, Guangzhou, China) and were initially obtained from the American Type Culture Collection (Cat # CRL-2577, Cat # CCL-229, Cat # CCL-227, and Cat # HTB-38, Maryland, USA). FHC was procured from Meisen Biological Technology Co., Ltd (Cat # CTCC-001-0208, Guangzhou, China). MC38 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Cat # C11995500BT, Gibco, USA). In contrast, RKO and HT29 cells were cultured in Roswell Park Memorial Institute-1640 (RPMI-1640, Cat # C11875500BT, Gibco, USA) medium supplemented with 10% fetal bovine serum (FBS, Cat # 10091, Gibco, USA) and 1% penicillin–streptomycin (Cat # P1400, Solarbio, China). The culture medium for FHC was DMEM with 20% FBS. All cell lines were subjected to mycoplasma testing. Cells were cultured in an incubator with an atmosphere of 5% CO2 at 37°C.

2.3 Cell counting kit-8 (CCK-8) detection

MC38, RKO, and HT29 cells were seeded in 96-well plates at a density of 1,000 cells/well. OXA and NTD were diluted to gradient concentrations in the corresponding complete media. The previous medium was replaced with the prepared solution, and the cells were cultured in an incubator with an atmosphere of 5% CO2 at 37°C for 48 h. Finally, CCK-8 (Cat # CK04, Dojindo, Japan) was employed to examine the cell viability following the manufacturer’s protocol. After each well was replaced with the solution (CCK-8: culture medium = 1:9) and incubated for 4 h, a microplate reader was used to detect the optical density (OD) value of each well at 450 nm. GraphPad Prism software (version 9.0; GraphPad, La Jolla, CA, USA) was employed to calculate 50% inhibitory concentration (IC50) values.

2.4 Synergy determination with SynergyFinder

MC38, RKO, and HT29 cells were seeded into 96-well plates at 1,000 cells/well density and prepared for treatment as described below. Either single treatment alone (NTD, OXA) or combinations (NTD and OXA) were analyzed using the indicated amounts from the CCK-8 detection above. The IC50 value of each drug was calculated as the concentration gradient (NTD concentration: 25, 50, 100, 250, and 500 μM; OXA concentration: 3.125, 6.25, 12.5, 25, and 50 μM). After 48 h of treatment, the CCK-8 kit was utilized to examine cell viability on a microplate reader (Cat # 1681135, Bio-Rad Laboratories Inc., USA), as described above. The OD value of each well at 450 nm was determined using EXCEL software and was ready for the next analysis. By utilizing the response surface model and zero interaction potency (ZIP) calculation method, the online software SynergyFinder (https://synergy-finder.fimm.fi) was employed to calculate drug synergy scoring with the “inhibition index” (the inhibition index = 100 – cell viability). When the ZIP synergy scores were greater than 0, the synergy determination was synergism (red regions), and scores greater than 10 were strongly synergistic. Heat maps of drug synergistic responses were also plotted to reveal the therapeutic significance of the combination [16].

2.5 Colony formation assay

MC38 and RKO cells were seeded in six-well plates at 600 cells/well density and cultured in an incubator with an atmosphere of 5% CO2 at 37°C for 24 h. The culture medium was replaced with a complete medium containing NTD or OXA. Finally, the colonies were fixed with 4% paraformaldehyde and stained with the Giemsa dye for 30 min. ImageJ software was used to count the number of stained colonies.

2.6 Wound-healing assay

RKO cells were seeded in six-well plates at a density of 2 × 106 cells/well. The cells were grown into a monolayer. A small pipette tip was used to create a scratch wound in each well. At 0, 12, 24, and 36 h after treatment, photos of three randomly selected microscopic fields (×200) were taken to evaluate the migration status of the cells. The wound healing area was calculated using ImageJ software, and the ratio of cell migration was calculated.

2.7 Animal experiments

C57BL/6J female mice (5–6 weeks old, 19–20 g) were procured from Guang Dong Model Biotechnology Co., Ltd (China) and bred under specific pathogen-free conditions. To establish the CRC model, MC38 cells were subcutaneously injected into the right flank of mice at a density of 5 × 105 cells per mouse. When the tumor volume approached 50–100 mm3, the mice were randomly assigned to four groups (control, NTD treatment alone, OXA treatment alone, and combination treatment groups). The mice received OXA (3 mg/kg/2 days, intraperitoneally [i.p.]) and NTD (25 mg/kg/2 days, i.p.). Two to three weeks after cell injection, the tumors were harvested when the tumor mass approached approximately 1,000 mm3 (less than 1,500 mm3) or when obvious ulceration or cachexia occurred. The procedure refers to the material and method used in a recent study [15,16].

2.8 Quantitative real-time polymerase chain reaction (qPCR) assay

Control and treated cells or tumor tissues were collected at a low temperature. The cells were lysed using TRIzol reagent (Cat # 15596026CN, Invitrogen, USA), and total RNA was extracted according to the manufacturer’s protocol. Prime-Script RT Reagent Kit (Cat # RR037A, Promega, Madison, WI, USA) was employed to reverse-transcribed the mRNA into cDNA. SYBR Green PCR Mix (Cat # K1070, Apexbio, USA) was used for qPCR using a Roche LightCycler 480 Real-Time PCR System (Cat # LightCycler 480 II, Roche Life Science, USA). GAPDH was used as an internal control. The primer sequences for GAPDH amplification were as follows: forward primer: GGAGCGAGATCCC-TCCAAAAT; reverse primer: GGCTGTTGTCATAC TTCTCATGG. The primer sequences for CACNA1D amplification were as follows: forward primer: CGCGAACGAGGCAAACTATG; reverse primer: TTGGAGCTATTCG-GCTGAGAA. The relative expression levels of target genes were normalized using the 2–ΔΔCt method. The experiments were conducted three times in the same procedure.

