Home Medicine Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
Article Open Access

Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling

  • Fei Yu , Guangxue Wang , Xingyi Chen , Yanfei Zhang , Cheng Yang , Hui Hu EMAIL logo and Liang Wei EMAIL logo
Published/Copyright: October 27, 2025
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 20 Issue 1

Abstract

We aimed to investigate the protective effect of luteolin against neuron injury induced by oxygen-glucose deprivation/reoxygenation (OGD/R), and to further elucidate the roles of NLRP3 in luteolin-mediated regulation of neuron injury. Using Schwann (SW) 10 cells, an OGD/R-induced neuron injury model was established, and six experimental groups were designated. Subsequently, cell viability and apoptosis were respectively detected by cell counting kit 8 and flow cytometry. Reactive oxygen species (ROS) levels were measured via flow cytometry with a ROS assay kit. Moreover, the expression of interleukin (IL)-6, IL-1β, NLRP3, and MMP9 was examined by real-time quantitative PCR and Western blot. Compared with control cells, OGD/R significantly reduced cell viability and increased apoptosis, ROS levels, and the mRNA levels of IL-6, IL-1β, NLRP3, and MMP9. Luteolin significantly enhanced OGD/R-induced cell viability and alleviated apoptosis in SW10 cells (P < 0.05). Additionally, luteolin suppressed ROS levels, along with the expression of IL-1β, IL-6, NLRP3, and MMP9 induced by OGD/R. Furthermore, BMS-986299 significantly decreased the cell viability and increased the expression of inflammatory factors in OGD/R-induced SW10 cells treated with luteolin. This inhibitory effect was reversed by NLRP3 knockdown. In conclusion, luteolin may exert a protective effect on OGD/R-induced nerve injury by inhibiting the NLRP3/IL-1β signaling pathway.

Keywords: ischemia/reperfusion; luteolin; NLRP3/IL-1β signaling

1 Introduction

Cerebral ischemia is associated with various severe conditions, such as stroke, cardiac arrest, and respiratory arrest [1]. Therapeutic strategies typically center on the rapid restoration of blood flow. However, the restoration of blood circulation can trigger oxidative stress and inflammation damage in regions affected by hypoxia and nutrient deprivation. Moreover, cerebral ischemia–reperfusion (I/R) can lead to impairments in mitochondrial oxidative metabolism and energy depletion within neurons, ultimately resulting in cell death [2,3]. Consequently, the restoration of blood flow following cerebral ischemia may cause additional harm, referred to as I/R injury [4,5]. Therefore, suitable drugs are necessary to safeguard neurons from the impact of I/R injury and mitigate the associated pathological responses [6]. Nevertheless, to date, only a limited number of drugs are available for the clinical treatment of cerebral ischemia [6].

Luteolin, a dietary flavone abundant in numerous plants has been demonstrated to penetrate the brain and exert significant neuroprotective effects [7]. In the context of cerebral I/R, neuroinflammation plays a pivotal role in immune defense through the activation of microglia, an increase in pro-inflammatory mediators, and the promotion of inflammatory cell proliferation [8]. Luteolin has been reported to reduce infarct size and neutrophil accumulation in the ischemic myocardium [9,10,11]. Additionally, it exhibits robust antioxidant and anti-neuroinflammatory effects by inhibiting reactive oxygen species (ROS) and inflammatory factors in cerebral I/R injury [12]. Recently, luteolin has been shown to exert its neuroprotective effects via modulation of various signaling pathways [13,14,15]. However, the precise neuroprotective mechanisms of luteolin against oxygen–glucose deprivation/reoxygenation (OGD/R)-induced neuronal damage remain to be elucidated.

The NOD-like receptor pyrin domain-containing protein 3 (NLRP3) inflammasome is a protein complex. Its activation results in the secretion of the pro-inflammatory cytokine interleukin (IL)-1β [16]. This pathway has been demonstrated to play a substantial role in neuroinflammation and neuronal damage [17]. Activation of the NLRP3 inflammasome can be induced by various cellular stressors, including mitochondrial dysfunction, and oxidative stress, both of which are hallmarks of OGD/R-induced neuronal injury [18,19,20]. Interestingly, recent research has indicated that luteolin may suppress the activation of the NLRP3 inflammasome. However, whether luteolin can exert its neuroprotective effects by modulating the NLRP3/IL-1β signaling pathway in the setting of OGD/R-induced neuronal injury remains uncertain.

Consequently, this study aimed to explore the protective effect of luteolin on OGD/R-induced neuronal injury and to further illuminate the underlying mechanisms, with a specific emphasis on the NLRP3/IL-1β signaling pathway. We hypothesized that luteolin could attenuate neuronal injury by inhibiting the activation of the NLRP3 inflammasome and reducing the production of IL-1β. The findings of this study may contribute to a deeper understanding of the neuroprotective mechanisms of luteolin and identify its potential as a protective agent against brain I/R injury.

2 Materials and methods

2.1 Cell culture

Schwann (SW) 10 cells were procured from FuHeng Biology (Shanghai, China). SW10 cells, a type of SW cell originating from mouse neural tissue, are also referred to as neuronal SW cells. These cells belong to the glial cell type in the peripheral nervous system, where their primary functions include providing support and protection to neurons, as well as participating in nerve regeneration subsequent to nerve injury. The cells were cultured in Dulbecco’s Modified Eagle’s Medium containing 10% fetal bovine serum (Gibco, USA) and 1% penicillin–streptomycin antibiotics (Gibco) in an incubator maintained at 37°C with 5% CO2.

2.2 Cell transfection

Small interference (si)-RNA-targeting NLRP3 (si-NLRP3) and si-negative control (si-NC) were obtained from Yanzai Biotechnology (Shanghai, China). The sequences of si-NLRP3-1/2/3 and si-NC are presented as follows: si-NLRP3-1, sense 5′-CCGGCCUUACUUCAAUCUGUUTT-3′, antisense 5′-AACAGAUUGAAGUAAGGCCGGTT-3′; si-NLRP3-2, sense 5′-CCAGGAGAGAACCUCUUAUUUTT-3′, anti-sense 5′-AAAUAAGAGGUUCUCUCCUGGTT-3′; si-NLRP3-3, sense 5′-CCCGGACUGUAAACUACAGAUTT-3′, antisense 5′-AUCUGUAGUUUACAGUCCGGGTT-3′; and si-NC, sense 5′-UUCUCCGAAGGUGUCACGUTT-3′, antisense 5′-ACGUGACACGUUCGGAGAATT-3′. Briefly, SW10 cells at a density of 2 × 104 cells/well were seeded into 24-well plates. Subsequently, 15 pmol of either si-NLRP3 or si-NC was transfected into the cells using Lipofectamine 2000 (Thermo, USA). After 6 h, the medium was replaced with a complete medium. Following an additional 12 h incubation, the transfection efficiency was evaluated by determining the expression of NLRP3 using real-time quantitative PCR (RT-qPCR) and Western blot analysis.

