Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
-
Jinling Liu
, Wenwen Xiao , Buluhan Halan , Aishanjiang Wumaer , Zhuoya Maimaitiwusiman , Saiyare Xuekelati , Tajiguli Musha , Xue Bai and Hongmei Wang
Abstract
Objective
Obesity has been recognized as a global epidemic and public health crisis. The prevalence of obesity has tripled since 1975, especially in the elderly population. Accumulating preclinical and clinical studies have confirmed that chronic low-grade inflammation of adipose tissues is mechanistically related to metabolic diseases and tissue complications in overweight and obesity patients, as a result of the intricate interplay of various pro-inflammatory and anti-inflammatory signaling cascades. The present study aims to explore the differential expressions of receptor activator of nuclear factor-kappa B (RANK), RANK ligand (RANKL), and osteoprotegerin (OPG) in leukocytes of elderly obesity patients in Xinjiang, thereby providing new physiological, cellular, and molecular targets for the treatment of obesity.
Methods
A total of 40 obesity patients and 40 non-obesity patients were selected. The protein and gene expression levels of RANK, RANKL, and OPG in peripheral blood were detected by western blotting and real-time quantitative PCR.
Results
There was no significant difference in the expression levels of RANK protein, OPG protein, and OPG gene between the obesity group and non-obesity group (P > 0.05). The relative expression levels of the RANK gene and RANKL protein and gene were significantly different between the obesity group and non-obesity group (P < 0.05). The differential expressions of the RANK gene, RANKL protein and gene, and the OPG protein in leukocytes had a significant correlation with obesity in the elderly population (P < 0.05).
Conclusion
The expressions of the RANKL protein and gene and RANK gene in leukocytes of elderly obesity patients in Xinjiang were higher than those of non-obesity patients. In the elderly obesity patients in Xinjiang, the abdominal circumference was correlated with the expressions of the RANK gene, RANKL protein and gene, and OPG protein in leukocytes.
1 Introduction
Obesity is defined as a chronic metabolic disease caused by excessive fat accumulation and also includes genetic and environmental factors [1]. Obesity can be asymptomatic or accompanied by a variety of comorbidities, such as cancer, coronary artery disease, diabetes, hypertension, gout, obstructive sleep apnea, and osteoarthritis [2,3,4]. It is estimated that nearly 4 million people die of weight-related comorbidities every year. Complications caused by obesity are closely related to the risk of death and have become the primary cause of preventable diseases and disabilities [5]. According to the survey, 2030–2050 will be the most serious period of population aging in China. The global obesity epidemic continues to spread relentlessly. In China, the elderly over 60 years old are particularly prominent, which leads to an increase in the risk of serious diseases and death related to obesity and its comorbidities. It is easy to interact with other risk factors, further endangering the health of the elderly. Therefore, it is imperative to formulate and implement effective obesity prevention and control strategies [6].
Obesity is the result of the complex interaction of genetic factors, environmental factors, and polygenic factors. At present, research on the pathogenesis of obesity is still in the exploratory stage, and the exact cause of obesity has not been fully clarified. New evidence shows that the nuclear factor receptor activator-κB ligand (RANKL)-RANK-OPG system not only participates in the regulation of bone metabolism but also plays a vital role in the regulation of chronic metabolic diseases, especially sugar and lipid metabolism [7,8]. The variation and differential expression of these genes are partially the reasons for obesity [7,8,9,10,11,12,13,14,15]. Our previous research found that the decrease in the methylation level in the RANK promoter region is related to obesity in the elderly population in Xinjiang [16]. Other scholars have found that there is an obvious correlation between the reduction of the methylation level and obesity in the population, and pointed out that the effect is very significant, especially in the elderly over 65 years old. However, there is no report on the correlation between the gene and protein expression levels of the Rank–RANKL–OPG system and obesity. Relevant scholars have pointed out that RANKL binds to its receptor level and activates the NF-κB pathway, thus triggering the expression of pro-inflammatory cytokines, while obesity also activates the JNK and NF-κB signaling pathways. NF-κB activation induces the activation of the inflammatory signaling pathway, which leads to insulin resistance and pancreatic β-cell dysfunction, and also activates T cells, endothelial cells, and adipocytes. By comparing the gene and protein expression levels of RANK, RANKL, and OPG in elderly obese patients in Xinjiang, this study discusses the correlation between the RANK–RANKL–OPG system and elderly obesity, and provides a basis for further study on the pathogenesis of obesity.
2 Research subjects and methods
2.1 Research subjects
The cohort established in this study was based on the elderly general population in Xinjiang collected in the previous epidemiological survey. According to the Guidelines for Prevention and Control of Overweight and Obesity in Chinese Adults, a male waist circumference of ≥85 cm and a female waist circumference of ≥80 cm were considered obese. A total of 80 older patients who were hospitalized in the Second Department of Cadre Health Care of People’s Hospital of Xinjiang Uygur Autonomous Region from March 2020 to April 2020 were recruited. Inclusion criteria are as follows: (1) age ≥ 60 years, (2) local registered residents, and (3) informed consent. Exclusion criteria are as follows: (1) cognitive impairment, (2) language communication barrier, (3) patients with mental illness, (4) type I diabetes, (5) chronic kidney disease, (6) chronic liver disease or alcoholism, (7) chronic lung disease, (8) taking hormone drugs, (9) hyperthyroidism and hypothyroidism, (10) major organ failure, (11) a recent history of surgery, (12) a recent history of infection, and (13) consumptive diseases such as malignant tumor and pulmonary tuberculosis.
The general information of all subjects was collected, including the age, gender, educational degree, resting blood pressure, smoking and drinking history, history of diabetes, and history of hypertension. Then, 5 mL of whole blood was extracted from the subjects under fasting conditions, and the serum and blood-formed elements were separated by on-site centrifugation. The blood lipids were detected within 1 month after blood collection, including total cholesterol (TC), triglyceride (TG), high-density lipoprotein-cholesterol (HDL-C), low-density lipoprotein-cholesterol (LDL-C), creatinine, glutamic pyruvic transaminase, glutamic oxaloacetic transaminase, blood glucose, and other biochemical indicators. The blood-formed element was stored at −80°C for extracting DNA. The biochemical tests were completed by specially assigned personnel in the Department of Clinical Laboratory of the People’s Hospital of Xinjiang Uygur Autonomous Region (grade III class A hospital).
