Home FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
Article Open Access

FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway

  • Bitao Wang , Yubiao Yang , Zhi Zeng , Boyuan Ma , Yuxuan Zhou , Zhenhan Li , Jinyu Chen , Cheng Tang , Jian Hao EMAIL logo and Xianhu Zhou EMAIL logo
Published/Copyright: September 24, 2025
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 20 Issue 1

Abstract

Background

Ferroptosis, a type of iron-dependent lipid peroxidation-induced neuronal death, has been strongly implicated in the initiation and progression of various neurological disorders, including neurodegenerative diseases and central nervous system (CNS) injuries. Although significant research efforts have been devoted to this area, most available therapeutic strategies remain largely ineffective due to the complex pathophysiology of these conditions. Moreover, the mechanisms underlying neuronal ferroptosis are not yet fully elucidated.

Methods

To investigate the role of FAHD1 in neuronal ferroptosis, bioinformatic analyses and cellular experiments were performed. Immunofluorescence and dot blot analyses were employed to explore the effects of FAHD1 overexpression on R-loop formation. Additionally, western blotting was used to assess alterations in the expression of cGAS–STING pathway-related proteins resulting from FAHD1 overexpression.

Results

Our results demonstrate that FAHD1 expression is significantly downregulated in primary neurons subjected to oxidative stress. Furthermore, ferroptosis appears to be a major contributor to neuronal damage triggered by oxidative stress. Overexpression of FAHD1 significantly reduced reactive oxygen species accumulation and R-loop formation, preserved genomic stability, and suppressed neuronal ferroptosis by inhibiting activation of the cGAS–STING pathway.

Conclusion

FAHD1 is a critical regulator of neuronal ferroptosis and may serve as a potential therapeutic target for the treatment of neurodegenerative diseases and CNS injuries.

Keywords: FAHD1; neuronal ferroptosis; oxidative stress; R-loop; cGAS–STING pathway

1 Introduction

Neuron death is a fundamental pathological process in various neurodegenerative diseases and central nervous system (CNS) injuries. The mechanisms contributing to neuronal death include apoptosis, necrosis, autophagy, pyroptosis, ferroptosis, and excitotoxicity [1]. Among these, ferroptosis is one of the significant and has been closely associated with numerous neurodegenerative diseases [2], such as Alzheimer’s disease, Parkinson’s disease, and Huntington’s disease, as well as CNS injuries [3], including spinal cord injury and traumatic brain injury.

Ferroptosis, an iron-dependent form of programmed cell death, is characterized by intracellular iron accumulation and lipid peroxidation [4]. Oxidative stress in the nervous system is closely linked to dysregulation of iron metabolism and lipid peroxidation, making it a critical trigger for ferroptosis [5]. Under conditions of oxidative stress, the body’s antioxidant system may become impaired or imbalanced, reducing its ability to neutralize reactive oxygen species (ROS). This deficiency leads to excessive ROS accumulation, triggering harmful processes such as lipid peroxidation and disruptions in iron metabolism, which ultimately result in cellular ferroptosis. Studies have shown that ROS inhibitors, such as N-acetylcysteine [6], and iron chelators, such as ferrostatin-1 [7], effectively reverse neuronal ferroptosis. Inhibiting ferroptosis preserves a substantial number of functional neurons and oligodendrocytes, significantly mitigating functional loss [8]. The complexity of the etiology and pathology of neurological disorders, coupled with the presence of the blood–brain barrier, render conventional pharmacological therapies ineffective in many cases. At present, in excess of 95% of patients are without an efficacious treatment option [9]. Thus, reducing neuronal ferroptosis is crucial for maintaining nervous system function. However, the full mechanisms underlying ferroptosis remain incompletely elucidated.

Accumulation of R-loops has been implicated in several neurological disorders, including ataxia, neuromuscular diseases, and spinal muscular atrophy, among others [10]. R-loops are triple-stranded structures consisting of RNA–DNA hybrids and unpaired single-stranded DNA, typically formed during transcription. These structures play a crucial role in gene regulation and maintaining genomic stability [11]. Oxidative stress can lead to the excessive production of ROS, resulting in abnormal R-loop accumulation and genomic instability [12], which subsequently activates the cGAS–STING-mediated inflammatory response [13]. Research indicates that reducing R-loop formation by alleviating oxidative stress is essential in ensuring neuronal health and homeostasis [14]. Nevertheless, our understanding of R-loop functions in the nervous system remains limited.

FAHD1, a member of the FAH protein family, catalyzes the conversion of fumarate to malate, a key reaction in the tricarboxylic acid (TCA) cycle [15]. Previous studies have demonstrated that FAHD1 is crucial for mitochondrial function. FAHD1 deficiency disrupts TCA cycle flux, impairs cell proliferation, inhibits mitochondrial energy metabolism, and ultimately leads to premature cellular senescence [16]. Additionally, FAHD1 plays an essential role in regulating cellular ROS levels, as overexpression of FAHD1 has been shown to shift cellular metabolism toward glycolysis and reduce ROS accumulation [17]. Furthermore, FAHD1 has been identified as a regulator of serotonin levels, underscoring the intricate relationship between neuronal metabolism and neurotransmitter signaling [18]. Transcriptome sequencing has revealed a significant reduction in FAHD1 expression in mouse hippocampal cell line (HT22) during oxidative stress. However, the precise role of FAHD1 in oxidative stress-induced neuronal ferroptosis remains to be defined.