2.3 OGD/R induction

SW10 cells were plated and cultured for 24 h, and the original medium was removed on the second day. After being cleaned twice with sugar-free Earle’s solution (EBSS solution; Servicebio, Wuhan, China), EBSS solution was added for maintenance. The cell culture dish was exposed to CoCl2 (0, 50, 100, 200, 400, 600 μM; Aladdin, Shanghai, China) to induce chemical hypoxia and placed in a constant temperature incubator (oxygen glucose deprivation, simulating ischemia and hypoxia in vitro). After 2 h, the EBSS solution was removed, and cells were maintained in the original culture medium for normal growth (oxygen glucose recovery, simulating reperfusion in vitro). The OGD/R-induced SW10 cells were constructed for follow-up experiments.

2.4 Grouping

To determine the optimal concentrations of CoCl2, luteolin, and NLRP3/IL-1β pathway agonist (BMS-986299), different concentrations of CoCl2 (0, 50, 100, 200, 400, and 600 μM), luteolin (0, 1, 2, 5, 10, 20, 50, and 100 μM, Yuanye Bio-Technology Co., Ltd., Shanghai, China), and BMS-986299 (0, 0.2, 0.5, 1, 2, and 5 μM, MedChemExpress, USA) were, respectively, used to treat SW10 cells for 48 h, and then cell viability was detected. Further to explore the effects of luteolin on the growth of SW10 cells induced by OGD/R, the cells were grouped as follows: control, OGD/R, and OGD/R + luteolin groups.

To explore the roles of NLRP3 in luteolin-mediated regulation of cell growth following OGD/R, and the associated mechanisms, the cells were divided into five groups: OGD/R, OGD/R + si-NLRP3, OGD/R + luteolin, OGD/R + luteolin + BMS-986299, and OGD/R + luteolin + BMS-986299 + si-NLRP3 groups.

2.5 Cell counting kit-8 (CCK-8) assay

Cells subjected to different treatments were harvested, and 10 μL of CCK-8 solution (Beyotime, Shanghai, China) was added. After 2 h of incubation (with the optical density [OD] maintained at ≤2.0), the absorbance at 450 nm was measured using a Multiskan MK3 (Thermo, USA), and the cell viability curves were drawn.

2.6 Apoptosis assays

Cells from each group were digested with trypsin. After adding medium, the cells were gently pipetted to dislodge them and then transferred into the centrifuge tube. After centrifugation at 1,000 rpm for 5 min, the supernatant was discarded. Next, 195 μL of Annexin V-FITC binding solution was added, followed by 5 μL of Annexin V-FITC and propidium iodide staining. Then, the cells were incubated at 5°C for 20 min in the dark. Fluorescence-activated apoptotic cells were analyzed using a flow cytometer (FACSCalibur, BD Biosciences, USA).

3 Determination of ROS contents

The levels of ROS in the different groups were measured using a flow cytometry in conjunction with a ROS assay kit (chemical fluorescence method, Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. Briefly, the cells were centrifuged at 1,000 rpm for 5 min and were resuspended in PBS containing 10 μM DCFH-DA probes. The cells were then cultured at 37°C for 60 min. The DCFH-DA-labeled cells were centrifuged again at 1,000 rpm for 5 min, and the supernatant was removed. After washing twice with PBS, the cell pellets were collected and resuspended in PBS for flow cytometry analysis.

3.1 RT-qPCR

Total RNA was extracted from SW10 cells with different treatments using RNAiso Plus (Takara, Dalian, China). Following reverse transcription, the mRNA expressions of IL-1β, IL-6, NLRP3, and matrix metallopeptidase 9 (MMP9) were detected using 2× Universal SYBR Green Fast qPCR Mix (ABclonal, USA), with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal reference. The relative expression levels were calculated using the 2−∆∆CT method. All primer sequences are presented in Table 1.

Table 1

The primers used in this study

Gene Primer sequence (5′→3′)
IL-6-mF TAGTCCTTCCTACCCCAATTTCC
IL-6-mR TTGGTCCTTAGCCACTCCTTC
IL-1β-mF TGCCACCTTTTGACAGTGATG
IL-1β-mF TGATGTGCTGCTGCGAGATT
NLRP3-mF ATTACCCGCCCGAGAAAGG
NLRP3-mR TCGCAGCAAAGATCCACACAG
MMP9-mF CTGGACAGCCAGACACTAAAG
MMP9-mF CTCGCGGCAAGTCTTCAGAG
GAPDH-mF GGTGAAGGTCGGTGTGAACG
GAPDH-mR CTCGCTCCTGGAAGATGGTG

3.2 Western blot

For protein extraction, 200 μL of RIPA lysis buffer (Beyotime) was added to SW10 cells. The protein content was determined using the bicinchoninic acid (BCA) method (Servicebio, USA). Subsequently, the proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto polyvinylidene difluoride membranes. After blocking with 5% non-fat milk powder, the membranes were incubated overnight at 4°C with primary antibodies, including MMP9 (1:1,000; 10375-2-AP; Proteintech, USA); NLRP3 (1:2,000; 68102-1-Ig; Proteintech); IL-6 (1:1,000; 26404-1-AP; Proteintech); IL-1β (1:800; A16288; ABclonal); GAPDH (1:50,000; 60004-1-Ig; Proteintech). The next day, the membranes were incubated with the appropriate secondary antibodies (goat anti-rabbit IgG [H + L]-HRP or goat anti-mouse IgG [H + L]-HRP; 1: 10,000, 111-035-003 or 115-035-003; Jackson ImmunoResearch, USA) for 2 h at 25°C. Finally, the membranes were developed using an enhanced chemiluminescence detection kit (Beyotime).

3.3 Statistical analysis

Each experiment was repeated three times, and data were expressed mean ± standard deviation. Statistical analyses were analyzed by GraphPad Prism 5 (GraphPad Software, USA), and the comparison between groups was analyzed by one-way analysis of variance, with P < 0.05 as the threshold.

4 Results

4.1 Selection of optimal concentrations of CoCl2, luteolin, and BMS-986299

The rational behind choosing the optimal concentrations of CoCl2, luteolin, and BMS-986299 is to select a drug concentration that, while not significantly affecting cell viability, can maximize its biological effects. For the selection of the optimal concentration of CoCl2, the concentrations of 50, 100, and 200 μM had no apparent impact on cell viability (P > 0.05), whereas concentrations of 400 and 600 μM significantly suppressed cell viability (P < 0.05, Figure 1a). Consequently, 200 μM of CoCl2 was selected for subsequent experiments.