The calculation of each index was as follows: (1) hypertension: systolic pressure ≥ 140 mmHg (1 mmHg = 0.133 kPa) and/or diastolic pressure ≥ 90 mmHg, or those who had a history of hypertension and took antihypertensive drugs in the past 2 weeks [17]. (2) Diabetes: fasting blood glucose (FBG) ≥ 7.0 mmol/L and/or with a history of diabetes [18]. (3) Dyslipidemia: TC ≥ 6.22 mmol/L or TG ≥ 2.26 mmol/L or LDL-C ≥ 4.14 mmol/L or HDL-C < 1.04 mmol/L [19]. (4) Abdominal circumference: the subject was in a standing position, with shoulders naturally relaxed and arms sagging. A tape measure was used to encircle the navel of the subject, and the tape measure should be parallel to the ground when recording the abdominal circumference. Men with an abdominal circumference of ≥85 cm and women with an abdominal circumference of ≥80 cm were considered obese.
Among the selected subjects, there were 40 subjects in the obesity group (case group) and 40 subjects in the non-obesity group. All subjects had signed informed consent. This study was reviewed and approved by the Medical Ethics Committee of the People’s Hospital of Xinjiang Uygur Autonomous Region.
2.2 Research materials
Five × All-In-One RT MasterMix (with AccuRT Genomic DNA Removal Kit) (abm, G492), EvaGreen Express 2 × qPCR MasterMix-Low Rox (abm, MasterMix-LR), bicinchoninic acid (BCA) kit (TransGen Biotech, DQ111-01), RANK antibody (Abcam, ab182158), RANKL antibody (Bioss, bs-0747R), OPG antibody (Bioss, bs-0431R), LC3-B antibody (Bioss, BS-4843R), and β-actin (Sino Biological, 100166-MM10) were used in the experiments.
A PCR instrument (Bio-Rad, MyCycler Thermal Cycler, ABI QuantStudio™ 6), quantitative fluorescence PCR (ABI, Flex Real-Time PCR System), high-speed refrigerated centrifuge (Thermo Fisher Scientific, Heraeus Multifuge X1R), gel imaging system (Shanghai Tanon Co., Ltd, 2500), electrophoretic transfer (Bio-Rad, USA, Mini-PROTEAN Tetra System), chemiluminescence imaging system (Shanghai CLiNX Scientific Instruments Co., Ltd, Chemiscope 3000), and microplate reader (Bio-Rad, xMarkTM) were used.
2.3 Research methods
2.3.1 Treatment of blood samples
Blood samples were collected from the subjects using ethylenediaminetetraacetic acid (EDTA) tubes (5 mL × 2 tubes per subject) and centrifuged at 2,500 rpm/min (centrifugation radius of 116 mm) for 10 min to obtain the upper plasma and sealed it for standby. The remaining lower blood sample was added with three times the volume of red blood cell lysate, mixed twice in a vortex shaker, and placed on ice for 15 min. The sample was subjected to centrifugation at 450 × g and 4°C for 10 min to precipitate leukocytes, and then, the supernatant was carefully removed. Next, the leukocyte precipitation was supplemented with red blood cell lysate, twice the volume of the original liquid, followed by a gentle vortex to fully resuspend the leukocytes. Thereafter, the leukocytes were centrifuged at 450 × g and 4°C for 10 min, and the supernatant was removed carefully and thoroughly. Finally, peripheral blood leukocytes were obtained.
2.3.2 Extraction of protein and RNA
Leukocytes (1 × 106) were collected, rinsed with phosphate-buffered saline (PBS), and centrifuged to remove the supernatant. To the cell precipitate, 100 μL radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitor and phosphatase inhibitor was added, homogenized fully on ice, subjected to an ice bath for 60 min, and centrifuged at 12,000 rpm and 4°C for 15 min to obtain the supernatant. The protein concentration was measured using the BCA method. Subsequently, the protein was denatured with 5× protein loading buffer and then stored for standby after cooling.
Peripheral blood leukocytes were lysed with the TRIzol reagent, mixed in a 1.5 mL centrifuge tube, and placed at room temperature for 15 min. Then, the cells were mixed with 200 μL of chloroform, placed at room temperature for 5 min, and centrifuged at 12,000 rpm and 4°C for 15 min. The supernatant was moved into another centrifuge tube, an equal volume of isopropanol was added, mixed well, and placed at −20°C for 60 min. After centrifugation at 12,000 rpm for 15 min at 4°C, the supernatant was carefully removed. Next, 75% ethanol was added to make the precipitate float and washed off. After centrifugation at 12,000 rpm for 15 min at 4°C to remove the supernatant, 75% ethanol was added again for washing, followed by empty tube centrifugation and discarding the liquid. The precipitate was dissolved using RNase-free water. The ultramicrospectrophotometer (Nano-100, ALLSHENG, Hangzhou, China) was used for the detection. The final concentration of RNA in each sample was ensured to be 100–500 ng/μL, and the A260/A280 ratio was 1.8–2.1. RNA integrity was detected using agarose gel electrophoresis, followed by RNA reverse transcription for subsequent experiments.
2.3.3 Western blotting
The loaded protein sample (20 μg) was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene fluoride membranes (0.45 μm). The membranes were blocked with 5% skim milk at room temperature for 1 h, rinsed with Tris-buffered saline-tween (TBST) 3 times (5 min/time), and incubated with the primary antibodies at 4°C overnight: RANK (1:1,200), RANKL (1:1,600), OPG (1:600), and β-actin (1:1,000). After washing three times with TBST (10 min/time), the membranes were incubated with the secondary antibodies goat anti-mouse IgG H&L (HRP) (1:15,000) and goat anti-rabbit IgG H&L (HRP) (1:5,000) at room temperature for 1 h and rinsed with TBST three times (10 min/time). The chromogenic solutions A and B were mixed and added to the membranes (2 mL), and the ChemiScope mini chemiluminometer was used for detection and photographing. The gray value of protein bands was calculated using Image J software.
2.3.4 cDNA synthesis and quantitative real-time polymerase chain reaction (qPCR)
The reverse transcription system is shown in Table 1. Reverse transcription was performed using the PCR instrument (Bio-Rad, MyCycler Thermal Cycler, ABI QuantStudio™ 6), and the procedures were set as follows: reaction at 25°C for 10 min, reaction at 42°C for 15 min, and reaction at 85°C for 5 min. The cDNA obtained by reverse transcription was stored at −80°C, and the cDNA samples for subsequent fluorescence quantitative detection of mRNA were diluted with RNase-free water at a ratio of 1:1 for the reaction. The primer information is shown in Table 2: β-actin, internal reference, 10 μL Evagreen 2 × qPCR Master Mix (abm, MasterMix-LR); 0.6 μL, forward primer; 0.6 μL, reverse primer; 2 μL, cDNA template; and 6.8 μL, ddH2O. The procedures of the fluorescence quantitative PCR instrument were set as follows: 95°C for 10 min, 40 cycles of 95°C for 15 s, 60°C for 60 s, and 60°C for 60 s. The relative expression of the gene was calculated using the 2−ΔΔCt method.