This study aims to investigate the role of FAHD1 in neuronal ferroptosis and to elucidate its underlying mechanisms. Our results suggest that FAHD1 is a crucial regulator of neuronal ferroptosis. Overexpression of FAHD1 reduces oxidative stress-induced ROS production, thereby attenuating R-loop formation, enhancing genomic stability, and preventing neuronal ferroptosis by inhibiting the cGAS–STING signaling pathway. In conclusion, this study demonstrates that FAHD1 plays a central role in the pathogenesis of neuronal ferroptosis and suggests that FAHD1 may represent a potential therapeutic target for neurological diseases.

2 Materials and methods

2.1 Chemicals and cell

Enhanced Cell Counting Kit-8 (CCK8; Cat. No. C0042), LDH Assay Kit with WST-8 (Cat. No. C0018S), ROS (Cat. No. S0033S), and RNase III (Cat. No. R7086S) were obtained from Shanghai Beyotime Biotechnology (Shanghai, China). 5,6-Dimethylxanthenone-4-acetic acid (DMXAA) (Cat. No. HY-10964, MedChemExpress, USA), Ferrostatin-1 (Fer-1; Cat. No. SML0583, Sigma-Aldrich, USA), RU.521 (MedChemExpress, USA), GenElute™ (Cat. No. G1N70, Sigma-Aldrich, USA), malondialdehyde (MDA; Cat. No, A003-2), and glutathione (GSH; Cat. No. A006-2-1) were acquired from Jiancheng Bioengineering Institute (Nanjing, China). Hydrogen peroxide (H2O2; Cat. No. H433857) was obtained from Shanghai Aladdin Biochemical Technology Co., Ltd (Shanghai, China). Fetal bovine serum (Cat. No. 10270106) and Dulbecco's modified eagle medium (DMEM) (Cat. No. C11995500BT) were sourced from Gibco. FastPure® Cell Total RNA Isolation Kit V2, PrimeScriptTM RT reagent kit, and SYBR® Premix Ex TaTM were purchased from Vazyme (Nanjing, China). Plasmids were purchased from Ruibo Biotechnology Co (Guangzhou, China). Lipofectamine 3000 from Invitrogen, USA. The vector was generated by Obio Technology (Shanghai, China). HEK 293T cell line was purchased from OriCell Biotechnology Ltd (Guangzhou, China).

2.2 Animals

Pregnant C57 mice were purchased from Zhuhai Beston Biotechnology Co. All animal care and experimental protocols were reviewed and approved by the Experimental Animal Welfare Ethics Review Committee of the Second Affiliated Hospital of Guangzhou Medical University (Approval number: A2023-049).

2.3 Primary neuron isolation and culture

Pregnant C57 mice were euthanized, immersed in ice-cold ethanol for 30 s, and dissected to extract the fetal brains, which were rinsed in cold phosphate-buffered saline (PBS). A microscope was used to remove the skull, blood, and meninges from the fetal brains. The cortex was isolated and transferred to a papain solution, incubated at 37°C for 20–30 min to facilitate cell dissociation. The tissue was triturated using a cell strainer or pipette, resulting in a single-cell suspension. The suspension was centrifuged to remove the enzyme solution, then resuspended in neuron-specific growth medium and seeded into precoated dishes. The cultures were maintained in a 37°C, 5% CO2 incubator with periodic medium changes. All experiments were performed in the surgical laboratory of the Second Affiliated Hospital of Guangzhou Medical University.

2.4 Establishment of an in vitro oxidative stress model

Oxidative stress was induced by incubating primary neurons with 100 μM H2O2 in neuronal culture medium for 12 h, following established protocols [19]. After incubation, neurons were collected for analyses, including quantitative reverse transcription PCR (qRT-PCR), western blotting, immunofluorescence (IF), and dot blot assays.

2.5 Lentivirus infection and cell transfection

A lentivirus infection was conducted to knock down RNase H1 (shRNH1) or over-express FAHD1 (OE) in neurons. The plasmid was cloned into a lentivirus vector and transfected into HEK-293T cells. The virus was used to infect neurons. Around 1 × 10⁵ neurons were seeded into each well of a six-well plate for transfection. Lipofectamine 3000 was used to transfect plasmids into cells. Western blotting was used to determine transfection efficiency. An empty pSLenti-EF1-P2A-Puro-CMV-MCS-3xFLAG-WPRE vector was used as a control. The following shRNA sequences were used to target RNH1: AGGCAAAGAAATCTATTAGT [20].

2.6 CCK8 assay

Neurons viability was measured using the CCK8 assay. Neurons were seeded in 96-well plates at a density of 5 × 103 cells/well. After treatment, CCK8 solution was added to per well and incubated for 2 h. Then the absorbance value was measured at 450 nm, and the relative viability of cells was calculated with the blank control group.

2.7 Assessment for GSH level, MDA level, and LDH release

According to the manufacturer’s guidelines, GSH and MDA kits were used to detect the levels of GSH and MDA. In addition, LDH release in the cell supernatant was measured using a LDH release assay kit.

2.8 Detection of intracellular ROS

ROS assay kit was employed to detect the total level of intracellular ROS. After different treatments, neurons were washed with PBS three times, and then incubated with serum-free DMEM medium containing dichlorodihydrofluorescein diacetate (DCFH-DA) at 37°C in the dark for 2 h, and then discarded the medium. After washing with PBS three times, the outcomes were acquired using the Olympus inverted fluorescence microscope.