2.9 Western blotting analysis

Total cell proteins were collected, lysed, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and electro-transferred onto a polyvinylidene difluoride membrane. Then, the membranes were blocked with 5% skimmed milk and incubated using primary antibodies against GAPDH (1:1,000 dilution, Cat # RM2002, Beijing Ray Antibody Biotech), anti-CACNA1D (1:500 dilution, Cat # ab85491, Abcam, USA), followed by incubation with the appropriate secondary antibodies. An enhanced chemiluminescence (Cat # 750L, Pierce, Rockford, IL, USA) was used to detect signals.

2.10 RNA interference and lentivirus transfection

The human siRNA sequence targeting CACNA1D (siCACNA1D) was GCGTGCTATATCGTGTGATTT (Cat # siBDMV002-10, Ribobio, China). RKO cells were successfully transfected with siRNA using Lipofectamine 2000 (Cat # 11668030, Thermo Fisher, USA). The murine shRNA sequences targeting CACNA1D (shCACNA1D) were CCTGCATTAGTATAGTGGAAT (Cat # S24042008, Cyagen, Suchow, China). PCDNA3.1-mouse-CACNA1D was obtained from Vigene (Cat#WZ010001, Shan Dong, China). First, package tool cells HEK293 were transfected with plasmids using Lipofectamine 2000 for 24 h. The medium was then replaced with DMEM supplemented with 10% FBS. After 48 h, the targeted recombinant lentiviruses were collected and transfected into the CRC cells. The knockdown efficiency was examined by qPCR.

2.11 Bioinformatics analysis

The mRNA expression of CACNA1D generated by TCGA was obtained from the Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database (http://gepia2.cancer-pku.cn/#index), and the protein expression of CACNA1D in patients with CRC was obtained from the Human Protein Atlas (HPA) database.

2.12 Statistical analysis

All statistical analyses were performed using SynergyFinder and GraphPad Prism (version 9.0) software. Numerical data are presented as mean ± standard deviation. The statistical significance of the differences was analyzed using Student’s and unpaired t-tests according to the test of homogeneity of variances. Survival rates were evaluated using the Kaplan–Meier method and tested using the log-rank test. Error bars represent the standard error of the mean; n.s. no significance; *p < 0.05; **p < 0.01; ***p < 0.001; p < 0.0001. p < 0.05 was considered statistically significant.

  1. Ethical statement: The animal study was in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and reviewed and approved by Taizhou University.

3 Results

3.1 NTD inhibited the cell proliferation and migration viability of CRC cells

The CCK-8 assay was used to assess the biological effect of NTD in a concentration gradient on the murine and human CRC cell lines MC38, RKO, and HT29. As demonstrated by the dose–response curves, NTD exerted an inhibitory effect on each cell line in a concentration-dependent manner (Figure 1(a)–(c)). The IC50 value was also calculated and was displayed in Figure 1(d). We also found that the non-cytotoxic concentration of NTD was not more than 100 μM (Figure S1(a)). Next, we performed a colony formation assay to confirm the antiproliferative effect of NTD on CRC cells. The result indicated that NTD highly inhibited colony formation in the murine CRC cell lines MC38 and CT26 (Figure 1(e) and (f) and Figure S1(d) and (e)) and the human CRC cell line RKO and HT29 (Figure 1(g) and (h) and Figure S1(b) and (c)). Furthermore, NTD not only illustrated an inhibiting effect on RKO invasion but also exerted strong synergistic preventive effect on OXA inhibition on RKO migration and invasion (Figure 1(i) and (j), Figure S1(f)–(i)). In conclusion, NTD inhibits the proliferation and migration of CRC cells in vitro.

Figure 1 NTD inhibited the cell proliferation and migration viability of CRC cells. (a)–(c) Dose–response examination of NTD in MC38 (a), RKO (b), and HT29 cells (c). (d) IC50 values of NTD for MC38, RKO, or HT29. (e) and (f) NTD (100 μM) suppressed the ability of colony formation of MC38 cells. (g) and (h) NTD (100 μM) suppressed the ability of colony formation of RKO cells. (i) and (j) NTD (100 μM) and OXA (6.25 μM) inhibited the migration ability of RKO cells. a, analysis of variance performed between multiple groups.
Figure 1

NTD inhibited the cell proliferation and migration viability of CRC cells. (a)–(c) Dose–response examination of NTD in MC38 (a), RKO (b), and HT29 cells (c). (d) IC50 values of NTD for MC38, RKO, or HT29. (e) and (f) NTD (100 μM) suppressed the ability of colony formation of MC38 cells. (g) and (h) NTD (100 μM) suppressed the ability of colony formation of RKO cells. (i) and (j) NTD (100 μM) and OXA (6.25 μM) inhibited the migration ability of RKO cells. a, analysis of variance performed between multiple groups.

3.2 The combination of NTD plus OXA synergistically enhanced CRC inhibition in vitro and in vivo

The CCK-8 assay was also employed to assess the toxicity of OXA in MC38, RKO, and HT29 cells, and OXA displayed concentration-dependent antiproliferative effects in CRC cells (Figure 2(a)–(c)). The IC50 values were also calculated and are displayed in Figure 2(d). Using the online SynergyFinder software, the drug ZIP synergy scores of MC38, RKO, and HT29 were calculated according to other concentration gradients and the corresponding inhibition index (Figure 2(e)–(g)). The results demonstrated that the average (and maximum) proportions of the antiproliferative effect attributable to drug interaction were 17.456 (26.20) in MC38 cells, 13.989 (23.32) in RKO cells, and 11.781(20.92) in HT29 cells. Indeed, the combined treatment of NTD and OXA displayed significant synergistic effects in antiproliferative activity (ZIP synergy scores >0). As depicted in Figure 2(e)–(g), the white rectangle indicates the region of the maximum synergistic area. The results indicated that the concentration of NTD encompassing the region of highest synergy was between 25 and 100 μM. The lowest effective and best-combined concentration of NTD was determined as 25 μM. The results also indicated that concentrations of OXA, 6.25–25 μM for MC38 cells and 3.13–12.5 μM for RKO cells, may be the best concentrations to display synergistic antiproliferative effects encompassing the region of highest synergy.