Synthesis and configuration system of mRNA first-strand cDNA
| Component | Volume |
|---|---|
| RNA template | Up to 1 μg |
| AccuRT reaction mix (4×) | 2 μL |
| Nuclease-free H2O | Up to a total volume of 8 μL |
| Incubate at 42°C for 2 min or at room temperature for 5 min, then add the following to the tube: | |
| AccuRT Reaction Stopper (5X) | 2 μL |
| 5X All-In-One RT MasterMix | 4 μL |
| Nuclease-free H2O | 6 μL |
| Total reaction volume | 20 μL |
Primers for fluorescence quantitative mRNA detection
| Name of the primer | Sequence (5′ to 3′) | Size of the primer |
|---|---|---|
| RANK-F | TTGCAGCTCAACAAGGACAC | 104 bp |
| RANK-R | AAGGTACAGTTGGTCCAGGG | |
| RANKL-F | CAGAGAAAGCGATGGTGGATG | 105 bp |
| RANKL-R | ATGGGATGTCGGTGGCATTA | |
| OPG-F | AAGGAGCTGCAGTACGTCAA | 139 bp |
| OPG-R | CAGCTTGCACCACTCCAAAT |
2.3.5 Statistical methods
All data were subjected to statistical analysis by SPSS 19.0 software. The measurement data were in normal distribution and expressed by x ± s. The difference between the two groups was compared by using a t-test. The correlation of the expressions of the RANK, RANKL, OPG protein, and gene with obesity was analyzed by the Pearson correlation coefficient. A value of P < 0.05 was indicative of statistical significance.
-
Ethics approval: This study was reviewed and approved by the Medical Ethics Committee of the People’s Hospital of Xinjiang Uygur Autonomous Region.
-
Informed consent: For all studies involving human participants, informed written consent to take part in the research has been obtained prior to the commencement of the study.
3 Results
3.1 Comparison of demographic and clinical characteristics
This section includes the basic indexes and clinical characteristics of obese and non-obese groups, and analyzes the correlation between patients’ age, gender, diastolic blood pressure at admission, education level, hypertension, diabetes, coronary heart disease, TG, TC, LDL-C, HDL-C, urea nitrogen, and so on.
The analysis of Table 3 shows that there are significant differences in age, sex, and diastolic blood pressure at admission between the obese group and non-obese group, which is statistically significant. It shows that obesity and non-obesity are influenced by age, sex, and diastolic blood pressure, and many factors are closely related. The analysis found that no matter the education level of patients and the medical history of hypertension, diabetes, coronary heart disease, and other differences, there will be no significant comparative differences, no statistical significance. The same is true for TG, TC, LDL-C, HDL-C, and urea nitrogen.
Analysis of demographic characteristics and clinical data of selected subjects
| Obesity group (n = 40) | Non-obesity group (n = 40) | t/Z/χ² | P | |
|---|---|---|---|---|
| Age | 72.15 (7.18) | 76.97 (10.29) | 2.432 | 0.017 |
| Gender (%) | 6.545 | 0.02 | ||
| Male | 20 (50.0) | 31 (77.5) | ||
| Female | 20 (50.0) | 9 (22.5) | ||
| Nationality (%) | 2.615 | 0.27 | ||
| Han Nationality | 23 (57.5) | 23 (57.5) | ||
| Uygur Nationality | 11 (27.5) | 15 (37.5) | ||
| Other | 6 (15.0) | 2 (5.0) | ||
| Education degree (%) | 3.252 | 0.197 | ||
| Primary school degree | 5 (12.5) | 11 (27.5) | ||
| Junior high school degree | 4 (10.0) | 5 (12.5) | ||
| Senior high school degree or above | 31 (77.5) | 24 (60.0) | ||
| Smoking (%) | 12 (30.0) | 10 (25.0) | 0.802 | |
| Drinking (%) | 9 (22.5) | 8 (20.0) | 1 | |
| Type 2 diabetes (%) | 7 (17.5) | 12 (30.0) | 0.293 | |
| Hypertension (%) | 24 (60.0) | 32 (80.0) | 0.088 | |
| Coronary heart disease (%) | 18 (45.0) | 17 (42.5) | 1 | |
| Systolic pressure at admission | 138.20 (20.43) | 137.15 (19.11) | −0.237 | 0.813 |
| Diastolic pressure at admission | 78.17 (12.64) | 72.20 (13.03) | −2.082 | 0.041 |
| Glutamic pyruvic transaminase | 21.82 (13.26) | 20.90 (19.97) | −0.244 | 0.808 |
| Glutamic oxaloacetic transaminase | 20.96 (6.77) | 21.67 (17.23) | 0.242 | 0.809 |
| Urea nitrogen | 4.96 (1.32) | 5.70 (2.12) | 1.869 | 0.065 |
| Creatinine | 64.90 (13.14) | 76.12 (40.55) | 1.665 | 0.1 |
| TG | 1.36 (0.52) | 1.38 (0.68) | 0.177 | 0.86 |
| TC | 4.46 (1.14) | 4.39 (1.27) | −0.263 | 0.793 |
| High-density lipoprotein | 1.16 (0.25) | 1.24 (0.69) | 0.740 | 0.461 |
| Low-density lipoprotein | 2.03 (0.82) | 2.06 (0.89) | 0.124 | 0.902 |
3.2 Comparison of RANKL protein and RNA expression levels
The relative expression of RANKL protein was significantly different between the obesity group [(0.70 ± 0.20)] and the non-obesity group [(0.58 ± 0.23)] (T = −2.657, P = 0.021), and the expression of RANKL mRNA was also significantly different between the obesity group [(1.31 ± 0.64)] and the non-obesity group [(1.06 ± 0.37)] (T = −2.144, P = 0.035), as shown in Table 4 and Figure 1. Expression levels of RANK, RANKL, and OPG proteins in two groups are shown in Figure 2.
Difference in the relative expressions of RANKL, RANK, OPG proteins and mRNAs between older obese patients and controls
| Obesity group | Non-obesity group | T | P | |
|---|---|---|---|---|
| RANKL protein | 0.70 (0.20) | 0.58 (0.23) | −2.657 | 0.021 |
| RANKL mRNA | 1.31 (0.64) | 1.06 (0.37) | −2.144 | 0.035 |
| RANK protein | 0.84 (0.31) | 0.81 (0.27) | −0.144 | 0.701 |
| RANK mRNA | 2.51 (1.29) | 1.16 (0.62) | −5.969 | <0.001 |
| OPG protein | 0.99 (0.08) | 0.96 (0.09) | 1.154 | 0.117 |
| OPG mRNA | 1.25 (0.75) | 1.08 (0.44) | −1.174 | 0.244 |

Comparison of protein levels of RANKL, RANK, and OPG in the peripheral blood between the two groups ((a) statistical analysis of RANKL protein expression level; (b) statistical analysis of RANK protein expression level; (c) statistical analysis of OPG protein expression level). Comparison of gene levels of RANKL, RANK, and OPG in peripheral blood between the two groups ((d) statistical analysis of the RANKL gene expression level; (e) statistical analysis of the RANK gene expression level; (f) statistical analysis of the OPG gene expression level).