2.9 qRT-PCR

Total RNA was extracted from the neurons using the FastPure® Cell Total RNA Isolation Kit V2, in accordance with the manufacturer's instructions. RNA concentrations were assessed using a NanoDrop spectrophotometer. Subsequently, RNA was used to synthesize cDNA through reverse transcription with the PrimeScriptTM RT reagent Kit. Gene expression analysis was performed on a QuantGene 9600 Real-Time PCR System using SYBR® Premix Ex TaTM. Quantification for target gene expression was performed using the 2−ΔΔCt method and β-actin was used as normalization control. All primers are given in Table S1.

2.10 Western blot

For western blot analysis, cells were harvested and lysed with RIPA buffer for 30 min on ice. The samples were subjected to SDS-PAGE and transferred to PVDF membranes via a wet transfer technique. The membranes were blocked with 5% non-fat milk for 2 h, then incubated overnight at 4°C with the appropriate primary antibodies. After three 10 min washes in TBST, membranes were incubated with secondary antibodies for 1 h at room temperature. Protein bands were detected using Immobilon Western horseradish peroxidase (HRP) mix reagent (Millipore). Antibodies used are listed in Table S2.

2.11 IF

Neurons were seeded on glass coverslips in six-well plates and subsequent implementation of various treatments. Subsequently, the neurons were rinsed three times with PBS, fixed with 4% formaldehyde, and permeabilized using 0.5% Triton X-100. Subsequently, the cells were blocked with 5% bovine serum albumin for 1 h. Next, the cells were incubated overnight at 4°C with a primary antibody, followed by incubation with a fluorescein isothiocyanate-conjugated goat secondary antibody for 1 h in the dark. Finally, the nuclei were stained with 4′,6-diamidino-2-phenylindole and visualized using an Olympus inverted fluorescence microscope. The average fluorescence intensity was quantified using ImageJ.

2.12 Dot blot analysis

Genomic DNA was extracted using the GenElute™ kit. The isolated gDNA was treated with RNase III for 2 h at 37°C. The enzyme was inactivated at 65°C for 20 min, and then the samples were divided. The control samples were digested with 10 U RNaseH1 for 16 h at 37°C. The DNA was spotted onto a nylon membrane using a dot-blot apparatus. The DNA was cross-linked to the membrane using ultraviolet light, and a 5% skimmed milk to block it. The membrane was incubated at 4°C overnight with S9.6 or dsDNA. The antibody was washed for 10 min in TBST, then HRP-conjugated secondary antibodies were applied for 1 h at room temperature. The intensity of the signals was quantified using ImageJ, and the ratios between the S9.6 and dsDNA signals were calculated to ascertain the global levels of R-loops.

2.13 Statistical analysis

Statistical analyses were performed using Graphpad Prism 10.2 software and are presented as mean ± SEM. Differences between variables were considered statistically significant at p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, and ns, not significant.

  1. Ethical approval: All animal care and experimental protocols were reviewed and approved by the Experimental Animal Welfare Ethics Review Committee of the Second Affiliated Hospital of Guangzhou Medical University (Approval number: A2023-049).

3 Result

3.1 Expression of FAHD1 is diminished during oxidative stress in neurons

The HT22 is a frequently utilized mouse hippocampal neuronal cell line that exhibits characteristic neuronal morphological features. It has been extensively employed in research pertaining to neurodegenerative diseases, oxidative stress, and signaling pathways. The objective of this study was to analyze specific molecules associated with neuronal oxidative stress. To this end, we performed a comprehensive analysis of the HT22’s transcriptome, with the aim of identifying genes associated with oxidative stress. As demonstrated in the volcano plot, among the differentially expressed genes, the expression of FAHD1 was significantly reduced (Figure 1a). To further substantiate this finding, RT-qPCR (Figure 1b), western blotting (Figure 1c and d), and IF (Figure 1e) consistently demonstrated a significant reduction in FAHD1 expression in the experimental group compared to the control group, in alignment with the bioinformatics analysis. Previous research has demonstrated that FAHD1 plays a role in regulating ROS production, leading us to hypothesize that FAHD1 is a key factor in protecting cells against oxidative stress damage.

Figure 1 FAHD1 expression in neurons under oxidative stress. Volcano plot of differentially regulated genes under oxidative stress (a). qRT-PCR evaluated FAHD1 expression levels after 100 µM H2O2 treatment (b). Western blot and semi-quantitative analysis of FAHD1 expression (c) and (d). IF staining analysis of FAHD1, scale bar: 5 μm (e) (n = 3, one sample t-test, **p < 0.01 and ***p < 0.001 represent comparison with control group).
Figure 1

FAHD1 expression in neurons under oxidative stress. Volcano plot of differentially regulated genes under oxidative stress (a). qRT-PCR evaluated FAHD1 expression levels after 100 µM H2O2 treatment (b). Western blot and semi-quantitative analysis of FAHD1 expression (c) and (d). IF staining analysis of FAHD1, scale bar: 5 μm (e) (n = 3, one sample t-test, **p < 0.01 and ***p < 0.001 represent comparison with control group).