Figure 2 NTD synergistically enhances the cytotoxicity of OXA against CRC cells. MC38 (a), RKO (b), and HT29 cells (c). (d) IC50 values of OXA for MC38, RKO, or HT29. (e)–(g) Heatmaps of drug combination responses. NTD and OXA synergistically inhibited MC38 (e), RKO (f), or HT29 (g) cell growth in vitro. MC38, RKO, or HT29 cells were treated with NTD and OXA at the indicated concentrations for 48 h, and CCK-8 was employed to detect cell viability. SynergyFinder software was used to calculate the ZIP Synergy scores. Scores > 0: synergism, and scores > 10: strongly synergistic. The gradation of the red regions revealed synergism intensity. The white rectangle displayed the concentrations encompassing the region of highest synergy, and the X- and Y-axes corresponding to the sides of the white rectangle demonstrate the concentrations at which the drug combination exerts the maximum inhibitory impact on cell proliferation. (h) and (i) The combination of OXA (12.5 μM) plus NTD (100 μM) enhanced the colony formation of MC38 cells. (j) CCK-8 detection of cell viability of RKO cells after being treated with OXA (12.5 μM) plus NTD (100 μM) for 48 h. (k) CCK-8 detection of cell viability of HT29 cells after being treated with OXA (12.5 μM) plus NTD (100 μM) for 48 h. (l) The scheme of NTD and OXA treatment on MC38 subcutaneous tumor model (control group [n = 7], NTD group [n = 7], OXA group [n = 7], OXA + NTD group [n = 7]). (m) Photo of MC38 subcutaneous tumor. (n) Growth of curve of tumor volume. (o) Weight of tumor. (p) Weight of mice. (q) The survival rate of MC38-tumor-bearing mice received combination therapy of NTD and OXA. a, analysis of variance performed between multiple groups.
Figure 2

NTD synergistically enhances the cytotoxicity of OXA against CRC cells. MC38 (a), RKO (b), and HT29 cells (c). (d) IC50 values of OXA for MC38, RKO, or HT29. (e)–(g) Heatmaps of drug combination responses. NTD and OXA synergistically inhibited MC38 (e), RKO (f), or HT29 (g) cell growth in vitro. MC38, RKO, or HT29 cells were treated with NTD and OXA at the indicated concentrations for 48 h, and CCK-8 was employed to detect cell viability. SynergyFinder software was used to calculate the ZIP Synergy scores. Scores > 0: synergism, and scores > 10: strongly synergistic. The gradation of the red regions revealed synergism intensity. The white rectangle displayed the concentrations encompassing the region of highest synergy, and the X- and Y-axes corresponding to the sides of the white rectangle demonstrate the concentrations at which the drug combination exerts the maximum inhibitory impact on cell proliferation. (h) and (i) The combination of OXA (12.5 μM) plus NTD (100 μM) enhanced the colony formation of MC38 cells. (j) CCK-8 detection of cell viability of RKO cells after being treated with OXA (12.5 μM) plus NTD (100 μM) for 48 h. (k) CCK-8 detection of cell viability of HT29 cells after being treated with OXA (12.5 μM) plus NTD (100 μM) for 48 h. (l) The scheme of NTD and OXA treatment on MC38 subcutaneous tumor model (control group [n = 7], NTD group [n = 7], OXA group [n = 7], OXA + NTD group [n = 7]). (m) Photo of MC38 subcutaneous tumor. (n) Growth of curve of tumor volume. (o) Weight of tumor. (p) Weight of mice. (q) The survival rate of MC38-tumor-bearing mice received combination therapy of NTD and OXA. a, analysis of variance performed between multiple groups.

Next, we performed a colony formation assay to further confirm the best-combined concentration of NTD and OXA for inhibiting cell proliferation in vitro. The results demonstrated that 100 μM NTD and 12.5 μM OXA highly synergistically inhibited colony formation in the murine CRC cell line MC38 (Figure 2(h) and (i)). A similar outcome was observed using CCK-8 detection in the human CRC cell line RKO by adding NTD at 100 μM and OXA at 12.5 μM (Figure 2(j)) and HT29 by adding NTD at 100 μM and OXA at 12.5 μM (Figure 2(k)). Using a murine subcutaneous CRC model (Figure 2(l)), we found that the NTD and OXA groups significantly suppressed tumor growth in vivo compared to the control group. Compared to the OXA group, the NTD + OXA group revealed enhanced tumor growth inhibition (Figure 2(m)–(o)). Furthermore, NTD treatment alone significantly inhibited other tumors, such as melanoma (Figure S1(j)–(l)). NTD-enhanced immune checkpoint inhibitors programmed death-1 antibody therapeutic effect on CT26 tumors in vivo (Figure S1(m)–(o)). The weight of mice in each group revealed a non-significant change (Figure 2(p)). Notably, NTD treatment alone and in combination with OXA significantly prolonged survival time in tumor-bearing mice (Figure 2(q)).

Collectively, the combination of NTD plus OXA enhanced cell proliferation and migration inhibition in vitro and in vivo.

3.3 NTD inhibited CRC progression and enhanced OXA therapeutic effect in vitro by downregulating CACNA1D

It has recently been documented that another antihypertensive agent and a CCB, nifedipine, could suppress prostate cancer progression by modulating CACNA1D expression [17]. Therefore, it is difficult to avoid the hypothesis that CACNA1D participates in the mechanism by which NTD prevents CRC progression. Using HPA and GEPIA2 web tools, we found that CACNA1D expression was higher in colon tumor tissues than in normal tissues (Figure 3(a) and (b)). Moreover, CACNA1D expression was higher in rectal tumor tissues than in normal tissues (Figure 3(c) and (d)). The qPCR and WB results confirmed that compared to normal colonic epithelial cells FHC, CRC cell lines such as RKO, HT29, SW-620, and LOVO exhibited higher expression of CACNA1D (Figure 3(e) and (f)). Furthermore, the concentration gradient of NTD decreased CACNA1D expression in the murine CRC cell line MC38 and the human CRC cell line RKO (Figure 3(g) and (h)). After successfully knocking down CACNA1D in MC38 and RKO cells (Figure 3(i), Figure S2(a)), we performed a CCK-8 assay to assess cell viability upon the addition of NTD and OXA. The results suggested that the knockdown of CACNA1D and NTD significantly impaired the MC38 cell growth when compared to the control group. However, when compared with the shCACNA1D group, the cell viability of the NTD + shCACNA1D group was non-significantly different (Figure 3(j)). A similar outcome was observed in the human CRC cell line RKO (Figure 3(k)). When OXA was added, the results indicated that OXA significantly suppressed cell proliferation when compared to the control group. Nevertheless, compared with the shCACNA1D group, the OXA + shCACNA1D group revealed a non-significant inhibitory effect (Figure 3(l)). In other words, NTD did not suppress cell growth after CACNA1D knockdown. A similar outcome was observed in the human CRC cell line RKO (Figure 3(m)). Furthermore, the results of rescue experiments indicated that the application of CACNA1D overexpression could rescue the inhibitory effect of NTD exerting on the cells in vitro and in vivo (Figure S2(b)–(f)). Collectively, these results indicated that NTD may inhibit CRC progression and enhance OXA therapeutic effects in vitro by downregulating CACNA1D.

Figure 3 NTD inhibited CRC progression and enhanced OXA therapeutic effect in vitro by downregulating CACNA1D. (a) Data from the GEO were utilized to analyze CACNA1D expression in colon tumor tissues. (b) IHC detection data of CACNA1D expression in colon tumor tissues downloaded from the HPA database (www.proteinatlas.org), scale bar, 100 μm. (c) Data from the GEO were utilized to analyze the CACNA1D expression in rectum tumor tissues. (d) IHC detection data of CACNA1D expression in rectum tumor tissues downloaded from the HPA database (www.proteinatlas.org), scale bar, 100 μm. (e) qPCR detection of CACNA1D expression of FHC and CRC cell lines. (f) WB detection of CACNA1D expression of FHC and CRC cell lines. (g) qPCR detection of CACNA1D expression in MC38 after NTD treatment. (h) qPCR detection of CACNA1D expression in RKO after NTD treatment. (i) The efficiency of CACNA1D knockdown in MC38 and RKO was examined by qPCR assay. (j) Cell viability of MC38 after CACNA1D knockdown and with the addition of NTD (100 μM) for 48 h. (k) Cell viability of RKO after knocking down CACNA1D and being treated by NTD (100 μM) for 48 h. (l) Cell viability of MC38 after CACNA1D knockdown and upon with the addition of OXA (20 μM) for 48 h. (m) Cell viability of RKO after CACNA1D knockdown and treated by OXA (20 μM) for 48 h. a, analysis of variance performed between multiple groups.
Figure 3

NTD inhibited CRC progression and enhanced OXA therapeutic effect in vitro by downregulating CACNA1D. (a) Data from the GEO were utilized to analyze CACNA1D expression in colon tumor tissues. (b) IHC detection data of CACNA1D expression in colon tumor tissues downloaded from the HPA database (www.proteinatlas.org), scale bar, 100 μm. (c) Data from the GEO were utilized to analyze the CACNA1D expression in rectum tumor tissues. (d) IHC detection data of CACNA1D expression in rectum tumor tissues downloaded from the HPA database (www.proteinatlas.org), scale bar, 100 μm. (e) qPCR detection of CACNA1D expression of FHC and CRC cell lines. (f) WB detection of CACNA1D expression of FHC and CRC cell lines. (g) qPCR detection of CACNA1D expression in MC38 after NTD treatment. (h) qPCR detection of CACNA1D expression in RKO after NTD treatment. (i) The efficiency of CACNA1D knockdown in MC38 and RKO was examined by qPCR assay. (j) Cell viability of MC38 after CACNA1D knockdown and with the addition of NTD (100 μM) for 48 h. (k) Cell viability of RKO after knocking down CACNA1D and being treated by NTD (100 μM) for 48 h. (l) Cell viability of MC38 after CACNA1D knockdown and upon with the addition of OXA (20 μM) for 48 h. (m) Cell viability of RKO after CACNA1D knockdown and treated by OXA (20 μM) for 48 h. a, analysis of variance performed between multiple groups.

3.4 NTD potentiated OXA inhibition on CRC in vivo by downregulating CACNA1D

To further validate the role of CACNA1D in inhibiting CRC progression and enhancing the therapeutic effects of OXA, we used a syngeneic murine CRC model in this section (Figure 4a). The results demonstrated that in the model established using MC38/scramble cells, compared to the control group, NTD and OXA alone significantly suppressed the growth of MC38 tumors, and the combination treatment displayed the strongest inhibition (Figure 4(b)–(d)). However, when CACNA1D was successfully knocked down, the antitumor effect of NTD + OXA was impaired in vitro (Figure S2(g)). In the model established using MC38/shCACNA1D cells, the tumor growth rate and weight of NTD or OXA groups were comparable to those of the control group. Besides, the tumor size and weight in the NTD + OXA group did not differ from that of the OXA group or the NTD group (Figure 4(e)–(g)). Therefore, OXA administration revealed a non-significant increase in antitumor effect in the MC38/shCACNA1D model. The results of qPCR detection of tumor samples revealed that when compared with the control group, the mRNA expression of CACNA1D in the NTD group and OXA group decreased, and the combination group remained the lowest. When CACNA1D was successfully knocked down, the mRNA expression of CACNA1D was significantly decreased, and the mRNA expression of CACNA1D in the NTD group or the OXA group or the combination group was comparable to those of the control group (Figure S2(h)). In summary, NTD potentiated OXA inhibition and enhanced the OXA therapeutic effect in CRC in vivo by downregulating CACNA1D expression.

Figure 4 NTD potentiates OXA inhibition on CRC in vivo by downregulating CACNA1D. (a) The scheme of scramble and shCACNA1D MC38 subcutaneous tumors after receiving combination therapy of NTD and OXA. (b) Photo of MC38/scramble group subcutaneous tumor(control group [n = 7], NTD group [n = 7], OXA group [n = 7], OXA + NTD group [n = 7]). (c) Growth curve of MC38/scramble group tumor. (d) Weight of MC38/scramble group tumor. (e) Photo of MC38/shCACNA1D group subcutaneous tumor (shCACNA1D group (n = 7), NTD + shCACNA1D group (n = 7), OXA + shCACNA1D group (n = 7), and OXA + NTD + shCACNA1D group (n = 7)). (f) Growth curve of MC38/shCACNA1D group tumor. (g) Weight of MC38/shCACNA1D group tumor. a, analysis of variance performed between multiple groups.
Figure 4

NTD potentiates OXA inhibition on CRC in vivo by downregulating CACNA1D. (a) The scheme of scramble and shCACNA1D MC38 subcutaneous tumors after receiving combination therapy of NTD and OXA. (b) Photo of MC38/scramble group subcutaneous tumor(control group [n = 7], NTD group [n = 7], OXA group [n = 7], OXA + NTD group [n = 7]). (c) Growth curve of MC38/scramble group tumor. (d) Weight of MC38/scramble group tumor. (e) Photo of MC38/shCACNA1D group subcutaneous tumor (shCACNA1D group (n = 7), NTD + shCACNA1D group (n = 7), OXA + shCACNA1D group (n = 7), and OXA + NTD + shCACNA1D group (n = 7)). (f) Growth curve of MC38/shCACNA1D group tumor. (g) Weight of MC38/shCACNA1D group tumor. a, analysis of variance performed between multiple groups.

4 Discussion

This study demonstrates that the first-line antihypertensive NTD arrested the progression of CRC by suppressing cell proliferation and migration and revealed synergistic activity with the commonly used chemotherapy drug OXA by downregulating CACNA1D. This is the first study to explore the activity and mechanism of NTD in CRC in vivo and in vitro. In conclusion, these findings indicate that combination therapy of NTD plus OXA may be a promising clinical treatment for CRC.

Cancer is a leading cause of mortality worldwide. Together, hypertension is recognized as among the most common comorbidities in patients with cancer, such as CRC, owing to overlapping epidemiologic features, such as most old patients. Furthermore, several reports have indicated that hypertension is closely associated with the incidence and prognosis of common malignancies, including breast, kidney, colorectal, oral, laryngeal, and esophageal cancers [18,19,20,21]. Patients with cancer and hypertension typically have poorer clinical outcomes than normotensive ones. Therefore, it is important to identify the role of common first-line antihypertensive NTD in cancer treatment. The present study may assist in solving these problems: (1) it helps oncologists choose a reasonable antihypertensive NTD to control blood pressure when prescribing OXA-based chemotherapy regimens like (FOLFOX or CapeOx). (2) The present research may provide novel insights into the development of other commonly prescribed, non-antitumor agents for cancer therapy.

NTD is a very commonly used antihypertensive that belongs to a CCB demonstrated to prevent the movement of calcium through the “slow channel” of cardiac and vascular smooth muscle, resulting in peripheral vasodilation with a consequent reduction in elevated blood pressure [13,22]. Recently, many researchers have focused on the antitumor action and related mechanisms of CCBs. CCBs, including verapamil, nifedipine, and felodipine, have been demonstrated to exert antitumorigenic effects in breast, gastric, prostate, ovarian, and lung cancers [23,24,25,26]. However, previous reports on CCBs in cancer chemotherapy are limited, predominantly focusing on the synergistic effect of verapamil with chemotherapeutic agents such as paclitaxel, adriamycin, and doxorubicin against various cancers [27,28,29]. However, there is a paucity of studies on other commonly used antihypertensive NTD. Compared to verapamil, NTD is more commonly used and is generally suitable for patients with hypertension and coronary heart disease because it has a protective effect on the ischemic myocardium [30]. Nevertheless, laboratory research on NTD for cancer prevention and therapy is scarce. In this study, we found that NTD suppressed CRC progression by inhibiting cell proliferation and migration. Surprisingly, NTD revealed synergistic activity with the chemotherapeutic drug OXA in vitro and in vivo. Our research suggested that NTD may be a novel chemosensitizer as a new OXA combination to improve the efficacy and safety of CRC therapy. However, NTD has potential side effects such as hypotension, headache, and facial flushing [13]. The adverse events of OXA most often cited were hematologic toxicity, gastrointestinal tract toxicity, and neuropathy unlike that observed with other platinum derivatives [31]. Therefore, the potential side effects should be brought to clinicians’ attention when using NTD in combination with OXA for the treatment of CRC with high CACNA1D expression.

Aberrant Ca2+ signaling has been reported to participate in malignant biological properties such as proliferation, invasion, and migration [32]. In this pathway, ion channels, such as CaV channels, which comprise pore-forming α1 subunits and a series of accessory/regulatory β and α2δ subunits, play vital roles in disease progression or treatment resistance [33,34]. Among the CaVs, CaV1.3, encoded by CACNA1D, was recently reported to be upregulated in cancer tissues compared to related normal tissues [35]. Laboratory studies have reported that CaV1.3 overexpression significantly promotes breast, prostate, and gastric cancer progression [36,37,38]. For example, McKerr et al. reported that CACNA1D overexpression potentiated the malignancy of prostate cancer and that CCBs nifedipine can reverse this phenomenon [17]. However, the role of CACNA1D in CRC progression and therapy remains unclear. In this study, using bioinformatics tools, we found that CACNA1D was upregulated in CRC tissues than normal tissues, and the CACNA1D expression was negatively correlated with prognosis. Furthermore, the CCBs NTD introduction decreased the CACNA1D expression dose-dependently. After the successful knockdown of CACNA1D, compared to the shCACNA1D group, cell proliferation in the shCACNA1D + NTD and shCACNA1D + NTD + OXA groups displayed no significant changes in vitro and in vivo; These findings suggest that CACNA1D may play a key role in NTD inhibition and in combination with OXA.

In conclusion, this study presents novel data on first-line antihypertensive NTD exerting inhibitory effects on cell proliferation and migration of CRC and reveals synergistic activity with OXA by downregulating CACNA1D. This study offers a theoretical basis for combining OXA with NTD for CRC treatment. However, some limitations cannot be neglected, as more direct evidence is needed to verify that NTD suppresses CRC progression through CACNA1D. Detailed mechanistic studies will be conducted in the future.

  1. Funding information: This study was supported by the Taizhou Municipal Science and Technology Bureau (No. 22ywb86).

  2. Author contributions: CZL, JHL, and HKZ conceived the study and designed the experiments. CZL, JHL, HKZ, and JNZ contributed to the data extraction, performed the analysis, and interpreted the results. CZL, JHL, and HKZ wrote the manuscript. All authors have read the manuscript and approved the final version.

  3. Conflict of interest: The authors declare no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

  4. Data availability statement: The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

References

[1] Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin. 2022;72(1):7–33.10.3322/caac.21708Search in Google Scholar PubMed

[2] Zhang C, Stampfl-Mattersberger M, Ruckser R, Sebesta C. Colorectal cancer. Wien Med Wochenschr. 2023;173(9–10):216–20.10.1007/s10354-022-00975-6Search in Google Scholar PubMed

[3] Shinji S, Yamada T, Matsuda A, Sonoda H, Ohta R, Iwai T, et al. Recent advances in the treatment of colorectal cancer: A review. J Nippon Med Sch. 2022;89(3):246–54.10.1272/jnms.JNMS.2022_89-310Search in Google Scholar PubMed

[4] Katona BW, Weiss JM. Chemoprevention of colorectal cancer. Gastroenterology. 2020;158(2):368–88.10.1053/j.gastro.2019.06.047Search in Google Scholar PubMed PubMed Central

[5] Biller LH, Schrag D. Diagnosis and treatment of metastatic colorectal cancer: A review. JAMA. 2021;325(7):669–85.10.1001/jama.2021.0106Search in Google Scholar PubMed

[6] Dekker E, Tanis PJ, Vleugels J, Kasi PM, Wallace MB. Colorectal cancer. Lancet. 2019;394(10207):1467–80.10.1016/S0140-6736(19)32319-0Search in Google Scholar PubMed

[7] Mauri G, Gori V, Bonazzina E, Amatu A, Tosi F, Bencardino K, et al. Oxaliplatin retreatment in metastatic colorectal cancer: Systematic review and future research opportunities. Cancer treat rev. 2020;91:102112.10.1016/j.ctrv.2020.102112Search in Google Scholar PubMed

[8] Zhang X, Wu Q, Wei M, Deng X, Gu C, Wang Z. Oxaliplatin versus mitomycin C in HIPEC for peritoneal metastasis from colorectal cancer: a systematic review and meta-analysis of comparative studies. Int J Colorectal Dis. 2020;35(10):1831–9.10.1007/s00384-020-03702-ySearch in Google Scholar PubMed

[9] Cremolini C, Antoniotti C, Rossini D, Lonardi S, Loupakis F, Pietrantonio F, et al. Upfront FOLFOXIRI plus bevacizumab and reintroduction after progression versus mFOLFOX6 plus bevacizumab followed by FOLFIRI plus bevacizumab in the treatment of patients with metastatic colorectal cancer (TRIBE2): A multicentre, open-label, phase 3, randomised, controlled trial. Lancet Oncol. 2020;21(4):497–507.10.2139/ssrn.3478102Search in Google Scholar

[10] Zhang C, Xu C, Gao X, Yao Q. Platinum-based drugs for cancer therapy and anti-tumor strategies. Theranostics. 2022;12(5):2115–32.10.7150/thno.69424Search in Google Scholar PubMed PubMed Central

[11] Vodenkova S, Buchler T, Cervena K, Veskrnova V, Vodicka P, Vymetalkova V. 5-fluorouracil and other fluoropyrimidines in colorectal cancer: Past, present and future. Pharmacol Ther. 2020;206:107447.10.1016/j.pharmthera.2019.107447Search in Google Scholar PubMed

[12] Zraik IM, Heß-Busch Y. Management of chemotherapy side effects and their long-term sequelae. Urologe A. 2021;60(7):862–71.10.1007/s00120-021-01569-7Search in Google Scholar PubMed

[13] Goa KL, Sorkin EM. Nitrendipine. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic efficacy in the treatment of hypertension. Drugs. 1987;33(2):123–55.10.2165/00003495-198733020-00003Search in Google Scholar PubMed

[14] Principe DR, Aissa AF, Kumar S, Pham T, Underwood PW, Nair R, et al. Calcium channel blockers potentiate gemcitabine chemotherapy in pancreatic cancer. Proc Natl Acad Sci U S A. 2022;119(18):e2200143119.10.1073/pnas.2200143119Search in Google Scholar PubMed PubMed Central

[15] Wu L, Lin W, Liao Q, Wang H, Lin C, Tang L, et al. Calcium channel blocker nifedipine suppresses colorectal cancer progression and immune escape by preventing NFAT2 nuclear translocation. Cell Rep. 2020;33(4):108327.10.1016/j.celrep.2020.108327Search in Google Scholar PubMed

[16] Zhang Q, Zhou Y, Feng X, Gao Y, Huang C, Yao X. Low-dose orlistat promotes the therapeutic effect of oxaliplatin in colorectal cancer. Biomed Pharmacother. 2022;153:113426.10.1016/j.biopha.2022.113426Search in Google Scholar PubMed

[17] McKerr N, Mohd-Sarip A, Dorrian H, Breen C, A James J, McQuaid S, et al. CACNA1D overexpression and voltage-gated calcium channels in prostate cancer during androgen deprivation. Sci Rep. 2023;13(1):4683.10.1038/s41598-023-28693-ySearch in Google Scholar PubMed PubMed Central

[18] Han H, Guo W, Shi W, Yu Y, Zhang Y, Ye X, et al. Hypertension and breast cancer risk: A systematic review and meta-analysis. Sci Rep. 2017;7:44877.10.1038/srep44877Search in Google Scholar PubMed PubMed Central

[19] Campi R, Rebez G, Klatte T, Roussel E, Ouizad I, Ingels A, et al. Effect of smoking, hypertension and lifestyle factors on kidney cancer - perspectives for prevention and screening programmes. Nat Rev Urol. 2023;20(11):669–81.10.1038/s41585-023-00781-8Search in Google Scholar PubMed

[20] Xuan K, Zhao T, Sun C, Patel AS, Liu H, Chen X, et al. The association between hypertension and colorectal cancer: A meta-analysis of observational studies. Eur J Cancer Prev. 2021;30(1):84–96.10.1097/CEJ.0000000000000578Search in Google Scholar PubMed

[21] Seo JH, Kim YD, Park CS, Han KD, Joo YH. Hypertension is associated with oral, laryngeal, and esophageal cancer: A nationwide population-based study. Sci Rep. 2020;10(1):10291.10.1038/s41598-020-67329-3Search in Google Scholar PubMed PubMed Central

[22] Santiago TM, Lopez LM. Nitrendipine: A new dihydropyridine calcium-channel antagonist for the treatment of hypertension. DICP. 1990;24(2):167–75.10.1177/106002809002400211Search in Google Scholar PubMed

[23] Nandi SK, Chatterjee N, Roychowdhury T, Pradhan A, Moiz S, Manna K, et al. Kaempferol with Verapamil impeded panoramic chemoevasion pathways in breast cancer through ROS overproduction and disruption of lysosomal biogenesis. Phytomedicine. 2023;113:154689.10.1016/j.phymed.2023.154689Search in Google Scholar PubMed

[24] Shiozaki A, Katsurahara K, Kudou M, Shimizu H, Kosuga T, Ito H, et al. Amlodipine and verapamil, voltage-gated Ca(2+) channel inhibitors, suppressed the growth of gastric cancer stem cells. Ann Surg Oncol. 2021;28(9):5400–11.10.1245/s10434-021-09645-0Search in Google Scholar PubMed

[25] Rybalchenko V, Prevarskaya N, Van Coppenolle F, Legrand G, Lemonnier L, Le Bourhis X, et al. Verapamil inhibits proliferation of LNCaP human prostate cancer cells influencing K+ channel gating. Mol Pharmacol. 2001;59(6):1376–87.10.1124/mol.59.6.1376Search in Google Scholar PubMed

[26] Liang SY, Xiao HK. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC. Open Med (Wars). 2023;18(1):20230801.10.1515/med-2023-0801Search in Google Scholar PubMed PubMed Central

[27] Li P, Zhong D, Gong PY. Synergistic effect of paclitaxel and verapamil to overcome multi-drug resistance in breast cancer cells. Biochem Biophys Res Commun. 2019;516(1):183–8.10.1016/j.bbrc.2019.05.189Search in Google Scholar PubMed

[28] Zheng W, Li M, Lin Y, Zhan X. Encapsulation of verapamil and doxorubicin by MPEG-PLA to reverse drug resistance in ovarian cancer. Biomed Pharmacother. 2018;108:565–73.10.1016/j.biopha.2018.09.039Search in Google Scholar PubMed

[29] Rogan AM, Hamilton TC, Young RC, Klecker Jr RW, Ozols RF. Reversal of adriamycin resistance by verapamil in human ovarian cancer. Science. 1984;224(4652):994–6.10.1126/science.6372095Search in Google Scholar PubMed

[30] Zhu J, Chen N, Zhou M, Guo J, Zhu C, Zhou J, et al. Calcium channel blockers versus other classes of drugs for hypertension. Cochrane Database Syst Rev. 2022;1(1):Cd003654.10.1002/14651858.CD003654.pub6Search in Google Scholar PubMed PubMed Central

[31] Cassidy J, Misset JL. Oxaliplatin-related side effects: characteristics and management. Semin Oncol. 2002;29(5 Suppl 15):11–20.10.1053/sonc.2002.35524Search in Google Scholar PubMed

[32] Prevarskaya N, Ouadid-Ahidouch H, Skryma R, Shuba Y. Remodelling of Ca2+ transport in cancer: how it contributes to cancer hallmarks? Philos Trans R Soc Lond B Biol Sci. 2014;369(1638):20130097.10.1098/rstb.2013.0097Search in Google Scholar PubMed PubMed Central

[33] Biasiotta A, D'Arcangelo D, Passarelli F, Nicodemi EM, Facchiano A. Ion channels expression and function are strongly modified in solid tumors and vascular malformations. J Transl Med. 2016;14(1):285.10.1186/s12967-016-1038-ySearch in Google Scholar PubMed PubMed Central

[34] Lastraioli E, Iorio J, Arcangeli A. Ion channel expression as promising cancer biomarker. Biochim Biophys Acta. 2015;1848(10 Pt B):2685–702.10.1016/j.bbamem.2014.12.016Search in Google Scholar PubMed

[35] Wang CY, Lai MD, Phan NN, Sun Z, Lin YC. Meta-analysis of public microarray datasets reveals voltage-gated calcium gene signatures in clinical cancer patients. PLoS One. 2015;10(7):e0125766.10.1371/journal.pone.0125766Search in Google Scholar PubMed PubMed Central

[36] O'reilly D, Downing T, Kouba S, Potier-Cartereau M, McKenna DJ, Vandier C, et al. CaV1.3 enhanced store operated calcium promotes resistance to androgen deprivation in prostate cancer. Cell Calcium. 2022;103:102554.10.1016/j.ceca.2022.102554Search in Google Scholar PubMed

[37] Ji Y, Han Z, Shao L, Zhao Y. Ultrasound-targeted microbubble destruction of calcium channel subunit α 1D siRNA inhibits breast cancer via G protein-coupled receptor 30. Oncol Rep. 2016;36(4):1886–92.10.3892/or.2016.5031Search in Google Scholar PubMed PubMed Central

[38] Xu W, Zheng J, Wang X, Zhou B, Chen H, Li G, et al. tRF-Val-CAC-016 modulates the transduction of CACNA1d-mediated MAPK signaling pathways to suppress the proliferation of gastric carcinoma. Cell Commun Signal. 2022;20(1):68.10.1186/s12964-022-00857-9Search in Google Scholar PubMed PubMed Central

Received: 2024-05-20
Revised: 2024-10-10
Accepted: 2024-12-24
Published Online: 2025-02-12

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
  156. Review Articles
  157. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  158. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  159. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  160. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  161. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  162. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  163. The application of augmented reality in robotic general surgery: A mini-review
  164. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  165. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  166. Plant polyphenols, terpenes, and terpenoids in oral health
  167. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  168. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  169. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  170. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  171. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  172. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  173. Giant borderline ovarian tumours – review of the literature
  174. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  175. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  176. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  177. Supplement strategies for infertility in overweight women: Evidence and legal insights
  178. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  179. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  180. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  181. Strategies for hyperkalemia management in dialysis patients: A systematic review
  182. C-reactive protein-to-albumin ratio in peripheral artery disease
  183. Case Reports
  184. Delayed graft function after renal transplantation
  185. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  186. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  187. Giant right atrial hemangioma presenting with ascites: A case report
  188. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  189. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  190. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  191. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  192. Rapid Communication
  193. Biological properties of valve materials using RGD and EC
  194. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  195. Letter to the Editor
  196. Role of enhanced external counterpulsation in long COVID
  197. Expression of Concern
  198. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  199. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  200. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  201. Corrigendum
  202. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  203. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  204. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  205. Retraction
  206. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  207. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  208. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  209. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  210. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  211. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  212. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  213. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  214. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  215. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  216. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  217. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  218. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  219. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  220. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  221. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  222. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  223. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  224. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  225. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  226. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  227. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  228. A review of brain research on T2DM-related cognitive dysfunction
  229. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  230. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  231. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
https://doi.org/10.1515/med-2024-1138
Keywords for this article
antihypertensive; nitrendipine; oxaliplatin; colorectal cancer; CACNA1D
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
  156. Review Articles
  157. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  158. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  159. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  160. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  161. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  162. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  163. The application of augmented reality in robotic general surgery: A mini-review
  164. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  165. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  166. Plant polyphenols, terpenes, and terpenoids in oral health
  167. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  168. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  169. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  170. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  171. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  172. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  173. Giant borderline ovarian tumours – review of the literature
  174. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  175. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  176. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  177. Supplement strategies for infertility in overweight women: Evidence and legal insights
  178. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  179. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  180. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  181. Strategies for hyperkalemia management in dialysis patients: A systematic review
  182. C-reactive protein-to-albumin ratio in peripheral artery disease
  183. Case Reports
  184. Delayed graft function after renal transplantation
  185. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  186. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  187. Giant right atrial hemangioma presenting with ascites: A case report
  188. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  189. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  190. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  191. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  192. Rapid Communication
  193. Biological properties of valve materials using RGD and EC
  194. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  195. Letter to the Editor
  196. Role of enhanced external counterpulsation in long COVID
  197. Expression of Concern
  198. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  199. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  200. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  201. Corrigendum
  202. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  203. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  204. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  205. Retraction
  206. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  207. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  208. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  209. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  210. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  211. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  212. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  213. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  214. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  215. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  216. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  217. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  218. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  219. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  220. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  221. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  222. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  223. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  224. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  225. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  226. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  227. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  228. A review of brain research on T2DM-related cognitive dysfunction
  229. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  230. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  231. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 3.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2024-1138/html
Scroll to top button