Expression levels of the RANK, RANKL, and OPG proteins in the two groups.
3.3 Comparison of the RANK protein and gene expression levels
There was no significant difference in the relative expression of RANK protein between the obesity group [(0.99 ± 0.08)] and the non-obesity group [(0.81 ± 0.27)] (T = 0.144, P = 0.701), while the expression of RANK gene was significantly different between the obesity group [(2.51 ± 1.29)] and the non-obesity group [(1.16 ± 0.62)] (T = −5.969, P < 0.001), as shown in Table 4 and Figure 1.
3.4 Comparison of OPG protein and gene expression levels
There was no significant difference in the relative expression of OPG protein between the obesity group [(0.98 ± 0.08)] and the non-obesity group [(0.97 ± 0.09)] (T = 1.1541, P = 0.117). The expression of OPG mRNA was significantly different between the obesity group [(1.25 ± 0.75)] and the non-obesity group [(1.08 ± 0.44)] (T = −1.174, P = 0.244), as shown in Table 4 and Figure 1.
3.5 Correlation analysis between the differential expressions of the RANK, RANKL, OPG proteins, and gene and abdominal circumference
The expressions of the RANK mRNA, RANKL protein, RANKL mRNA, and OPG protein in leukocytes of elderly obese patients were positively correlated with abdominal circumference, and the correlation coefficient r was 0.378, 0.043, 0.262, and 0.363, respectively, with statistical significance (all P < 0.05, Table 5).
Correlation between the abdominal circumference and relative expressions of the RANKL, RANK, OPG proteins, and mRNAs in older obesity patients
| Abdominal circumference | RANK protein | RANKL protein | OPG protein | RANK mRNA | RANKL mRNA | OPG mRNA | |
|---|---|---|---|---|---|---|---|
| RANK protein | 0.292 | 1.000 | 0.233 | 0.211 | −0.046 | −0.206 | −0.066 |
| RANKL protein | 0.000 | 0.038 | 1.000 | 0.407 | 0.116 | −0.093 | −0.042 |
| OPG protein | 0.001 | 0.061 | 0.000 | 1.000 | 0.023 | 0.298 | −0.103 |
| RANK mRNA | 0.001 | 0.684 | 0.306 | 0.838 | 1.000 | 0.177 | 0.099 |
| RANKL mRNA | 0.019 | 0.067 | 0.414 | 0.007 | 0.116 | 1.000 | 0.371 |
| OPG mRNA | 0.443 | 0.558 | 0.711 | 0.362 | 0.383 | 0.001 | 1.000 |
| Abdominal circumference | 1.000 | −0.119 | 0.443 | 0.363 | 0.378 | 0.262 | 0.087 |
Note: Numbers in black are the Pearson correlation coefficients, and numbers in red are the P values of the correlation coefficients.
4 Discussion
The results of this study showed that the expressions of the RANKL protein, RANKL mRNA, and RANK gene in the peripheral blood of older obese patients in Xinjiang were higher than those of non-obese patients. In the older obese patients in Xinjiang, the abdominal circumference was correlated with the expression of the RANK protein, RANK gene, RANKL protein, and OPG protein. However, the interaction and mechanism between obesity and the RANK/RANKL/OPG system still need further exploration.
Nowadays, obesity has become the most concerning public health problem in the world [20,21,22]. Chronic low-grade inflammation of the whole body is an important inducement of obesity, lipid metabolism, diabetes, arteriosclerosis, and insulin resistance [23]. In addition, some researchers pointed out that adipose tissue can secrete many hormones, cytokines, and chemokines with various biological functions besides energy storage [24], thus participating in the regulation of adipose tissue and the immune system [25]. Obesity is not only the excessive accumulation of adipose tissue, but also a chronic low-grade inflammatory state induced by various inflammatory factors [25]. In the vicious circle of obesity, the continuous expansion of white adipose tissue leads to an increase in the secretion of tumor necrosis factor α (TNF-α), C-reactive protein (CRP), interleukin-6 (IL-6), monocyte chemoattractant protein -1(MCP-1), and other pro-inflammatory cytokines, which eventually leads to a chronic inflammatory state [26,27,28,29]. Due to the specific heterogeneity of adipose tissue, macrophages in adipose tissue also activate c-Jun amino-terminal kinase (JNK) and nuclear factor-κB (NF-κB) signaling pathways through autocrine and paracrine, which affects the surrounding tissues and organs, forming a vicious circle and aggravating the occurrence and development of obesity. Tumor necrosis factor superfamily regulates adipocyte inflammation and manipulates adipocyte function, thus promoting the occurrence of obesity and the development of complications [30]. Some researchers observed that the levels of TNF-α and leptin in obese patients increased, while the level of adiponectin decreased, and activated the RANK/RANKL/OPG system [31,32].
The role of the RANKL–RANK–OPG system in glucose and lipid metabolism has also been highlighted, in addition to the regulation of bone metabolism. RANKL is a type Ⅱ transmembrane protein, and RANK is its specific receptor; OPG is a pseudoreceptor of RANKL. RANK, RANKL, and OPG have well-established regulatory effects on bone metabolism. Moreover, RANK, RANKL, and OPG are also highly expressed in monocytes/macrophages, liver, muscle, kidney, heart, lung, vascular tissues, dendritic cells, and breast. OPG competitively binds to RANKL with RANK, thus blocking the mechanism of RANK. The binding affinity between OPG and RANKL is about 500 times higher than that of OPG and RANK. Therefore, OPG can prevent RANKL from binding to its receptor RANK. RANKL mainly exists in the Golgi apparatus. OPG affects the release of RANKL to the cell membrane and its extracellular transport process, leaving RANKL in the cells and thus reducing the binding of RANKL and RANK [33]. The activation of the RANK/RANKL/OPG signaling pathway is essentially a series of signal transduction reactions and biological effects after the binding of RANKL and RANK.