3.2 Ferroptosis mediates H2O2-induced injury in neurons

The contribution of ferroptosis to H2O2-induced neuronal damage is illustrated in Figure 2. Treatment with H2O2 caused a significant decrease in neuronal survival (Figure 2a and b) and GSH levels (Figure 2c). GSH, a critical intracellular antioxidant, prevents lipid peroxidation by activating glutathione peroxidase 4 (GPX4), thereby inhibiting ferroptosis. Conversely, levels of MDA, a marker of lipid peroxidation, and ROS were significantly elevated (Figure 2d–f). Furthermore, qRT-PCR analysis demonstrated reduced expressions of SLC7A11 (also known as XCT) and GPX4 in neurons exposed to H2O2 (Figure 2g). Western blotting confirmed a significant reduction in ferroptosis-related proteins (XCT and GPX4) and a marked increase in 4-hydroxynonenal (4-HNE) levels (Figure 2h and i). Importantly, the neuronal damage induced by H2O2 was partially reversed by 1 µM Fer-1 [21], a ferroptosis inhibitor (Figure 2). These findings suggest that ferroptosis plays a key role in H2O2-induced neuronal death.

Figure 2 Ferroptosis causes H2O2-induced neuronal damage. Cell viability evaluated using the CCK-8 assay (a) (n = 6, one-way ANOVA, *p < 0.05, ***p < 0.001). An LDH assay (b) assessed cellular damage. GSH (c) and MDA (d) levels quantified. ROS production was evaluated using the DCFH-DA assay, scale bar 5 µm (e) and (f). WELD: White light emitting diode. qRT-PCR evaluated GPX4 and XCT expression levels (g). Ferroptosis-related proteins, such as 4-HNE, GPX4, and XCT were detected by western blotting (h) and (i) (n = 3, one-way ANOVA, *p < 0.05, **p < 0.01, ***p < 0.001, and ns, not significant).
Figure 2

Ferroptosis causes H2O2-induced neuronal damage. Cell viability evaluated using the CCK-8 assay (a) (n = 6, one-way ANOVA, *p < 0.05, ***p < 0.001). An LDH assay (b) assessed cellular damage. GSH (c) and MDA (d) levels quantified. ROS production was evaluated using the DCFH-DA assay, scale bar 5 µm (e) and (f). WELD: White light emitting diode. qRT-PCR evaluated GPX4 and XCT expression levels (g). Ferroptosis-related proteins, such as 4-HNE, GPX4, and XCT were detected by western blotting (h) and (i) (n = 3, one-way ANOVA, *p < 0.05, **p < 0.01, ***p < 0.001, and ns, not significant).

3.3 Overexpression of FAHD1 reduces the formation of R-loop and DNA damage in neurons

ROS generated during oxidative stress can promote the accumulation of abnormal R-loops and induce DNA damage. To determine whether FAHD1 mitigates R-loop formation and reduces DNA damage by inhibiting ROS, we performed IF staining. The results showed elevated levels of the R-loop marker S9.6 [22] and the DNA damage marker phosphorylated H2AX (γ-H2AX) [23] in neurons following H2O2 treatment. However, FAHD1 overexpression significantly attenuated these effects (Figure 3a–c). The successful transfection of FAHD1 was confirmed by western blot analysis (Figure S1a). Moreover, dot blot analysis confirmed that FAHD1 overexpression resulted in a decrease in S9.6 levels (Figure 3d and e). Furthermore, ROS levels were significantly elevated following H2O2 treatment, but markedly reduced by FAHD1 overexpression (Figure 3f). These findings suggest that FAHD1 overexpression decreases R-loop formation, thereby reducing DNA damage and promoting genomic stability in neurons.

Figure 3 Overexpression of FAHD1 reduces R-loop formation and DNA injury, while also mitigating ferroptosis. IF was performed to detect S9.6 and γ-H2AX expression, followed by semi-quantitative analysis, scale bar: 5 μm (a)–(c). Dot blot analysis and semi-quantitative analysis were conducted to assess R-loops using an antibody against S9.6, with dsDNA as an internal loading control (d) and (e). DCFH-DA assay employed to evaluate the production of ROS, scale bar: 5 μm (f). 4-HNE, XCT, and GPX4 expression levels were detected by western blotting and semi-quantitative analysis (g) and (h) (n = 3, one-way ANOVA, p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, and ns, not significant).
Figure 3

Overexpression of FAHD1 reduces R-loop formation and DNA injury, while also mitigating ferroptosis. IF was performed to detect S9.6 and γ-H2AX expression, followed by semi-quantitative analysis, scale bar: 5 μm (a)–(c). Dot blot analysis and semi-quantitative analysis were conducted to assess R-loops using an antibody against S9.6, with dsDNA as an internal loading control (d) and (e). DCFH-DA assay employed to evaluate the production of ROS, scale bar: 5 μm (f). 4-HNE, XCT, and GPX4 expression levels were detected by western blotting and semi-quantitative analysis (g) and (h) (n = 3, one-way ANOVA, p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, and ns, not significant).

3.4 Overexpression of FAHD1 inhibits ferroptosis in neurons

As previously described, overexpression of FAHD1 inhibited neuronal ROS production. In addition, we observed that FAHD1 overexpression reversed the H2O2-induced elevation of MDA levels and the reduction of GSH levels in neurons (Figure S2a–c). Furthermore, western blot analysis demonstrated that H2O2 treatment resulted in a downregulation of GPX4 and XCT expression, accompanied by an upregulation of 4-HNE levels. In contrast, FAHD1 overexpression reduced 4-HNE levels while upregulating GPX4 and XCT expression (Figure 3g and h). These results suggest that FAHD1 overexpression mitigates oxidative stress-induced neuronal ferroptosis.