Figure 1 Selection of optimal concentrations of CoCl2, luteolin, and BMS-986299. (a) Selection of optimal concentrations of CoCl2 by CCK-8. N = 4. (b) Selection of optimal concentrations of luteolin by CCK-8. N = 4. (c) Selection of optimal concentrations of BMS-986299 by CCK-8. N = 4. NLRP3 expression determined to evaluate the cell transfection efficiency using RT-qPCR (d) and Western blot (e). N = 3. *P < 0.05 compared with 0 μM group or blank group. # P < 0.05 compared with si-NLRP3-1; $ P < 0.05 compared with si-NLRP3-2.
Figure 1

Selection of optimal concentrations of CoCl2, luteolin, and BMS-986299. (a) Selection of optimal concentrations of CoCl2 by CCK-8. N = 4. (b) Selection of optimal concentrations of luteolin by CCK-8. N = 4. (c) Selection of optimal concentrations of BMS-986299 by CCK-8. N = 4. NLRP3 expression determined to evaluate the cell transfection efficiency using RT-qPCR (d) and Western blot (e). N = 3. *P < 0.05 compared with 0 μM group or blank group. # P < 0.05 compared with si-NLRP3-1; $ P < 0.05 compared with si-NLRP3-2.

Likewise, luteolin at concentrations of 1, 2, 5, 10, and 20 μM did not significantly influence the viability of SW10 cells (P > 0.05), but concentrations of 50 and 100 μM significantly inhibited cell viability (P < 0.05, Figure 1b). Therefore, 20 μM of luteolin was selected for further experiments.

When SW10 cells were treated with 0, 0.2, 0.5, and 1 μM of BMS-986299, the cell viability was not significantly affected (P > 0.05). However, 2 and 5 μM of BMS-986299 significantly inhibited the cell viability (P < 0.05, Figure 1c). Ultimately, 1 μM of BMS-986299 was chosen for subsequent experiments.

4.2 Evaluation of cell transfection efficiency

Following the transfection of cells with si-NLRP3, the cell transfection efficiency was assessed using RT-qPCR and Western blot. As depicted in Figure 1d and e, no significant difference was observed in the NLRP3 expression between the blank and si-NC groups (P > 0.05); as well as the relative expression of NLRP3 decreased significantly after transfection with si-NLRP3 (P < 0.05) compared to the blank group. Specifically, si-NLRP3-2 exhibited the highest transfection efficiency. Consequently, si-NLRP3-2 was chosen for the subsequent experiments.

4.3 Effects of luteolin on the growth of SW10 cells induced by OGD/R and its related mechanisms

To investigate the effects of luteolin on the growth of SW10 cells induced by OGD/R, the viability and apoptosis of SW10 cells were measured. It was found that, in comparison to the control group, OGD/R significantly suppressed cell viability (P < 0.01), while after the SW10 cells were treated with luteolin, the cell viability was elevated significantly compared to the OGD/R group (P < 0.05, Figure 2a). Additionally, when compared to the control cells, the apoptosis rate of SW10 cells increased significantly following OGD/R induction (P < 0.01). In contrast, treatment with luteolin significantly decreased the apoptosis rate of SW10 cells relative to the OGD/R group (P < 0.05, Figure 2b).

Figure 2 Effects of luteolin on the growth of SW10 cells and on the ROS contents. (a) Cell viability of SW10 cells after OGD/R or treated with luteolin detected by CCK-8. N = 4. (b) Apoptosis rate of SW10 cells after OGD/R or treated with luteolin detected by flow cytometry. N = 3. (c) The ROS levels in the SW10 cells after OGD/R or treated with luteolin detected by flow cytometry. N = 3. *P < 0.05 compared with control. # P < 0.05 compared with OGD/R group.
Figure 2

Effects of luteolin on the growth of SW10 cells and on the ROS contents. (a) Cell viability of SW10 cells after OGD/R or treated with luteolin detected by CCK-8. N = 4. (b) Apoptosis rate of SW10 cells after OGD/R or treated with luteolin detected by flow cytometry. N = 3. (c) The ROS levels in the SW10 cells after OGD/R or treated with luteolin detected by flow cytometry. N = 3. *P < 0.05 compared with control. # P < 0.05 compared with OGD/R group.

Further, we explored the potential mechanisms by which luteolin regulates OGD/R-induced SW10 cells. Compared with the control group, the ROS level in the OGD/R-induced cells was significantly elevated (P < 0.05); whereas luteolin evidently reduced the ROS levels caused by OGD/R (P < 0.05, Figure 2c). In addition, OGD/R treatment significantly increased the mRNA expression of IL-6, IL-1β, NLRP3, and MMP9 in SW10 cells (P < 0.05, Figure 3a). Conversely, luteolin evidently reduced the mRNA levels of IL-6, IL-1β, NLRP3, and MMP9 compared to the OGD/R group (P < 0.05). Western blot analysis further confirmed the results of RT-qPCR (Figure 3b).

Figure 3 Effects of luteolin on the expression of inflammatory factors in SW10 cells. The expression of IL-6, IL-1β, NLRP3, and MMP9 after OGD/R or treated with luteolin detected by RT-qPCR (a) and Western blot (b). N = 3. *P < 0.05 compared with control. # P < 0.05 compared with OGD/R group.
Figure 3

Effects of luteolin on the expression of inflammatory factors in SW10 cells. The expression of IL-6, IL-1β, NLRP3, and MMP9 after OGD/R or treated with luteolin detected by RT-qPCR (a) and Western blot (b). N = 3. *P < 0.05 compared with control. # P < 0.05 compared with OGD/R group.

4.4 The roles of NLRP3 in luteolin-mediated regulation of cell growth induced by OGD/R and its related mechanisms

To study the role of NLRP3 in luteolin-mediated regulation of cell growth induced by OGD/R, NLRP3 was knocked down. When compared to the OGD/R group, the viability of SW10 cells was significantly increased after either knocking down NLRP3 or adding luteolin (P < 0.05). BMS-986299 significantly reduced the viability of OGD/R SW10 cells treated with luteolin, and the inhibitory effect was reversed by NLRP3 knockdown (P < 0.05, Figure 4a). Additionally, after knocking down NLRP3 or adding luteolin, the apoptosis proportion of SW10 cells in OGD/R declined significantly compared with the OGD/R group (P < 0.05). However, the addition of BMS-986299 to OGD/R SW10 cells treated with luteolin significantly increased the apoptosis rate of cells compared with OGD/R + luteolin group, and this increase was reversed by NLRP3 knockdown (P < 0.05, Figure 4b).

Figure 4 The roles of NLRP3 in luteolin regulating cell growth induced by OGD/R. (a) Cell viability of SW10 cells after OGD/R, NLRP3 knocking down or treated with BMS-986299 detected by CCK-8. N = 4. (b) Apoptosis rate of SW10 cells after OGD/R, NLRP3 knocking down or treated with BMS-986299 detected by flow cytometry. N = 3. *P < 0.05 compared with OGD/R group. # P < 0.05 compared with OGD/R + si-NLRP3 group. $ P < 0.05 compared with OGD/R + luteolin group. & P < 0.05 compared with OGD/R + luteolin + BMS986299 group.
Figure 4

The roles of NLRP3 in luteolin regulating cell growth induced by OGD/R. (a) Cell viability of SW10 cells after OGD/R, NLRP3 knocking down or treated with BMS-986299 detected by CCK-8. N = 4. (b) Apoptosis rate of SW10 cells after OGD/R, NLRP3 knocking down or treated with BMS-986299 detected by flow cytometry. N = 3. *P < 0.05 compared with OGD/R group. # P < 0.05 compared with OGD/R + si-NLRP3 group. $ P < 0.05 compared with OGD/R + luteolin group. & P < 0.05 compared with OGD/R + luteolin + BMS986299 group.

We also detected the expression of IL-6, IL-1β, NLRP3, and MMP9 in SW10 cells of OGD/R after knocking down NLRP3 or adding luteolin. The mRNA levels of these genes in OGD/R + si-NLRP3/luteolin groups were significantly lower than those in the OGD/R group (P < 0.05). However, when BMS-986299 was added into the OGD/R + luteolin group, the mRNA levels of these genes were elevated significantly, which could be reversed by NLRP3 knockdown (P < 0.05, Figure 5a). The protein expression trends of IL-6, IL-1β, NLRP3, and MMP9 in different groups were consistent with the mRNA expression trends (Figure 5b).

Figure 5 The roles of NLRP3 in luteolin regulating the expression of inflammatory factors induced by OGD/R. The expression of IL-6, IL-1β, NLRP3, and MMP9 after OGD/R, NLRP3 knocking down or treated with BMS-986299 detected by RT-qPCR (a) and Western blot (b). N = 3. *P < 0.05 compared with OGD/R group. # P < 0.05 compared with OGD/R + si-NLRP3 group. $ P < 0.05 compared with OGD/R + luteolin group. & P < 0.05 compared with OGD/R + luteolin + BMS986299 group.
Figure 5

The roles of NLRP3 in luteolin regulating the expression of inflammatory factors induced by OGD/R. The expression of IL-6, IL-1β, NLRP3, and MMP9 after OGD/R, NLRP3 knocking down or treated with BMS-986299 detected by RT-qPCR (a) and Western blot (b). N = 3. *P < 0.05 compared with OGD/R group. # P < 0.05 compared with OGD/R + si-NLRP3 group. $ P < 0.05 compared with OGD/R + luteolin group. & P < 0.05 compared with OGD/R + luteolin + BMS986299 group.

5 Discussion

Cerebral ischemia, characterized by OGD, initiates a cascade of cellular events culminating in neuronal injury and death. Currently, no approved treatment exists to mitigate neurological dysfunction [21]. Moreover, the availability of effective drugs for treating cerebral ischemia remains limited. Our study is the first to investigate the neuroprotective role of luteolin in cerebral ischemia. The findings indicated that OGD/R significantly decreased cell viability, increased apoptosis, and elevated the mRNA levels of IL-6, IL-1β, NLRP3, and MMP9 in SW10 cells. Luteolin exerted neuroprotective effects by enhancing the cell viability-reducing apoptosis and inhibiting the expression of a series of inflammatory factors in injured SW10 cells following OGD/R. These protective effects were mediated through the regulation of the NLRP3/IL-1β signaling pathway and could be reversed by BMS-986299.

OGD/R is a widely used experimental model to mimic cerebral I/R injury, capable of inducing apoptosis and reducing the cell viability of neuronal cells [1,22]. Neuronal apoptosis frequently occurs in neurodegenerative diseases, leading to long-term alterations in brain function [22]. Our results demonstrated that luteolin could enhance OGD/R-induced cell viability and reduce apoptosis in SW10 cells, suggesting its neuroprotective properties of luteolin. A previous study has shown that the Naotaifang formula could relieve OGD/R-induced inflammation and ferroptosis through BMP6/SMADs signaling to regulate microglial M1/M2 polarization [23]. Edaravone is a well-known free radical scavenger with demonstrated neuroprotective effects in conditions like ischemic stroke. Yin et al. [24] demonstrated that edaravone could inhibit autophagy in neurons caused by OGD/R Another study manifested that edaravone-dexborneol, composed of edaravone and (+)-borneol, could significantly attenuate cerebral I/R injury both in vitro and in vivo via targeting OAT3/P-gp transporters for drug delivery into the brain [25]. Our in vivo experiments have clarified that luteolin could alleviate cerebral infarction, apoptosis, and pyroptosis in cerebral I/R injury. Therefore, the current in vitro experiments further confirmed that luteolin could improve OGD/R-induced injury by regulating cell viability and apoptosis.

Cerebral ischemia exacerbates brain injury by precipitating a robust inflammatory response [21]. An increasing body of evidence indicates that proinflammatory cytokines, such as IL-1β and IL-6, are the primary initiators of cerebral ischemic injury. Inflammation, moreover, plays a key role in the pathological progression of cerebral ischemic injury [26]. MMP9 has also been reported to regulate inflammation in various tissues and diseases [27,28]. MMP9 can activate inflammatory cells and facilitate the release of inflammatory factors, thereby further intensifying the inflammatory damage to brain tissue [29]. ROS is a crucial contributor of neuronal injury during OGD/R. The level of ROS was elevated by OGD/R but reduced by luteolin. Excessive production of ROS disrupts the redox equilibrium in cells, leading to lipid peroxidation, protein oxidation, and DNA damage, which will lead to cell dysfunction and death [30]. In addition, ROS can not only directly aggregate mitochondrial membrane and mitochondrial DNA but also increase blood-brain barrier permeability, activate NF-κB, and promote inflammation [30,31]. Our study indeed demonstrated that OGD/R induction triggered inflammation, increased the ROS levels, and up-regulated the expression of IL-6, IL-1β, NLRP3, and MMP9 in SW10 cells. However, luteolin suppressed their expression compared with the OGD/R group, suggesting that luteolin could reduce the release of inflammatory cytokines from injured SW10 cells caused by OGD/R.