As a ligand of RANK, RANKL exists in two forms: soluble protein and transmembrane protein. RANK and RANKL genes are expressed in human liver tissues and pancreatic β cells, showing a close correlation with blood glucose control and obesity. The concentration of soluble RANKL is related to insulin resistance [34]. RANKL binds to its receptor RANK and activates the NF-κB pathway, which triggers the expression of pro-inflammatory cytokines [35], while obesity also activates the JNK and NF-κB signaling pathways [36]. NF-κB activation induces the activation of inflammatory signaling pathways, leading to insulin resistance and pancreatic β cell dysfunction [7,37], and also activates T cells, endothelial cells, and adipocytes [34]. However, there is an unknown interaction between bone and the immune system, which may lead to hepatic insulin resistance. RANKL can be used to link the interaction between immune activation, bone resorption, and obesity [34]. A previous study focusing on the epigenetic regulation of RANKL in obesity has reported that 73.86% of RANKL in the obesity group is unmethylated, while 80% RANKL in the non-obesity group is unmethylated. However, this study is retrospective and cannot determine the protein and gene expression levels of RANKL [36]. Our results suggested that obesity was related to the expression of the RANKL protein, RANKL mRNA, and RANK mRNA. Moreover, the expression of the RANKL protein in obesity patients was significantly higher than that in non-obesity patients. However, due to the large standard deviation and the small sample size, we shall further increase the sample size and conduct more in-depth research in the follow-up study. The expression of RANK mRNA in obesity patients was significantly higher than that in non-obesity patients, suggesting that RANK/RANKL/OPG was involved in the occurrence and development of overweight and obesity. Our findings may provide novel candidate genes and therapeutic targets for the management of obesity.
After the study, it was found that the expression of the RANKL protein in obese patients was significantly higher than that in non-obese patients, which was novel. Moreover, due to the large standard deviation and small sample size, we further increased the sample size and conducted more in-depth research in the follow-up study, so as to obtain the most complete conclusions and detailed results. To further clarify the relationship between the abdominal circumference of elderly obese patients and the expression of the RANKL protein, RANKL protein, gene, and OPG protein in white blood cells, and verify the influence of RANKL and RANKL proteins on obesity, a more careful thinking network was created. A thorough analysis suggested that RANK/RANKL/OPG participates in the occurrence and development of overweight and obesity. Our findings may provide new candidate genes and therapeutic targets for the treatment of obesity.
In conclusion, the RANK/RANKL/OPG system plays a vital role in the occurrence and development of obesity. Nowadays, there is an accumulating in-depth research on obesity due to the increasing global prevalence of obesity. The exploration of signaling pathways, cytokines, immune responses, and epigenetic modifications related to obesity is essential for disease outcome and treatment development. The RANK/RANKL/OPG system may be a promising target for obesity treatment.
-
Funding information: This work was sponsored in part by the Scientific Research Project of People’s Hospital of Xinjiang Uygur Autonomous Region (No. 20190102) and Natural Science Foundation of Xinjiang Uygur Autonomous Region (No. 2021D01C198).
-
Author contributions: Jinling Liu, conceptual conception and design; Wenwen Xiao, experimental scheme; Buluhan Halan, thesis writing and construction of the thesis framework; Aishanjiang Wumaer and Zhuoya Maimaitiwusiman, focused on the method development and optimized the experimental process in combination with research objectives; Saiyare Xuekelati and Tajiguli Musha, statistical analysis of data; and Xue Bai and Hongmei Wang, comprehensively reviewed and revised the paper.
-
Conflict of interest: The authors declare that they have no competing interests.
-
Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Akram DS, Astrup AV, Atinmo T, Boissin JL, Bray GA, Carroll KK, et al. WHO. Obesity: Preventing and managing the global epidemic: Report of a WHO consultation. Technical Report Series 894. 2000;110(62):301–15.Search in Google Scholar
[2] Jensen MD, Ryan DH, Apovian CM, Ard JD, Comuzzie AG, Donato KA, et al. 2013 AHA/ACC/TOS guideline for the management of overweight and obesity in adults: A report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines and The Obesity Society. Circulation. 2014;129(25 suppl 2):S102–38.10.1161/01.cir.0000437739.71477.eeSearch in Google Scholar PubMed
[3] World Health Organization. WHO discussion paper: Draft recommendations for the prevention and management of obesity over the life course, including potential targets. Technical Document, 17 August 2021.Search in Google Scholar
[4] Kopelman PG. Obesity as a medical problem. Nature. 2000;404(6778):635–43.10.1038/35007508Search in Google Scholar PubMed
[5] Nutrition and Metabolic Management Branch of China International Exchange and Promotive Association for Medical and Health Care, Clinical Nutrition Branch of Chinese Nutrition Society, Chinese Diabetes Society, Chinese Society for Parenteral and Enteral Nutrition, Chinese Clinical Nutritionist Center of Chinese Medical Doctor Association. Guidelines for medical nutrition treatment of overweight/obesity in China (2021). Chin J Front Med Sci (Electron Version). 2021;13(11):1–55.Search in Google Scholar
[6] Yanovski SZ, Yanovski JA. Progress in pharmacotherapy for obesity. JAMA. 2021;326(2):129–30.10.1001/jama.2021.9486Search in Google Scholar PubMed PubMed Central
[7] Kiechl S, Wittmann J, Giaccari A, Knoflach M, Willeit P, Bozec A, et al. Blockade of receptor activator of nuclear factor-κB (RANKL) signaling improves hepatic insulin resistance and prevents development of diabetes mellitus. Nat Med. 2013;19(3):358–63.10.1038/nm.3084Search in Google Scholar PubMed
[8] Wilson C. Diabetes: Blocking RANKL signaling might prevent T2DM. Nat Rev Endocrinol. 2013;9(4):188.10.1038/nrendo.2013.43Search in Google Scholar PubMed
[9] Bilgir O, Yavuz M, Bilgir F, Akan OY, Bayindir AG, Calan M, et al. Relationship between insulin resistance, hs-CRP, and body fat and serum osteoprotegerin/RANKL in prediabetic patients. Minerva Endocrinol. 2018;43(1):19–26.10.23736/S0391-1977.17.02544-5Search in Google Scholar PubMed
[10] Duan P, Yang M, Wei M, Liu J, Tu P. Serum osteoprotegerin is a potential biomarker of insulin resistance in chinese postmenopausal women with prediabetes and type 2 diabetes. Int J Endocrinol. 2017;2017:8724869.10.1155/2017/8724869Search in Google Scholar PubMed PubMed Central
[11] Luo XH. Mechanism of osteoprotegerin regulating hepatic triglyceride metabolism. PhD thesis. Chongqing: Chongqing Medical University; 2017. Vol. 2017, p. 6654121.Search in Google Scholar
[12] Toffoli B, Fabris B, Bartelloni G, Bossi F, Bernardi S. Dyslipidemia and diabetes increase the OPG/TRAIL ratio in the cardiovascular system. Mediators Inflamm. 2016;2016:6529728.10.1155/2016/6529728Search in Google Scholar PubMed PubMed Central
[13] Harper E, Forde H, Davenport C, Rochfort KD, Smith D, Cummins PM. Vascular calcification in type-2 diabetes and cardiovascular disease: Integrative roles for OPG, RANKL, and TRAIL. Vasc Pharmacol. 2016;82:30–40.10.1016/j.vph.2016.02.003Search in Google Scholar PubMed
[14] Garcia-Hernandez A, Arzate H, Gil-Chavarria I, Rojo R, Moreno-Fierros L. High glucose concentrations alter the biomineralization process in human osteoblastic cells. Bone. 2012;50(1):276–88.10.1016/j.bone.2011.10.032Search in Google Scholar PubMed
[15] Duan P, Tu P, Si L, Hu W, Liu M, Liu J, et al. Gene polymorphisms in the RANKL/RANK/OPG pathway are associated with type 2 diabetes mellitus in Southern Han Chinese women. Genet Test Mol Biomarkers. 2016;20(6):285–90.10.1089/gtmb.2015.0306Search in Google Scholar PubMed
[16] Siage S, Li YJ, Bai X, Xiang H, Wang HM. Study on the relationship between the methylation of RANK gene and the obesity of Han, Uygur and Kazak olderly men in Xinjiang. J Med Res. 2019;48(9):99–102.Search in Google Scholar
[17] Committee for the Revision of Guidelines for Prevention and Treatment of Hypertension in China, Hypertension Alliance, Chinese Society of Cardiovascular Diseases of Chinese Medical Association, and Hypertension Professional Committee, Hypertension Branch of China International Exchange and Promotive Association for Medical and Health Care, Hypertension Branch of the Chinese Geriatric Association. Guidelines for prevention and treatment of hypertension in China (revised in 2018). Chin J Cardiovasc Med. 2019;24(1):24–56.Search in Google Scholar
[18] Chinese Diabetes Society. Guidelines for prevention and treatment of type 2 diabetes in China (2017 Edition). Chin J Pract Intern Med. 2018;38(4):292–344.Search in Google Scholar
[19] China Adult Dyslipidemia Prevention and Control Guide Revision Joint Committee. Guidelines for prevention and treatment of dyslipidemia in Chinese adults (revised in 2016). Chin J Health Manag. 2017;11(1):7–28.Search in Google Scholar
[20] Wang BB, Chen CR, Lu GL, Tian GH. The present situation, problems, and countermeasures of home-based olderly care service in China. Chin J Gerontol. 2020;40(17):3792–5.Search in Google Scholar
[21] Qi SG, Wang ZH, Li ZX, Wang LM, Zhang M, Zen XY. Epidemiological characteristics of obesity among the olderly in China and population attribution analysis of its relationship with five chronic diseases. Chin J Geriatr. 2018;37(8):919–23.Search in Google Scholar
[22] Wang NN, Bai YL. Research progress of chronic inflammation mechanism related to obesity. Chin Gen Med. 2017;20(12):1527–30.Search in Google Scholar
[23] Ouchi N, Parker JL, Lugus JJ, Walsh K. Adipokines in inflammation and metabolic disease. Nat Rev Immunol. 2011;11(2):85–97.10.1038/nri2921Search in Google Scholar PubMed PubMed Central
[24] Galic S, Oakhill JS, Steinberg GR. Adipose tissue as an endocrine organ. Mol Cell Endocrinol. 2010;316(2):129–39.10.1016/j.mce.2009.08.018Search in Google Scholar PubMed
[25] Kawai T, Autieri MV, Scalia R. Adipose tissue inflammation and metabolic dysfunction in obesity. Am J Physiol-Cell Physiol. 2021;320(3):C375–91.10.1152/ajpcell.00379.2020Search in Google Scholar PubMed PubMed Central
[26] Su X, Zhang G, Cheng Y, Wang B. Leptin in skin disease modulation. Clinica Chim Acta. 2021;516:8–14.10.1016/j.cca.2021.01.013Search in Google Scholar PubMed
[27] Kunz HE, Hart CR, Gries KJ, Parvizi M, Laurenti M, Dalla Man C, et al. Adipose tissue macrophage populations and inflammation are associated with systemic inflammation and insulin resistance in obesity. Am J Physiol-Endocrinol Metab. 2021;321(1):E105–21.10.1152/ajpendo.00070.2021Search in Google Scholar PubMed PubMed Central
[28] Sparling DP, McCullough N, Pajvani U, Humphrey MB. Inhibition of γ-secretase in adipocytes leads to altered IL-6 secretion and adipose inflammation. Adipocyte. 2020;9(1):325–34.10.1080/21623945.2020.1788235Search in Google Scholar PubMed PubMed Central
[29] Hoffmann A, Ebert T, Klöting N, Kolb M, Gericke M, Jeromin F, et al. Leptin decreases circulating inflammatory IL-6 and MCP-1 in mice. Biofactors. 2019;45(1):43–8.10.1002/biof.1457Search in Google Scholar PubMed
[30] Ren XY, Yan S. Research progress of tumor necrosis factor superfamily in obesity. J Med Postgrad. 2021;34(11):1217–22.Search in Google Scholar