3.5 FAHD1 attenuates oxidative stress-induced neuronal ferroptosis by inhibiting cGAS–STING pathway

Previous studies have identified the cGAS–STING pathway as a crucial mechanism in innate immune regulation, responsible for detecting abnormal intracellular DNA [24]. The cGAS–STING pathway has been identified as a potential contributor to a range of neurological disorders, including neurodegenerative diseases [25] and CNS injury [26]. To explore whether FAHD1 is potentially associated with the cGAS–STING pathway, western blot analysis demonstrated that H2O2 stimulation activates this pathway in neurons, increasing the expression of cGAS, STING, and phosphorylated IRF3. Conversely, FAHD1 overexpression diminished the expression of these proteins. Interestingly, the knockdown of RNase H1(RNH1), which degrades the RNA portion of the R-loop to restore DNA’s double-stranded structure [27], rendered FAHD1’s effects null (Figure 4a and b). The knockdown effect of RNH1 was confirmed through western blot analysis (Figure S1b). To verify that FAHD1 mitigates ferroptosis through the inhibition of the cGAS–STING pathway, western blot analysis revealed that FAHD1 overexpression resulted in enhanced GPX4 and XCT expression and attenuated 4-HNE levels. However, treatment with the STING agonist DMXAA [28] reversed these changes in protein expression (Figure 4c and d). Additionally, the decrease in neuronal survival induced by H2O2 was partially rescued by 1 μM RU.521 [29], a cGAS–STING pathway inhibitor (Figure S3a and b). CCK-8 assays confirmed that DMXAA exhibited negligible toxicity to neurons at concentrations below 50 µg/mL (Figure S3c). Similarly, the knockdown of RNH1 reversed the alterations in FAHD1-mediated expression of ferroptosis-related proteins (Figure 4e and f). The aforementioned results indicate that FAHD1 diminishes the activation of the cGAS–STING pathway by limiting the aberrant accumulation of R loops, which ultimately results in a reduction of neuronal ferroptosis.

Figure 4 FAHD1 attenuates neuronal ferroptosis by inhibiting the cGAS–STING pathway through reducing aberrant R-loop formation. Western blotting and semi-quantitative analysis were performed to assess the expression of cGAS–STING pathway-related proteins, including cGAS, STING, p-IRF3, and IRF3 (a) and (b). DMXAA: STING pathway agonist. After different treatments, the expression levels of ferroptosis-associated proteins 4-HNE, XCT, and GPX4 were detected by western blotting and quantified using ImageJ software (c)–(f) (n = 3, one-way ANOVA, p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, and ns, not significant).
Figure 4

FAHD1 attenuates neuronal ferroptosis by inhibiting the cGAS–STING pathway through reducing aberrant R-loop formation. Western blotting and semi-quantitative analysis were performed to assess the expression of cGAS–STING pathway-related proteins, including cGAS, STING, p-IRF3, and IRF3 (a) and (b). DMXAA: STING pathway agonist. After different treatments, the expression levels of ferroptosis-associated proteins 4-HNE, XCT, and GPX4 were detected by western blotting and quantified using ImageJ software (c)–(f) (n = 3, one-way ANOVA, p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, and ns, not significant).

4 Discussion

Ferroptosis represents a form of cell death characterized by iron accumulation and lipid peroxidation, both of which are prevalent pathophysiological features associated with neuronal oxidative stress [30]. This form of cell death is central to various neurological disorders [31]. In neurodegenerative diseases and CNS injuries, oxidative stress results in elevated levels of ROS and inflammatory factors. If these harmful compounds are not effectively scavenged or regulated, they propagate and form more complex derivatives, exacerbating neuronal damage. Previous studies have shown that inhibiting microglial ferroptosis significantly mitigates neurodegenerative changes [32]. Additionally, zinc has been found to attenuate ferroptosis and facilitate functional recovery following contusion spinal cord injury through the activation of the Nrf2/GPX4 defense pathway [33]. Therefore, early inhibition of neuronal ferroptosis is crucial to preserve the functional stability of the nervous system.

Previous studies have shown that the abnormal accumulation of R-loops is a common phenomenon in various human diseases, including neurological disorders and cancers [34]. R-loops are widely found in cells and are normally regulated dynamically under physiological conditions by precise formation and elimination mechanisms. However, abnormal R-loop accumulation leads to genomic instability, which can trigger various pathological conditions. Previous research has indicated that the inhibition of the aberrant accumulation of ROS and R-loop, which are generated by cellular oxidative stress, plays a pivotal role in maintaining neuronal cell health and homeostasis.Therefore, activating antioxidant mechanisms is essential to limit R-loop accumulation in the nervous system and maintain genome stability.

The growing body of evidence confirms that ROS accumulation stimulates the formation of aberrant R-loops, closely associated with the activation of the cGAS–STING pathway. Our experimental findings indicate that FAHD1 overexpression reduces neuronal ROS levels, decreases R-loop formation, and inhibits neuronal ferroptosis by suppressing the cGAS–STING pathway. Previous studies have also noted FAHD1 expression in both mouse and human models, highlighting its regulatory roles in energy metabolism, cellular function, and aging. In this study, we further demonstrate FAHD1’s critical role in mediating the pathological processes linked to neuronal ferroptosis.