It has been reported that the neuroprotective effects of luteolin are closely associated with ROS inhibition, mitochondrial function stabilization, and downstream transcription factors (e.g., NF-κB) [32,33,34]. A previous research showed that luteolin could protect cardiomyocytes from I/R-induced ferroptosis by inhibiting the accumulation of ROS and MDA [33]. Mitochondrial dysfunction is a hallmark of OGD/R injury, and luteolin could induce cell apoptosis through endoplasmic reticulum stress and mitochondrial dysfunction in neuroblastoma cells [35]. As a central regulator of inflammation, NF-κB activation exacerbates neuronal injury during OGD/R. The ability of luteolin to inhibit NF-κB signaling and reduce the expression of pro-inflammatory cytokines could further attenuate neuroinflammation and damage [36]. Mitochondrial dysfunction results in the accumulation of ROS and oxidized mtDNA within microglia, which leads to the activation and elongation of NLRP3 [37]. Additionally, NLRP3 is the best-studied inflammasome [38], playing a key role in the inflammatory response of I/R injury [39]. Interestingly, delayed NLRP3 expression has been detected in neurons during I/R injury [40]. NLRP3 has been reported to be the major contributor among the inflammasomes after transient middle cerebral artery occlusion (MCAO) in mice [41]. Therefore, NLRP3 inflammasome can act as a treatment target for cerebral I/R injury [42]. Moreover, NLRP3 inflammasome activation can up-regulate the IL‐1β expression and further promote the cascade of inflammation in the central nervous system, leading to the aggravation of nerve injury in patients with ischemic stroke [43,44,45]. Therefore, identifying interventions that can modulate the NLRP3/IL-1β signaling pathway holds great significance for neuroprotection and disease treatment. In this study, BMS-986299, an NLRP3 agonist, was found to significantly reduce the cell viability and increase the inflammatory factors expression of OGD/R SW10 cells treated with luteolin. This inhibitory effect was reversed by NLRP3 knockdown, indicating that the activity mediated by luteolin depends on the regulation of the NLRP3/IL-1β signaling pathway.

However, there are some limitations in this study. While the NLRP3/IL-1β signaling pathway is important, it could be beneficial to explore the additional pathways (such as NF-κB and mitochondrial function stabilization) that may contribute to luteolin’s effects. Second, further experiments, such as a CRISPR/Cas9-mediated knockout of NLRP3 in SW10 cells, as well as in vivo systems (interactions within the neural microenvironment or an in vivo MCAO model), should be conducted to investigate the specificity of luteolin’s actions on NLRP3. Additionally, the comparison analyses between luteolin and other neuroprotective agents (e.g., edaravone) need to be unearthed in the future.

In summary, we have demonstrated that luteolin alleviates the expression of inflammatory factors and protects neurons injured by OGD/R, which was mediated by suppressing the NLRP3/IL-1β signaling pathway. This study provides additional theoretical and data support for the potential clinical application of luteolin in mitigating neuron injury in cerebral ischemia.

# These authors are co-first authors.

tel: +86-021-38804518-14188

Acknowledgments

Not applicable.

  1. Funding information: This study was supported by the application of luteolin in cerebral ischemia-reperfusion injury (No. PKJ2022-Y55).

  2. Author contributions: FY and GXW carried out the conception and design of the research and drafted the manuscript. XYC participated in the acquisition of data. YFZ carried out the analysis and interpretation of data. CY participated in the design of the study and performed the statistical analysis. HH and LW conceived of the study, participated in its design and coordination, and helped to draft the manuscript and revision of manuscript for important intellectual content. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Data availability statement: The data used to support the findings of this study are available from the corresponding author upon request.

References

[1] Ye M, Wu H, Li S. Resveratrol alleviates oxygen/glucose deprivation/reoxygenation‑induced neuronal damage through induction of mitophagy. Mol Med Rep. 2021;23(1):25.10.3892/mmr.2020.11711Search in Google Scholar PubMed PubMed Central

[2] Cabral-Costa JV, Kowaltowski AJ. Neurological disorders and mitochondria. Mol Asp Med. 2020;71(100826):17.10.1016/j.mam.2019.10.003Search in Google Scholar PubMed

[3] Andrabi SS, Tabassum H, Parveen S, Parvez S. Ropinirole induces neuroprotection following reperfusion-promoted mitochondrial dysfunction after focal cerebral ischemia in Wistar rats. Neurotoxicology. 2020;77:94–104.10.1016/j.neuro.2019.12.004Search in Google Scholar PubMed

[4] Puyal J, Ginet V, Clarke PG. Multiple interacting cell death mechanisms in the mediation of excitotoxicity and ischemic brain damage: A challenge for neuroprotection. Prog Neurobiol. 2013;105:24–48.10.1016/j.pneurobio.2013.03.002Search in Google Scholar PubMed

[5] Chen H, Yoshioka H, Kim GS, Jung JE, Okami N, Sakata H, et al. Oxidative stress in ischemic brain damage: mechanisms of cell death and potential molecular targets for neuroprotection. Antioxid Redox Signal. 2011;14(8):1505–17.10.1089/ars.2010.3576Search in Google Scholar PubMed PubMed Central

[6] Yang J, Wu S, Hou L, Zhu D, Yin S, Yang G, et al. Therapeutic effects of simultaneous delivery of nerve growth factor mRNA and protein via exosomes on cerebral ischemia. Mol Ther Nucleic Acids. 2020;21:512–22.10.1016/j.omtn.2020.06.013Search in Google Scholar PubMed PubMed Central

[7] López-Lázaro M. Distribution and biological activities of the flavonoid luteolin. Mini Rev Med Chem. 2009;9(1):31–59.10.2174/138955709787001712Search in Google Scholar PubMed

[8] Jin R, Yang G, Li G. Inflammatory mechanisms in ischemic stroke: Role of inflammatory cells. J Leukoc Biol. 2010;87(5):779–89.10.1189/jlb.1109766Search in Google Scholar PubMed PubMed Central

[9] Li Q, Tian Z, Wang M, Kou J, Wang C, Rong X, et al. Luteoloside attenuates neuroinflammation in focal cerebral ischemia in rats via regulation of the PPARγ/Nrf2/NF-κB signaling pathway. Int Immunopharmacol. 2019;66:309–16.10.1016/j.intimp.2018.11.044Search in Google Scholar PubMed

[10] Zhang YC, Gan FF, Shelar SB, Ng KY, Chew EH. Antioxidant and Nrf2 inducing activities of luteolin, a flavonoid constituent in Ixeris sonchifolia Hance, provide neuroprotective effects against ischemia-induced cellular injury. Food Chem Toxicol. 2013;59:272–80.10.1016/j.fct.2013.05.058Search in Google Scholar PubMed

[11] Yang Y, Tan X, Xu J, Wang T, Liang T, Xu X, et al. Luteolin alleviates neuroinflammation via downregulating the TLR4/TRAF6/NF-κB pathway after intracerebral hemorrhage. Biomed Pharmacother. 2020;126(110044):27.Search in Google Scholar

[12] Li L, Pan G, Fan R, Li D, Guo L, Ma L, et al. Luteolin alleviates inflammation and autophagy of hippocampus induced by cerebral ischemia/reperfusion by activating PPAR gamma in rats. BMC Complement Med Ther. 2022;22(1):022–03652.10.1186/s12906-022-03652-8Search in Google Scholar PubMed PubMed Central

[13] Shi H, Liu G. Tobacco flavor. Beijing: China Agriculture Press; 2022.Search in Google Scholar

[14] Fan X, Lin F, Chen Y, Dou Y, Li T, Jin X, et al. Luteolin-7-O-β-d-glucuronide ameliorates cerebral ischemic injury: Involvement of RIP3/MLKL signaling pathway. Molecules. 2024;29(7)1665.10.3390/molecules29071665Search in Google Scholar PubMed PubMed Central

[15] Liu S, Su Y, Sun B, Hao R, Pan S, Gao X, et al. Luteolin protects against CIRI, potentially via regulation of the SIRT3/AMPK/mTOR signaling pathway. Neurochem Res. 2020;45(10):2499–515.10.1007/s11064-020-03108-wSearch in Google Scholar PubMed

[16] Mitroulis I, Skendros P, Ritis K. Targeting IL-1beta in disease; the expanding role of NLRP3 inflammasome. Eur J Intern Med. 2010;21(3):157–63.10.1016/j.ejim.2010.03.005Search in Google Scholar PubMed

[17] Zhao Z, Wang Y, Zhou R, Li Y, Gao Y, Tu D, et al. A novel role of NLRP3-generated IL-1β in the acute-chronic transition of peripheral lipopolysaccharide-elicited neuroinflammation: implications for sepsis-associated neurodegeneration. J Neuroinflammation. 2020;17(1):020–1728.10.1186/s12974-020-1728-5Search in Google Scholar PubMed PubMed Central

[18] Li W, Cao T, Luo C, Cai J, Zhou X, Xiao X, et al. Crosstalk between ER stress, NLRP3 inflammasome, and inflammation. Appl Microbiol Biotechnol. 2020;104(14):6129–40.10.1007/s00253-020-10614-ySearch in Google Scholar PubMed

[19] Zhao J, Piao X, Wu Y, Liang S, Han F, Liang Q, et al. Cepharanthine attenuates cerebral ischemia/reperfusion injury by reducing NLRP3 inflammasome-induced inflammation and oxidative stress via inhibiting 12/15-LOX signaling. Biomed Pharmacother. 2020;127(110151):19.10.1016/j.biopha.2020.110151Search in Google Scholar PubMed

[20] Zhang X, Zeng W, Zhang Y, Yu Q, Zeng M, Gan J, et al. Focus on the role of mitochondria in NLRP3 inflammasome activation: A prospective target for the treatment of ischemic stroke (Review). Int J Mol Med. 2022;49(6):8.10.3892/ijmm.2022.5130Search in Google Scholar PubMed PubMed Central

[21] Moskowitz MA, Lo EH, Iadecola C. The science of stroke: Mechanisms in search of treatments. Neuron. 2010;67(2):181–98.10.1016/j.neuron.2010.07.002Search in Google Scholar PubMed PubMed Central

[22] Park SY, Cho MH, Li M, Li K, Park G, Choi YW. Petatewalide B alleviates oxygen‑glucose deprivation/reoxygenation‑induced neuronal injury via activation of the AMPK/Nrf2 signaling pathway. Mol Med Rep. 2020;22(1):239–46.10.3892/mmr.2020.11075Search in Google Scholar PubMed PubMed Central

[23] Liao J, Wei M, Wang J, Zeng J, Liu D, Du Q, et al. Naotaifang formula attenuates OGD/R-induced inflammation and ferroptosis by regulating microglial M1/M2 polarization through BMP6/SMADs signaling pathway. Biomed Pharmacother = Biomedecine & Pharmacotherapie. 2023;167:115465.10.1016/j.biopha.2023.115465Search in Google Scholar PubMed

[24] Yin J, Zhou Z, Chen J, Wang Q, Tang P, Ding Q, et al. Edaravone inhibits autophagy after neuronal oxygen-glucose deprivation/recovery injury. Int J Neurosci. 2019;129(5):501–10.10.1080/00207454.2018.1550399Search in Google Scholar PubMed

[25] Wang X, Liu JJ, Zheng XR, Zhou ZJ, Duan JQ, Liu HY, et al. (+)-Borneol enhances the protective effect of edaravone against cerebral ischemia/reperfusion injury by targeting OAT3/P-gp transporters for drug delivery into the brain. Phytomed: Int J Phytother Phytopharmacol. 2025;139:156521.10.1016/j.phymed.2025.156521Search in Google Scholar PubMed

[26] Lin HW, Basu A, Druckman C, Cicchese M, Krady JK, Levison SW. Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury. J Neuroinflamm. 2006;3(15):1742–2094.10.1186/1742-2094-3-15Search in Google Scholar PubMed PubMed Central

[27] Corry DB, Kiss A, Song LZ, Song L, Xu J, Lee SH, et al. Overlapping and independent contributions of MMP2 and MMP9 to lung allergic inflammatory cell egression through decreased CC chemokines. Faseb J. 2004;18(9):995–7.10.1096/fj.03-1412fjeSearch in Google Scholar PubMed PubMed Central

[28] Zhang H, Liu L, Jiang C, Pan K, Deng J, Wan C. MMP9 protects against LPS-induced inflammation in osteoblasts. Innate Immun. 2020;26(4):259–69.10.1177/1753425919887236Search in Google Scholar PubMed PubMed Central

[29] Chaturvedi M, Kaczmarek L. Mmp-9 inhibition: A therapeutic strategy in ischemic stroke. Mol Neurobiol. 2014;49(1):563–73.10.1007/s12035-013-8538-zSearch in Google Scholar PubMed PubMed Central

[30] Yang B, Chen Y, Shi J. Reactive oxygen species (ROS)-based nanomedicine. Chem Rev. 2019;119(8):4881–985.10.1021/acs.chemrev.8b00626Search in Google Scholar PubMed

[31] Kauffman ME, Kauffman MK, Traore K, Zhu H, Trush MA, Jia Z, et al. MitoSOX-based flow cytometry for detecting mitochondrial ROS. Reactive Oxyg Species (Apex, NC). 2016;2(5):361–70.10.20455/ros.2016.865Search in Google Scholar PubMed PubMed Central

[32] Kou JJ, Shi JZ, He YY, Hao JJ, Zhang HY, Luo DM, et al. Luteolin alleviates cognitive impairment in Alzheimer’s disease mouse model via inhibiting endoplasmic reticulum stress-dependent neuroinflammation. Acta Pharmacol Sin. 2022;43(4):840–9.10.1038/s41401-021-00702-8Search in Google Scholar PubMed PubMed Central

[33] Wang IC, Lin JH, Lee WS, Liu CH, Lin TY, Yang KT. Baicalein and luteolin inhibit ischemia/reperfusion-induced ferroptosis in rat cardiomyocytes. Int J Cardiol. 2023;375:74–86.10.1016/j.ijcard.2022.12.018Search in Google Scholar PubMed

[34] Chen Y, Guo Y, Song Z, Chang H, Kuang Q, Zheng Z, et al. Luteolin restricts ASFV replication by regulating the NF-κB/STAT3/ATF6 signaling pathway. Vet Microbiol. 2022;273:109527.10.1016/j.vetmic.2022.109527Search in Google Scholar PubMed

[35] Choi AY, Choi JH, Yoon H, Hwang KY, Noh MH, Choe W, et al. Luteolin induces apoptosis through endoplasmic reticulum stress and mitochondrial dysfunction in Neuro-2a mouse neuroblastoma cells. Eur J Pharmacol. 2011;668(1–2):115–26.10.1016/j.ejphar.2011.06.047Search in Google Scholar PubMed

[36] Yang Y, Tan X, Xu J, Wang T, Liang T, Xu X, et al. Luteolin alleviates neuroinflammation via downregulating the TLR4/TRAF6/NF-κB pathway after intracerebral hemorrhage. Biomed Pharmacother = Biomedecine & Pharmacotherapie. 2020;126:110044.10.1016/j.biopha.2020.110044Search in Google Scholar PubMed

[37] Peng J, Wang H, Gong Z, Li X, He L, Shen Q, et al. Idebenone attenuates cerebral inflammatory injury in ischemia and reperfusion via dampening NLRP3 inflammasome activity. Mol Immunol. 2020;123:74–87.10.1016/j.molimm.2020.04.013Search in Google Scholar PubMed

[38] Palomino-Antolin A, Narros-Fernández P, Farré-Alins V, Sevilla-Montero J, Decouty-Pérez C, Lopez-Rodriguez AB, et al. Time-dependent dual effect of NLRP3 inflammasome in brain ischaemia. Br J Pharmacol. 2022;179(7):1395–410.10.1111/bph.15732Search in Google Scholar PubMed

[39] Ren H, Kong Y, Liu Z, Zang D, Yang X, Wood K, et al. Selective NLRP3 (pyrin domain-containing protein 3) inflammasome inhibitor reduces brain injury after intracerebral hemorrhage. Stroke. 2018;49(1):184–92.10.1161/STROKEAHA.117.018904Search in Google Scholar PubMed PubMed Central

[40] Dénes A, Ferenczi S, Kovács KJ. Systemic inflammatory challenges compromise survival after experimental stroke via augmenting brain inflammation, blood- brain barrier damage and brain oedema independently of infarct size. J Neuroinflammation. 2011;8(164):1742–2094.10.1186/1742-2094-8-164Search in Google Scholar PubMed PubMed Central

[41] Franke M, Bieber M, Kraft P, Weber ANR, Stoll G, Schuhmann MK. The NLRP3 inflammasome drives inflammation in ischemia/reperfusion injury after transient middle cerebral artery occlusion in mice. Brain Behav Immun. 2021;92:223–33.10.1016/j.bbi.2020.12.009Search in Google Scholar PubMed

[42] Wang L, Ren W, Wu Q, Liu T, Wei Y, Ding J, et al. NLRP3 inflammasome activation: A therapeutic target for cerebral ischemia-reperfusion injury. Front Mol Neurosci. 2022;15:847440.10.3389/fnmol.2022.847440Search in Google Scholar PubMed PubMed Central

[43] Aimanianda V, Haensler J, Lacroix-Desmazes S, Kaveri SV, Bayry J. Novel cellular and molecular mechanisms of induction of immune responses by aluminum adjuvants. Trends Pharmacol Sci. 2009;30(6):287–95.10.1016/j.tips.2009.03.005Search in Google Scholar PubMed

[44] Fann DY, Lee SY, Manzanero S, Chunduri P, Sobey CG, Arumugam TV. Pathogenesis of acute stroke and the role of inflammasomes. Ageing Res Rev. 2013;12(4):941–66.10.1016/j.arr.2013.09.004Search in Google Scholar PubMed

[45] Yang F, Wang Z, Wei X, Han H, Meng X, Zhang Y, et al. NLRP3 deficiency ameliorates neurovascular damage in experimental ischemic stroke. J Cereb Blood Flow Metab. 2014;34(4):660–7.10.1038/jcbfm.2013.242Search in Google Scholar PubMed PubMed Central

Received: 2024-11-23
Revised: 2025-03-24
Accepted: 2025-04-14
Published Online: 2025-10-27

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
  156. Influence of sevoflurane combined with propofol anesthesia on the anesthesia effect and adverse reactions in children with acute appendicitis
  157. Identification of hub genes related to acute kidney injury caused by sevoflurane anesthesia and endoplasmic reticulum stress
  158. Efficacy and safety of PD-1/PD-L1 inhibitors in pancreatic ductal adenocarcinoma: a systematic review and Meta-analysis of randomized controlled trials
  159. The value of diagnostic experience in O-RADS MRI score for ovarian-adnexal lesions
  160. Health education pathway for individuals with temporary enterostomies using patient journey mapping
  161. Serum TLR8 as a potential diagnostic biomarker of coronary heart disease
  162. Intraoperative temperature management and its effect on surgical outcomes in elderly patients undergoing lichtenstein unilateral inguinal hernia repair
  163. Immunohistochemical profiling and neuroepithelial heterogeneity in immature ovarian teratomas: a retrospective digital pathology-based study
  164. Associated risk factors and prevalence of human papillomavirus infection among females visiting tertiary care hospital: a cross-sectional study from Nepal
  165. Comparative evaluation of various disc elution methods for the detection of colistin-resistant gram-negative bacteria
  166. Effect of timing of cholecystectomy on weight loss after sleeve gastrectomy in morbidly obese individuals with cholelithiasis: a retrospective cohort study
  167. Causal association between ceramide levels and central precocious puberty: a mendelian randomization study
  168. Novel predictive model for colorectal liver metastases recurrence: a radiomics and clinical data approach
  169. Relationship between resident physicians’ perceived professional value and exposure to violence
  170. Multiple sclerosis and type 1 diabetes: a Mendelian randomization study of European ancestry
  171. Rapid pathogen identification in peritoneal dialysis effluent by MALDI-TOF MS following blood culture enrichment
  172. Comparison of open and percutaneous A1 pulley release in pediatric trigger thumb: a retrospective cohort study
  173. Impact of combined diaphragm-lung ultrasound assessment on postoperative respiratory function in patients under general anesthesia recovery
  174. Development and internal validation of a nomogram for predicting short-term prognosis in ICU patients with acute pyelonephritis
  175. The association between hypoxic burden and blood pressure in patients with obstructive sleep apnea
  176. Promotion of asthenozoospermia by C9orf72 through suppression of spermatogonia activity via fructose metabolism and mitophagy
  177. Review Articles
  178. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  179. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  180. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  181. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  182. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  183. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  184. The application of augmented reality in robotic general surgery: A mini-review
  185. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  186. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  187. Plant polyphenols, terpenes, and terpenoids in oral health
  188. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  189. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  190. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  191. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  192. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  193. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  194. Giant borderline ovarian tumours – review of the literature
  195. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  196. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  197. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  198. Supplement strategies for infertility in overweight women: Evidence and legal insights
  199. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  200. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  201. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  202. Strategies for hyperkalemia management in dialysis patients: A systematic review
  203. C-reactive protein-to-albumin ratio in peripheral artery disease
  204. Research progress on autophagy and its roles in sepsis induced organ injury
  205. Neuronutrition in autism spectrum disorders
  206. Pumilio 2 in neural development, function, and specific neurological disorders
  207. Antibiotic prescribing patterns in general dental practice- a scoping review
  208. Clinical and medico-legal reflections on non-invasive prenatal testing
  209. Smartphone use and back pain: a narrative review of postural pathologies
  210. Targeting endothelial oxidative stress in hypertension
  211. Exploring links between acne and metabolic syndrome: a narrative review
  212. Case Reports
  213. Delayed graft function after renal transplantation
  214. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  215. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  216. Giant right atrial hemangioma presenting with ascites: A case report
  217. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  218. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  219. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  220. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  221. Combined VAT and retroperitoneoscopy for pleural empyema due to nephro-pleuric fistula in xanthogranulomatous pyelonephritis
  222. A rare case of Opalski syndrome with a suspected multiple sclerosis etiology
  223. Newly diagnosed B-cell acute lymphoblastic leukemia demonstrating localized bone marrow infiltration exclusively in the lower extremities
  224. Rapid Communication
  225. Biological properties of valve materials using RGD and EC
  226. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  227. Repeat influenza incidence across two consecutive influenza seasons
  228. Letter to the Editor
  229. Role of enhanced external counterpulsation in long COVID
  230. Expression of Concern
  231. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  232. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  233. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  234. Corrigendum
  235. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  236. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  237. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  238. Retraction
  239. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  240. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  241. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  242. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  243. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  244. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  245. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  246. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  247. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  248. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  249. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  250. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  251. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  252. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  253. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  254. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  255. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  256. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  257. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  258. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  259. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  260. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  261. A review of brain research on T2DM-related cognitive dysfunction
  262. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  263. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  264. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
https://doi.org/10.1515/med-2025-1198
Keywords for this article
ischemia/reperfusion; luteolin; NLRP3/IL-1β signaling
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
  156. Influence of sevoflurane combined with propofol anesthesia on the anesthesia effect and adverse reactions in children with acute appendicitis
  157. Identification of hub genes related to acute kidney injury caused by sevoflurane anesthesia and endoplasmic reticulum stress
  158. Efficacy and safety of PD-1/PD-L1 inhibitors in pancreatic ductal adenocarcinoma: a systematic review and Meta-analysis of randomized controlled trials
  159. The value of diagnostic experience in O-RADS MRI score for ovarian-adnexal lesions
  160. Health education pathway for individuals with temporary enterostomies using patient journey mapping
  161. Serum TLR8 as a potential diagnostic biomarker of coronary heart disease
  162. Intraoperative temperature management and its effect on surgical outcomes in elderly patients undergoing lichtenstein unilateral inguinal hernia repair
  163. Immunohistochemical profiling and neuroepithelial heterogeneity in immature ovarian teratomas: a retrospective digital pathology-based study
  164. Associated risk factors and prevalence of human papillomavirus infection among females visiting tertiary care hospital: a cross-sectional study from Nepal
  165. Comparative evaluation of various disc elution methods for the detection of colistin-resistant gram-negative bacteria
  166. Effect of timing of cholecystectomy on weight loss after sleeve gastrectomy in morbidly obese individuals with cholelithiasis: a retrospective cohort study
  167. Causal association between ceramide levels and central precocious puberty: a mendelian randomization study
  168. Novel predictive model for colorectal liver metastases recurrence: a radiomics and clinical data approach
  169. Relationship between resident physicians’ perceived professional value and exposure to violence
  170. Multiple sclerosis and type 1 diabetes: a Mendelian randomization study of European ancestry
  171. Rapid pathogen identification in peritoneal dialysis effluent by MALDI-TOF MS following blood culture enrichment
  172. Comparison of open and percutaneous A1 pulley release in pediatric trigger thumb: a retrospective cohort study
  173. Impact of combined diaphragm-lung ultrasound assessment on postoperative respiratory function in patients under general anesthesia recovery
  174. Development and internal validation of a nomogram for predicting short-term prognosis in ICU patients with acute pyelonephritis
  175. The association between hypoxic burden and blood pressure in patients with obstructive sleep apnea
  176. Promotion of asthenozoospermia by C9orf72 through suppression of spermatogonia activity via fructose metabolism and mitophagy
  177. Review Articles
  178. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  179. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  180. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  181. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  182. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  183. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  184. The application of augmented reality in robotic general surgery: A mini-review
  185. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  186. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  187. Plant polyphenols, terpenes, and terpenoids in oral health
  188. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  189. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  190. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  191. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  192. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  193. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  194. Giant borderline ovarian tumours – review of the literature
  195. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  196. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  197. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  198. Supplement strategies for infertility in overweight women: Evidence and legal insights
  199. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  200. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  201. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  202. Strategies for hyperkalemia management in dialysis patients: A systematic review
  203. C-reactive protein-to-albumin ratio in peripheral artery disease
  204. Research progress on autophagy and its roles in sepsis induced organ injury
  205. Neuronutrition in autism spectrum disorders
  206. Pumilio 2 in neural development, function, and specific neurological disorders
  207. Antibiotic prescribing patterns in general dental practice- a scoping review
  208. Clinical and medico-legal reflections on non-invasive prenatal testing
  209. Smartphone use and back pain: a narrative review of postural pathologies
  210. Targeting endothelial oxidative stress in hypertension
  211. Exploring links between acne and metabolic syndrome: a narrative review
  212. Case Reports
  213. Delayed graft function after renal transplantation
  214. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  215. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  216. Giant right atrial hemangioma presenting with ascites: A case report
  217. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  218. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  219. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  220. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  221. Combined VAT and retroperitoneoscopy for pleural empyema due to nephro-pleuric fistula in xanthogranulomatous pyelonephritis
  222. A rare case of Opalski syndrome with a suspected multiple sclerosis etiology
  223. Newly diagnosed B-cell acute lymphoblastic leukemia demonstrating localized bone marrow infiltration exclusively in the lower extremities
  224. Rapid Communication
  225. Biological properties of valve materials using RGD and EC
  226. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  227. Repeat influenza incidence across two consecutive influenza seasons
  228. Letter to the Editor
  229. Role of enhanced external counterpulsation in long COVID
  230. Expression of Concern
  231. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  232. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  233. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  234. Corrigendum
  235. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  236. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  237. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  238. Retraction
  239. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  240. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  241. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  242. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  243. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  244. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  245. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  246. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  247. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  248. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  249. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  250. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  251. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  252. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  253. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  254. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  255. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  256. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  257. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  258. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  259. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  260. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  261. A review of brain research on T2DM-related cognitive dysfunction
  262. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  263. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  264. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 4.2.2026 from https://www.degruyterbrill.com/document/doi/10.1515/med-2025-1198/html
Scroll to top button