[31] López Gómez JJ, Castrillón JLP, Bobillo ER, de Luis Román DA. Effect of dietary treatment of obesity on bone metabolism. Nutricion Hospitalaria. 2016;33(6):1452–60.10.20960/nh.809Search in Google Scholar PubMed
[32] Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM. Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J Clin Invest. 1995;95(5):2409–15.10.1172/JCI117936Search in Google Scholar PubMed PubMed Central
[33] Zou C, Sun XP, Fu BB. Research progress of osteoprotegerin. Heilongjiang Med J. 2020;33(6):1274–7.Search in Google Scholar
[34] Chen XX, Yang T. Roles of leptin in bone metabolism and bone diseases. J Bone Miner Metab. 2015;33(5):474–85.10.1007/s00774-014-0569-7Search in Google Scholar PubMed
[35] Lopomo A, Burgio E, Migliore L. Epigenetics of obesity. Prog Mol Biol Transl Sci. 2016;140:151–84.10.1016/bs.pmbts.2016.02.002Search in Google Scholar PubMed
[36] Sharma M, Vikram NK, Misra A, Bhatt SP, Tarique M, Parray HA, et al. Assessment of 11-β hydroxysteroid dehydrogenase (11-βHSD1) 4478T > G and tumor necrosis factor-α (TNF-α)-308G > A polymorphisms with obesity and insulin resistance in Asian Indians in North India. Mol Biol Rep. 2013;40(11):6261–70.10.1007/s11033-013-2738-5Search in Google Scholar PubMed
[37] Shoelson SE, Herrero L, Naaz A. Obesity, inflammation, and insulin resistance. Gastroenterology. 2007;132:2169–80.10.1053/j.gastro.2007.03.059Search in Google Scholar PubMed
© 2025 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Research Articles
- Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
- Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
- Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
- Risk factors for severe adverse drug reactions in hospitalized patients
- Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
- Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
- CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
- Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
- Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
- Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
- Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
- Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
- Association between statin administration and outcome in patients with sepsis: A retrospective study
- Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
- A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
- Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
- Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
- Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
- Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
- Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
- The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
- Health literacy and health-related quality of life: The mediating role of irrational happiness
- Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
- Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
- Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
- Clinical analysis of ten cases of HIV infection combined with acute leukemia
- Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
- Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
- Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
- Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
- Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
- The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
- The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
- Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
- Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
- Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
- The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
- Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
- A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
- A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
- Identifying early screening factors for depression in middle-aged and older adults: A cohort study
- Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
- Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
- High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
- RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
- Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
- Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
- The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
- Expression and clinical significance of ITGA3 in breast cancer
- Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
- rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
- Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
- Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
- Gender beliefs and legitimization of dating violence in adolescents
- Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
- Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
- Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
- Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
- Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
- Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
- GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
- Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
- MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
- Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
- Trends in research on preterm birth in twin pregnancy based on bibliometrics
- Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
- Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
- Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
- Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
- Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
- CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
- Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
- Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
- Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
- Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
- Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
- Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
- Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
- The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
- The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
- Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
- Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
- The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
- Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
- Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
- Correlation of serum calprotectin with outcome of acute cerebral infarction
- Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
- Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
- The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
- Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
- Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
- Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
- Analysis of serum metabolomics in patients with different types of chronic heart failure
- Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
- Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
- Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
- METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
- The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
- Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
- Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
- Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
- Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
- Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
- Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
- Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
- Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
- Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
- Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
- Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
- HALP score in Demodex blepharitis: A case–control study
- Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
- Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
- Comparison of the two intestinal anastomosis methods in pediatric patients
- Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
- Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
- Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
- Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
- Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
- Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
- Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
- Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
- A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
- Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
- FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
- Association of placenta weight and morphology with term low birth weight: A case–control study
- Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
- Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
- TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
- Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
- Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
- Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
- Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
- H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
- Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
- Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
- Motivational interviewing for alcohol use reduction in Thai patients
- Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
- Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
- Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
- CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
- Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
- The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
- OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
- The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
- Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
- Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
- Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
- Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
- The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
- Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
- Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
- Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
- Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
- Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
- Influence of sevoflurane combined with propofol anesthesia on the anesthesia effect and adverse reactions in children with acute appendicitis
- Identification of hub genes related to acute kidney injury caused by sevoflurane anesthesia and endoplasmic reticulum stress
- Efficacy and safety of PD-1/PD-L1 inhibitors in pancreatic ductal adenocarcinoma: a systematic review and Meta-analysis of randomized controlled trials
- The value of diagnostic experience in O-RADS MRI score for ovarian-adnexal lesions
- Health education pathway for individuals with temporary enterostomies using patient journey mapping
- Serum TLR8 as a potential diagnostic biomarker of coronary heart disease
- Intraoperative temperature management and its effect on surgical outcomes in elderly patients undergoing lichtenstein unilateral inguinal hernia repair
- Immunohistochemical profiling and neuroepithelial heterogeneity in immature ovarian teratomas: a retrospective digital pathology-based study
- Associated risk factors and prevalence of human papillomavirus infection among females visiting tertiary care hospital: a cross-sectional study from Nepal