Although this study has certain limitations, it offers valuable insights. Our findings indicate that FAHD1 reduces R-loop formation and mitigates neuronal ferroptosis through the cGAS–STING pathway. However, the precise mechanisms involved remain to be fully elucidated. Furthermore, it is unclear whether FAHD1 exerts additional functions, and our understanding of its role is still in the early stages of development. There are also substantial gaps in our knowledge regarding the mechanisms of ferroptosis in neurodegenerative diseases and CNS injury, warranting further investigation. In summary, addressing neuronal ferroptosis and preserving the functional stability of the nervous system continue to present significant challenges.

# These authors contributed equally.

Acknowledgments

The authors would like to express their gratitude to the participants and acknowledge the support of the National Natural Science Foundation of China and the Second Affiliated Hospital of Guangzhou Medical University.

  1. Funding information: This research received funding from the National Natural Science Foundation of China under the grant award 82172409.

  2. Author contributions: Bitao Wang: writing – original draft, data curation; Yubiao Yang: data curation, conceptualization; Zhi Zeng: investigation, data curation; Boyuan Ma: formal analysis, visualization; Yuxuan Zhou: visualization; Zhenhan Li: visualization, software; Jinyu Chen: software, project administration; Cheng Tang: data curation. Jian Hao: review, supervision, conceptualization; Xianhu Zhou: project administration, funding acquisition.

  3. Conflict of interest: All authors declare no conflicts of interest.

  4. Data availability statement: The original transcriptome data are accessible via the NCBI BioSample database (https://www.ncbi.nlm.nih.gov/biosample/).

References

[1] Moujalled D, Strasser A, Liddell JR. Molecular mechanisms of cell death in neurological diseases. Cell Death Differ. 2021;28(7):2029–44. 10.1038/s41418-021-00814-y.Search in Google Scholar PubMed PubMed Central

[2] Ryan SK, Ugalde CL, Rolland A-S, Skidmore J, Devos D, Hammond TR. Therapeutic inhibition of ferroptosis in neurodegenerative disease. Trends Pharmacol Sci. 2023;44(10):674–88. 10.1016/j.tips.2023.07.007.Search in Google Scholar PubMed

[3] Hu X, Xu Y, Xu H, Jin C, Zhang H, Su H, et al. Progress in understanding ferroptosis and its targeting for therapeutic benefits in traumatic brain and spinal cord injuries. Front Cell Dev Biol. 2021;9:705786. 10.3389/fcell.2021.705786.Search in Google Scholar PubMed PubMed Central

[4] Liang D, Minikes AM, Jiang X. Ferroptosis at the intersection of lipid metabolism and cellular signaling. Mol Cell. 2022;82(12):2215–27. 10.1016/j.molcel.2022.03.022.Search in Google Scholar PubMed PubMed Central

[5] Li J, Jia B, Cheng Y, Song Y, Li Q, Luo C. Targeting molecular mediators of ferroptosis and oxidative stress for neurological disorders. Oxid Med Cell Longev. 2022;2022:3999083. 10.1155/2022/3999083.Search in Google Scholar PubMed PubMed Central

[6] Dong B, Jiang Y, Shi B, Zhang Z, Zhang Z. Selenomethionine alleviates decabromodiphenyl ether-induced oxidative stress and ferroptosis via the NRF2/GPX4 pathway in the chicken brain. J Hazard Mater. 2024;465:133307. 10.1016/j.jhazmat.2023.133307.Search in Google Scholar PubMed

[7] Xie B-S, Wang Y-Q, Lin Y, Mao Q, Feng J-F, Gao G-Y, et al. Inhibition of ferroptosis attenuates tissue damage and improves long-term outcomes after traumatic brain injury in mice. CNS Neurosci Ther. 2019;25(4):465–75. 10.1111/cns.13069.Search in Google Scholar PubMed PubMed Central

[8] Shen W, Li C, Liu Q, Cai J, Wang Z, Pang Y, et al. Celastrol inhibits oligodendrocyte and neuron ferroptosis to promote spinal cord injury recovery. Phytomedicine. 2024;128:155380. 10.1016/j.phymed.2024.155380.Search in Google Scholar PubMed

[9] Kang L, Jin S, Wang J, Lv Z, Xin C, Tan C, et al. AAV vectors applied to the treatment of CNS disorders: clinical status and challenges. J Control Rel. 2023;355:458–73. 10.1016/j.jconrel.2023.01.067.Search in Google Scholar PubMed

[10] Kannan A, Leela SG, Branzei D, Gangwani L. Role of senataxin in R-loop-mediated neurodegeneration. Brain Commun. 2024;6(4):fcae239. 10.1093/braincomms/fcae239.Search in Google Scholar PubMed PubMed Central

[11] Petermann E, Lan L, Zou L. Sources, resolution and physiological relevance of R-loops and RNA–DNA hybrids. Nat Rev Mol Cell Biol. 2022;23(8):521–40. 10.1038/s41580-022-00474-x.Search in Google Scholar PubMed

[12] Ma TS, Worth KR, Maher C, Ng N, Beghè C, Gromak N, et al. Hypoxia-induced transcriptional stress is mediated by ROS-induced R-loops. Nucleic Acids Res. 2023;51(21):11584–99. 10.1093/nar/gkad858.Search in Google Scholar PubMed PubMed Central

[13] Schwab N, Taskina D, Leung E, Innes BT, Bader GD, Hazrati L-N. Neurons and glial cells acquire a senescent signature after repeated mild traumatic brain injury in a sex-dependent manner. Front Neurosci. 2022;16:1027116. 10.3389/fnins.2022.1027116.Search in Google Scholar PubMed PubMed Central

[14] Mani C, Acharya G, Kshirsagar S, Vijayan M, Khan H, Reddy PH, et al. A novel role for BRIP1/FANCJ in neuronal cells health and in resolving oxidative stress-induced DNA lesions. J Alzheimers Dis. 2022;85(1):207–21. 10.3233/JAD-215305.Search in Google Scholar PubMed

[15] Weiss AKH, Naschberger A, Loeffler JR, Gstach H, Bowler MW, Holzknecht M, et al. Structural basis for the bi-functionality of human oxaloacetate decarboxylase FAHD1. Biochem J. 2018;475(22):3561–76. 10.1042/BCJ20180750.Search in Google Scholar PubMed PubMed Central

[16] Etemad S, Petit M, Weiss AKH, Schrattenholz A, Baraldo G, Jansen-Dürr P. Oxaloacetate decarboxylase FAHD1 – a new regulator of mitochondrial function and senescence. Mech Ageing Dev. 2019;177:22–9. 10.1016/j.mad.2018.07.007.Search in Google Scholar PubMed

[17] Heberle A, Cappuccio E, Andric A, Kuen T, Simonini A, Weiss AKH. Mitochondrial enzyme FAHD1 reduces ROS in osteosarcoma. Sci Rep. 2024;14(1):9231. 10.1038/s41598-024-60012-x.Search in Google Scholar PubMed PubMed Central

[18] Baraldo G, Etemad S, Weiss AKH, Jansen-Dürr P, Mack HID. Modulation of serotonin signaling by the putative oxaloacetate decarboxylase FAHD-1 in Caenorhabditis elegans. PLoS One. 2019;14(8):e0220434. 10.1371/journal.pone.0220434.Search in Google Scholar PubMed PubMed Central

[19] Wang H, Zhou X-M, Wu L-Y, Liu G-J, Xu W-D, Zhang X-S, et al. Aucubin alleviates oxidative stress and inflammation via Nrf2-mediated signaling activity in experimental traumatic brain injury. J Neuroinflammation. 2020;17(1):188. 10.1186/s12974-020-01863-9.Search in Google Scholar PubMed PubMed Central

[20] Burel SA, Hart CE, Cauntay P, Hsiao J, Machemer T, Katz M, et al. Hepatotoxicity of high affinity gapmer antisense oligonucleotides is mediated by RNase H1 dependent promiscuous reduction of very long pre-mRNA transcripts. Nucleic Acids Res. 2015;44(5):2093. 10.1093/nar/gkv1210.Search in Google Scholar PubMed PubMed Central

[21] Chen Y, He W, Wei H, Chang C, Yang L, Meng J, et al. Srs11-92, a ferrostatin-1 analog, improves oxidative stress and neuroinflammation via Nrf2 signal following cerebral ischemia/reperfusion injury. CNS Neurosci Ther. 2023;29(6):1667–77. 10.1111/cns.14130.Search in Google Scholar PubMed PubMed Central

[22] Sanz LA, Chédin F. High-resolution, strand-specific R-loop mapping via S9.6-based DNA-RNA immunoprecipitation and high-throughput sequencing. Nat Protoc. 2019;14(6):1734–55. 10.1038/s41596-019-0159-1.Search in Google Scholar PubMed PubMed Central

[23] Gerić M, Gajski G, Garaj-Vrhovac V. γ-H2AX as a biomarker for DNA double-strand breaks in ecotoxicology. Ecotoxicol Environ Saf. 2014;105:13–21. 10.1016/j.ecoenv.2014.03.035.Search in Google Scholar PubMed

[24] Skopelja-Gardner S, An J, Elkon KB. Role of the cGAS–STING pathway in systemic and organ-specific diseases. Nat Rev Nephrol. 2022;18(9):558–72. 10.1038/s41581-022-00589-6.Search in Google Scholar PubMed PubMed Central

[25] Huang Y, Liu B, Sinha SC, Amin S, Gan L. Mechanism and therapeutic potential of targeting cGAS–STING signaling in neurological disorders. Mol Neurodegener. 2023;18(1):79. 10.1186/s13024-023-00672-x.Search in Google Scholar PubMed PubMed Central

[26] Hu X, Zhang H, Zhang Q, Yao X, Ni W, Zhou K. Emerging role of STING signalling in CNS injury: inflammation, autophagy, necroptosis, ferroptosis and pyroptosis. J Neuroinflammation. 2022;19(1):242. 10.1186/s12974-022-02602-y.Search in Google Scholar PubMed PubMed Central

[27] Zong C, Zhang Z, Gao L, He J, Wang Y, Li Q, et al. APOBEC3B coordinates R-loop to promote replication stress and sensitize cancer cells to ATR/Chk1 inhibitors. Cell Death Dis. 2023;14(6):348. 10.1038/s41419-023-05867-0.Search in Google Scholar PubMed PubMed Central

[28] Wang K, Donnelly CR, Jiang C, Liao Y, Luo X, Tao X, et al. STING suppresses bone cancer pain via immune and neuronal modulation. Nat Commun. 2021;12(1):4558. 10.1038/s41467-021-24867-2.Search in Google Scholar PubMed PubMed Central

[29] Yang NSY, Zhong WJ, Sha HX, Zhang CY, Jin L, Duan JX, et al. mtDNA-cGAS–STING axis-dependent NLRP3 inflammasome activation contributes to postoperative cognitive dysfunction induced by sevoflurane in mice. Int J Biol Sci. 2024;20(5):1927–46. 10.7150/ijbs.91543.Search in Google Scholar PubMed PubMed Central

[30] Levi S, Ripamonti M, Moro AS, Cozzi A. Iron imbalance in neurodegeneration. Mol Psychiatry. 2024;29(4):1139. 10.1038/s41380-023-02399-z.Search in Google Scholar PubMed PubMed Central

[31] Jacquemyn J, Ralhan I, Ioannou MS. Driving factors of neuronal ferroptosis. Trends Cell Biol. 2024;34(7):535–46.10.1016/j.tcb.2024.01.010Search in Google Scholar PubMed

[32] Ryan SK, Zelic M, Han Y, Teeple E, Chen L, Sadeghi M. Microglia ferroptosis is regulated by SEC24B and contributes to neurodegeneration. Nat Neurosci. 2023;26(1):12–26. 10.1038/s41593-022-01221-3.Search in Google Scholar PubMed PubMed Central

[33] Ge M-H, Tian H, Mao L, Li D-Y, Lin J-Q, Hu H-S, et al. Zinc attenuates ferroptosis and promotes functional recovery in contusion spinal cord injury by activating Nrf2/GPX4 defense pathway. CNS Neurosci Ther. 2021;27(9):1023–40. 10.1111/cns.13657.Search in Google Scholar PubMed PubMed Central

[34] Uruci S, Lo CSY, Wheeler D, Taneja N R-loops and its chro-Mates: the strange case of Dr. Jekyll and Mr. Hyde. Int J Mol Sci. 2021;22(16):8850. 10.3390/ijms22168850.Search in Google Scholar PubMed PubMed Central

Received: 2025-03-07
Revised: 2025-03-07
Accepted: 2025-04-22
Published Online: 2025-09-24

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Review Articles
  156. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  157. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  158. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  159. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  160. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  161. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  162. The application of augmented reality in robotic general surgery: A mini-review
  163. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  164. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  165. Plant polyphenols, terpenes, and terpenoids in oral health
  166. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  167. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  168. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  169. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  170. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  171. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  172. Giant borderline ovarian tumours – review of the literature
  173. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  174. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  175. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  176. Supplement strategies for infertility in overweight women: Evidence and legal insights
  177. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  178. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  179. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  180. Strategies for hyperkalemia management in dialysis patients: A systematic review
  181. C-reactive protein-to-albumin ratio in peripheral artery disease
  182. Case Reports
  183. Delayed graft function after renal transplantation
  184. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  185. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  186. Giant right atrial hemangioma presenting with ascites: A case report
  187. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  188. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  189. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  190. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  191. Rapid Communication
  192. Biological properties of valve materials using RGD and EC
  193. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  194. Letter to the Editor
  195. Role of enhanced external counterpulsation in long COVID
  196. Expression of Concern
  197. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  198. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  199. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  200. Corrigendum
  201. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  202. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  203. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  204. Retraction
  205. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  206. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  207. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  208. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  209. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  210. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  211. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  212. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  213. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  214. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  215. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  216. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  217. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  218. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  219. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  220. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  221. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  222. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  223. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  224. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  225. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  226. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  227. A review of brain research on T2DM-related cognitive dysfunction
  228. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  229. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  230. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
https://doi.org/10.1515/med-2025-1200
Keywords for this article
FAHD1; neuronal ferroptosis; oxidative stress; R-loop; cGAS–STING pathway
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Review Articles
  156. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  157. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  158. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  159. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  160. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  161. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  162. The application of augmented reality in robotic general surgery: A mini-review
  163. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  164. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  165. Plant polyphenols, terpenes, and terpenoids in oral health
  166. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  167. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  168. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  169. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  170. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  171. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  172. Giant borderline ovarian tumours – review of the literature
  173. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  174. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  175. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  176. Supplement strategies for infertility in overweight women: Evidence and legal insights
  177. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  178. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  179. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  180. Strategies for hyperkalemia management in dialysis patients: A systematic review
  181. C-reactive protein-to-albumin ratio in peripheral artery disease
  182. Case Reports
  183. Delayed graft function after renal transplantation
  184. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  185. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  186. Giant right atrial hemangioma presenting with ascites: A case report
  187. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  188. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  189. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  190. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  191. Rapid Communication
  192. Biological properties of valve materials using RGD and EC
  193. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  194. Letter to the Editor
  195. Role of enhanced external counterpulsation in long COVID
  196. Expression of Concern
  197. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  198. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  199. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  200. Corrigendum
  201. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  202. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  203. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  204. Retraction
  205. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  206. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  207. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  208. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  209. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  210. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  211. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  212. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  213. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  214. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  215. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  216. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  217. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  218. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  219. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  220. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  221. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  222. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  223. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  224. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  225. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  226. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  227. A review of brain research on T2DM-related cognitive dysfunction
  228. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  229. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  230. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 25.11.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2025-1200/html
Scroll to top button