- Comparative evaluation of various disc elution methods for the detection of colistin-resistant gram-negative bacteria
- Effect of timing of cholecystectomy on weight loss after sleeve gastrectomy in morbidly obese individuals with cholelithiasis: a retrospective cohort study
- Causal association between ceramide levels and central precocious puberty: a mendelian randomization study
- Novel predictive model for colorectal liver metastases recurrence: a radiomics and clinical data approach
- Relationship between resident physicians’ perceived professional value and exposure to violence
- Multiple sclerosis and type 1 diabetes: a Mendelian randomization study of European ancestry
- Rapid pathogen identification in peritoneal dialysis effluent by MALDI-TOF MS following blood culture enrichment
- Comparison of open and percutaneous A1 pulley release in pediatric trigger thumb: a retrospective cohort study
- Impact of combined diaphragm-lung ultrasound assessment on postoperative respiratory function in patients under general anesthesia recovery
- Development and internal validation of a nomogram for predicting short-term prognosis in ICU patients with acute pyelonephritis
- The association between hypoxic burden and blood pressure in patients with obstructive sleep apnea
- Promotion of asthenozoospermia by C9orf72 through suppression of spermatogonia activity via fructose metabolism and mitophagy
- Review Articles
- The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
- Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
- Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
- Review of mechanisms and frontier applications in IL-17A-induced hypertension
- Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
- The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
- The application of augmented reality in robotic general surgery: A mini-review
- The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
- Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
- Plant polyphenols, terpenes, and terpenoids in oral health
- Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
- End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
- The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
- Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
- PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
- Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
- Giant borderline ovarian tumours – review of the literature
- Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
- Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
- Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
- Supplement strategies for infertility in overweight women: Evidence and legal insights
- Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
- A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
- Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
- Strategies for hyperkalemia management in dialysis patients: A systematic review
- C-reactive protein-to-albumin ratio in peripheral artery disease
- Research progress on autophagy and its roles in sepsis induced organ injury
- Neuronutrition in autism spectrum disorders
- Pumilio 2 in neural development, function, and specific neurological disorders
- Antibiotic prescribing patterns in general dental practice- a scoping review
- Clinical and medico-legal reflections on non-invasive prenatal testing
- Smartphone use and back pain: a narrative review of postural pathologies
- Targeting endothelial oxidative stress in hypertension
- Exploring links between acne and metabolic syndrome: a narrative review
- Case Reports
- Delayed graft function after renal transplantation
- Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
- Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
- Giant right atrial hemangioma presenting with ascites: A case report
- Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
- EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
- Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
- Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
- Combined VAT and retroperitoneoscopy for pleural empyema due to nephro-pleuric fistula in xanthogranulomatous pyelonephritis
- A rare case of Opalski syndrome with a suspected multiple sclerosis etiology
- Newly diagnosed B-cell acute lymphoblastic leukemia demonstrating localized bone marrow infiltration exclusively in the lower extremities
- Rapid Communication
- Biological properties of valve materials using RGD and EC
-
A single oral administration of flavanols enhances short
-term memory in mice along with increased brain-derived neurotrophic factor - Repeat influenza incidence across two consecutive influenza seasons
- Letter to the Editor
- Role of enhanced external counterpulsation in long COVID
- Expression of Concern
- Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
- Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
- Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
- Corrigendum
- Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
- Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
- Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
- Retraction
- Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
- Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
- Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
- Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
- Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
- Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
- The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
- Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
- Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
- Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
- Special Issue The evolving saga of RNAs from bench to bedside - Part III
- Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
- The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
- Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
- Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
- A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
- Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
- Special Issue Diabetes mellitus: pathophysiology, complications & treatment
- Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
- Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
- A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
- A review of brain research on T2DM-related cognitive dysfunction
- Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
- Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
- CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
Articles in the same Issue
- Research Articles
- Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
- Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
- Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
- Risk factors for severe adverse drug reactions in hospitalized patients
- Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
- Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
- CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
- Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
- Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
- Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
- Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
- Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
- Association between statin administration and outcome in patients with sepsis: A retrospective study
- Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
- A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
- Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
- Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
- Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
- Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
- Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
- The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
- Health literacy and health-related quality of life: The mediating role of irrational happiness
- Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
- Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
- Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
- Clinical analysis of ten cases of HIV infection combined with acute leukemia
- Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
- Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
- Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
- Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
- Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
- The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
- The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
- Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
- Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
- Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
- The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
- Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
- A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
- A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
- Identifying early screening factors for depression in middle-aged and older adults: A cohort study
- Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
- Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
- High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
- RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
- Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
- Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
- The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
- Expression and clinical significance of ITGA3 in breast cancer
- Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
- rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
- Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
- Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
- Gender beliefs and legitimization of dating violence in adolescents
- Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
- Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
- Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
- Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
- Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
- Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
- GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
- Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
- MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
- Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
- Trends in research on preterm birth in twin pregnancy based on bibliometrics
- Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
- Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
- Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
- Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
- Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
- CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
- Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
- Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
- Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
- Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
- Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
- Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
- Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
- The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
- The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
- Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
- Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
- The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
- Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
- Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
- Correlation of serum calprotectin with outcome of acute cerebral infarction
- Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
- Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
- The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
- Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
- Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
- Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
- Analysis of serum metabolomics in patients with different types of chronic heart failure
- Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
- Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
- Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
- METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
- The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
- Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
- Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
- Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
- Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
- Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
- Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
- Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
- Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
- Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
- Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
- Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
- HALP score in Demodex blepharitis: A case–control study
- Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
- Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
- Comparison of the two intestinal anastomosis methods in pediatric patients
- Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
- Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
- Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
- Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
- Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
- Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
- Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
- Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
- A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
- Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
- FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
- Association of placenta weight and morphology with term low birth weight: A case–control study
- Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
- Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
- TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
- Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
- Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
- Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
- Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
- H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
- Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
- Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
- Motivational interviewing for alcohol use reduction in Thai patients
- Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
- Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
- Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
- CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
- Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
- The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
- OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
- The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
- Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
- Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
- Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
- Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
- The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
- Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
- Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
- Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
- Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
- Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
- Influence of sevoflurane combined with propofol anesthesia on the anesthesia effect and adverse reactions in children with acute appendicitis
- Identification of hub genes related to acute kidney injury caused by sevoflurane anesthesia and endoplasmic reticulum stress
- Efficacy and safety of PD-1/PD-L1 inhibitors in pancreatic ductal adenocarcinoma: a systematic review and Meta-analysis of randomized controlled trials
- The value of diagnostic experience in O-RADS MRI score for ovarian-adnexal lesions
- Health education pathway for individuals with temporary enterostomies using patient journey mapping
- Serum TLR8 as a potential diagnostic biomarker of coronary heart disease
- Intraoperative temperature management and its effect on surgical outcomes in elderly patients undergoing lichtenstein unilateral inguinal hernia repair
- Immunohistochemical profiling and neuroepithelial heterogeneity in immature ovarian teratomas: a retrospective digital pathology-based study
- Associated risk factors and prevalence of human papillomavirus infection among females visiting tertiary care hospital: a cross-sectional study from Nepal
- Comparative evaluation of various disc elution methods for the detection of colistin-resistant gram-negative bacteria
- Effect of timing of cholecystectomy on weight loss after sleeve gastrectomy in morbidly obese individuals with cholelithiasis: a retrospective cohort study
- Causal association between ceramide levels and central precocious puberty: a mendelian randomization study
- Novel predictive model for colorectal liver metastases recurrence: a radiomics and clinical data approach
- Relationship between resident physicians’ perceived professional value and exposure to violence
- Multiple sclerosis and type 1 diabetes: a Mendelian randomization study of European ancestry
- Rapid pathogen identification in peritoneal dialysis effluent by MALDI-TOF MS following blood culture enrichment
- Comparison of open and percutaneous A1 pulley release in pediatric trigger thumb: a retrospective cohort study
- Impact of combined diaphragm-lung ultrasound assessment on postoperative respiratory function in patients under general anesthesia recovery
- Development and internal validation of a nomogram for predicting short-term prognosis in ICU patients with acute pyelonephritis
- The association between hypoxic burden and blood pressure in patients with obstructive sleep apnea
- Promotion of asthenozoospermia by C9orf72 through suppression of spermatogonia activity via fructose metabolism and mitophagy
- Review Articles
- The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
- Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
- Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
- Review of mechanisms and frontier applications in IL-17A-induced hypertension
- Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
- The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
- The application of augmented reality in robotic general surgery: A mini-review
- The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
- Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
- Plant polyphenols, terpenes, and terpenoids in oral health
- Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
- End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
- The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
- Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
- PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
- Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
- Giant borderline ovarian tumours – review of the literature
- Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
- Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
- Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
- Supplement strategies for infertility in overweight women: Evidence and legal insights
- Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
- A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
- Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
- Strategies for hyperkalemia management in dialysis patients: A systematic review
- C-reactive protein-to-albumin ratio in peripheral artery disease
- Research progress on autophagy and its roles in sepsis induced organ injury
- Neuronutrition in autism spectrum disorders
- Pumilio 2 in neural development, function, and specific neurological disorders
- Antibiotic prescribing patterns in general dental practice- a scoping review
- Clinical and medico-legal reflections on non-invasive prenatal testing
- Smartphone use and back pain: a narrative review of postural pathologies
- Targeting endothelial oxidative stress in hypertension
- Exploring links between acne and metabolic syndrome: a narrative review
- Case Reports
- Delayed graft function after renal transplantation
- Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
- Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
- Giant right atrial hemangioma presenting with ascites: A case report
- Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
- EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
- Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
- Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
- Combined VAT and retroperitoneoscopy for pleural empyema due to nephro-pleuric fistula in xanthogranulomatous pyelonephritis
- A rare case of Opalski syndrome with a suspected multiple sclerosis etiology
- Newly diagnosed B-cell acute lymphoblastic leukemia demonstrating localized bone marrow infiltration exclusively in the lower extremities
- Rapid Communication
- Biological properties of valve materials using RGD and EC
-
A single oral administration of flavanols enhances short
-term memory in mice along with increased brain-derived neurotrophic factor - Repeat influenza incidence across two consecutive influenza seasons
- Letter to the Editor
- Role of enhanced external counterpulsation in long COVID
- Expression of Concern
- Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
- Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
- Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
- Corrigendum
- Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
- Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
- Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
- Retraction
- Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
- Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
- Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
- Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
- Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
- Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
- The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
- Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
- Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
- Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
- Special Issue The evolving saga of RNAs from bench to bedside - Part III
- Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
- The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
- Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
- Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
- A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
- Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
- Special Issue Diabetes mellitus: pathophysiology, complications & treatment
- Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
- Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
- A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
- A review of brain research on T2DM-related cognitive dysfunction
- Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
- Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
- CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms