Home Medicine The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
Article Open Access

The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma

  • Xiaoju Wang , Yuxin Zhang , Yiqing Wang , Lei Shi , Caiqin Yuan , Wei Yin , Yaoshu Teng , Jing Li and Yanjiao Mao EMAIL logo
Published/Copyright: March 11, 2025
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 20 Issue 1

Abstract

Background

Epithelial–mesenchymal transition (EMT) and circulating tumor cells (CTCs) are key prognostic factors in nasopharyngeal carcinoma (NPC). However, the role of EMT status in CTCs for predicting outcomes in advanced NPC treated with radiotherapy after induction chemotherapy remains unclear.

Methods

A total of 143 CTC tests from 95 advanced/metastatic NPC patients were analyzed before, during, and after radiotherapy, with a 60-month follow-up. CTC count, matrix metalloproteinase 2 (MMP2)) protein expression, and EMT subtypes were examined.

Results

During radiotherapy, CTC counts increase but decrease afterward. Patients with higher pre-radiotherapy tumor-node-metastasis (TNM) stages have lower total and M-subtype CTC counts. Higher T and TNM stages during radiotherapy correlate with increased EMT-state CTCs, especially hybrid CTCs. EA/IgG-positive patients have a higher number of hybrid CTCs and E-type (epithelial + hybrid) CTCs, while EBV-EA-negative patients have more mesenchymal CTCs. A higher post-radiotherapy CTC count predicts relapse, and the positive rate of MMP2 expression on hybrid and epithelial CTCs is higher than that on mesenchymal CTCs.

Conclusion

EMT status, particularly in hybrid CTCs, is a potential prognostic marker for relapse in advanced NPC after radiotherapy.

Keywords: epithelial–mesenchymal transition; circulating tumor cells; nasopharyngeal carcinoma; MMP2; prognostic value

1 Introduction

Nasopharyngeal carcinoma (NPC) is a malignant tumor that occurs in the nasopharyngeal area of the upper respiratory tract [1]. Due to its unique geographical distribution, distinct pathological types, and close association with the Epstein-Barr Virus (EBV), NPC has become a unique and important field in the study of head and neck tumors [2,3]. NPC in a stable, non-progressive stage is typically manageable, largely owing to its positive response to both radiotherapy and chemotherapy [4]. On the other hand, NPC that is progressing tends to aggressively metastasize to cervical lymph nodes and other organs. The presence of metastatic disease is a marker of treatment failure and is associated with a poor prognosis in NPC patients [5,6]. Distant metastasis is the leading cause of cancer-related death in patients with NPC, and the median overall survival (OS) of NPC patients with recurrent or primary metastatic disease is 20 months [7].

Circulating tumor cells (CTCs) are often regarded as the precursors of metastasis, originating from the release of cancer cells into the bloodstream from primary and secondary tumors [8,9]. Identifying these scarce CTCs in the bloodstream opens up promising prospects for the early and sensitive detection of metastatic cancer cells. The effectiveness of CTCs in assessing treatment response and predicting outcomes has been established in a range of metastatic cancers [10,11]. The process of enhancing and isolating these infrequent CTCs in the blood has seen significant advancements, paving the way for the innovative use of blood-based cancer diagnostics to actively monitor the progression of cancer and the response to treatment in real-time. Ou and his colleagues reported that CTCs could be an independent prognostic value for advanced NPC [12]. CTCs exhibit a high degree of heterogeneity, particularly as they undergo the epithelial–mesenchymal transition (EMT) process [13,14]. During EMT, tumor cells undergo a transformation where they shed their epithelial attributes, such as robust adhesion to neighboring cells and the basal membrane. Concurrently, they acquire more aggressive traits, including enhanced motility, the capacity to break down the extracellular matrix (ECM), and characteristics akin to stem cells [15].

The ECM plays a crucial role in providing biochemical support to adjacent cells and modulating the microenvironmental changes that occur during tumor development [16]. Matrix metalloproteinases (MMPs), also known as matrixins, comprise a group of endopeptidases that are dependent on calcium and contain zinc. These enzymes are key in the remodeling of the ECM, as they regulate the breakdown of ECM components, including the connective tissue matrices [17]. Within the MMP family, MMP2 is recognized as a crucial contributor to the progression of metastasis including NPC. For example, MMP2 has been proven to play a functional role in promoting cell migration and invasion in NPC through Capn4 mediation [18].

Although the prognostic role of CTCs in NPC has been clarified, the relationship between different EMT states of CTCs, their expression of MMP2, and the prognosis of patients with advanced NPC has not yet been thoroughly investigated. In this study, we explored the relationship between different EMT states of CTCs and the prognosis of patients with advanced NPC undergoing radiotherapy, and further investigated the gene expression distribution of MMP2 in CTCs across different EMT states.

2 Methods

2.1 Patient enrollment

This study included 95 patients with advanced progressive NPC treated at the Hangzhou Cancer Hospital. The patient recruitment criteria were as follows: (1) aged between 18 and 80 years, and had not received intravenous chemotherapy at the time of enrollment; (2) expected survival time of at least 3 months; (3) normal liver and kidney function; (4) no planned surgeries within 6 months after the start of the trial; and (5) other organ tumors excluded by imaging findings. Clinical and laboratory characteristics of all the patients, including original lesion diameter, status of lymph node metastasis, tumor-node-metastasis (TNM) stage, EBV serology, cancer recurrence status, etc., were collected.

2.2 Isolation and detection of CTCs

CTC analysis was performed using the CanPatrol CTC enrichment system and in situ hybridization (ISH) technology before, during, and after chemotherapy. Peripheral blood samples were collected (5 mL, treated with ethylenediaminetetraacetic acid as an anticoagulant) after the initial 2 mL of blood was discarded. A lysis buffer specifically designed for red blood cells was employed to eliminate these cells, followed by a resuspension in phosphate-buffered saline containing 4% formaldehyde (Sigma, St Louis, MO, USA) for a duration of 5 min prior to the filtration process. The isolation of CTCs was accomplished through the use of the CanPatrol CTC enrichment system, which incorporates a filtration tube equipped with a membrane featuring pores of 8 μm in diameter (Sur Exam, Guangzhou, China), along with a vacuum plate manifold that includes a valve adjustment (SurExam, Guangzhou, China), an E-Z96 vacuum manifold (Omega, Norcross, GA, USA), and a vacuum pump (Auto Science, Tianjin, China). The RNA ISH method was utilized to detect and analyze the expression levels of epithelial and mesenchymal genes within the CTCs, employing three different types of nucleic acid probes. The targets for detection encompassed CD45, EPCAM, CK8/18/19 (markers for epithelial cells), VIMENTIN, and TWIST (markers for mesenchymal cells). The sequences used for RNA ISH are as follows:

EPCAM: TGGTGCTCGTTGATGAGTCAAGCCAGCTTTGAGCAAATGAAAAGCCCATCATTGTTCTGGCTCTCATCGCAGTCAGGATCTCCTTGTCTGTTCTTCTGACCTCAGAGCAGGTTATTTCAG;

CK8: CGTACCTTGTCTATGAAGGAACTTGGTCTCCAGCATCTTGCCTAAGGTTGTTGATGTAGCCTGAGGAAGTTGATCTCGTCCAGATGTGTCCGAGATCTGGTGACCTCAGCAATGATGCTG;

CK18: AGAAAGGACAGGACTCAGGCGAGTGGTGAAGCTCATGCTGTCAGGTCCTCGATGATCTTGCAATCTGCAGAACGATGCGGAAGTCATCAGCAGCAAGACGCTGCAGTCGTGTGATATTGG;

CK19: CTGTAGGAAGTCATGGCGAGAAGTCATCTGCAGCCAGACGCTGTTCCGTCTCAAACTTGGTTCTTCTTCAGGTAGGCCAGCTCAGCGTACTGATTTCCTCGTGAACCAGGCTTCAGCATC;

VIMENTIN: GAGCGAGAGTGGCAGAGGACCTTTGTCGTTGGTTAGCTGGCATATTGCTGACGTACGTCAGAGCGCCCCTAAGTTTTTAAAAGATTGCAGGGTGTTTTCGGGCCAATAGTGTCTTGGTAG;

TWIST: ACAATGACATCTAGGTCTCCCTGGTAGAGGAAGTCGATGTCAACTGTTCAGACTTCTATCCCTCTTGAGAATGCATGCATTTTCAGTGGGCTGATTGGCACTTACCATGGGTCCTCAATAA;

CD45: TCGCAATTCTTATGCGACTCTGTCATGGAGACAGTCATGTGTATTTCCAGCTTCAACTTCCCATCAATATAGCTGGCATTTTGTGCAGCAATGTATTTCCTACTTGAACCATCAGGCATC.

MMP2: CAACTCTTTGTCCGTTTTGGAAGGTGTTCAGGTATTGCACCAAACAGGTTGCAGCTCTCCTTCTTTAGTGTGTCCTTCAGCAGTCCAAAGAACTTCTGCAGGTCAAGATCACCTGTCTGGCGCATGGTCTCGATGGTATTGTTGTAGGCCACATCTG

Based on the gene expression levels observed, CTCs were classified into mesenchymal CTCs, epithelial CTCs, and hybrid CTCs, with the latter exhibiting fluorescence indicative of both epithelial and mesenchymal gene expressions. Moreover, to evaluate the expression of MMP2 in CTCs, we utilized immunohistochemistry for detection (Invitrogen, 1:1,000, Catalog # 35-1300Z).

2.3 Statistical analysis

Chi-square tests or Spearman correlation were used to analyze the association between CTCs and clinical pathological characteristics. Univariate variance analysis was employed to compare CTC counts at different time points of radiotherapy in NPC patients. A P-value of <0.05 was considered statistically significant. All statistical analyses were performed using SPSS software version 25.0.

  1. Consent to participate: Written informed consent was obtained from individual or guardian participants.

  2. Ethical approval: The experimental protocol was established, according to the ethical guidelines of the Helsinki Declaration and was approved by the Human Ethics Committee of the Hangzhou Cancer Hospital (Ethics Approval Number: HZCH-2022).

3 Results

3.1 Differences in CTC detection during different radiotherapy treatment periods

We analyzed the changes in CTC counts and their subtypes during different phases of radiation therapy. The results showed that the detection rates of total CTCs before, during, and after radiation therapy were 91.7, 90.1, and 78.9%, respectively, with median total CTC counts of 4, 7, and 2. Compared to before radiation therapy, there was an increase in total CTC counts during treatment, followed by a decrease after the treatment (Table 1). Interestingly, mesenchymal-type CTCs showed the same trend in positivity rate and total CTC count, with rates before, during, and after radiation therapy of 54.2, 59.1, and 49.1%, respectively. However, there was no significant difference in the median values among the three time points in the statistical analysis (Table 1).

Table 1

Overview of CTC detection data at different clinical stages

Clinical stages Total number of CTCs Mesenchymal CTCs
Positivity rate (%) Median value Total range Positivity rate (%) Median value Quantity range
After induction chemotherapy, before radiotherapy (n = 24) 91.7 4 0–36 54.2 1 0–4
During radiotherapy (n = 44) 90.1 7 0–40 59.1 1 0–18
First time after radiotherapy (n = 57) 78.9 2 0–40 49.1 0 0–9

3.2 Correlation between tumor clinical features and the number and subtypes of CTCs detected at different times during radiotherapy

We classified CTCs into different EMT statuses based on the expression of epithelial and mesenchymal genes on the CTCs (Figure 1). To further analyze the relationship between CTCs and patient clinical characteristics, we conducted a correlation analysis of the total CTC count and CTC counts of different EMT statuses at various stages of radiotherapy with patient clinical features. These clinical features include tumor size, tumor T stage, the presence of lymph node metastasis, TNM staging, EBV capsid antigen (EBV-CA), EBV early antigen (EBV-EA), EBV-DNA, and whether NPC has recurred or progressed. Before radiotherapy in NPC patients, only the total count of CTCs was negatively correlated with the TNM staging of the patients, meaning that patients with a higher TNM stage had a lower total count of CTCs. No correlation was found between other indicators (Table 2). During radiotherapy in patients with NPC, the number and types of CTCs – including hybrid CTCs, epithelial-type CTCs (epithelial + hybrid), and mesenchymal-type CTCs (mesenchymal + hybrid)  – were positively correlated with the pre-treatment T stage and TNM stage. This means that patients with higher T stages and TNM stages had a greater number or individual types of CTCs; whereas, the count of mesenchymal-type CTCs was only positively correlated with the pre-treatment T stage (Table 3). The relationship between CTCs and EBV markers shows that EA/IgG is positively correlated with the number of hybrid CTCs and epithelial-type (epithelial + hybrid) CTCs at this time. Patients positive for EA/IgG have higher counts of these two types of CTCs; meanwhile, patients who are negative for EBV-EA are more likely to have a positive detection of mesenchymal-type CTCs (Table 3). After radiotherapy in patients with NPC, the total number and types of CTCs – including hybrid CTCs, epithelial-type CTCs (epithelial + hybrid), and mesenchymal-type CTCs (mesenchymal + hybrid) – are negatively correlated with progression, meaning that patients with higher counts or types of CTCs are more likely to experience a recurrence (Table 4).

Figure 1 Representative images of different types of CTCs. The epithelial CTCs had red fluorescence, the hybrid CTCs had both red and green fluorescence, and the mesenchymal CTCs had green fluorescence.
Figure 1

Representative images of different types of CTCs. The epithelial CTCs had red fluorescence, the hybrid CTCs had both red and green fluorescence, and the mesenchymal CTCs had green fluorescence.

Table 2

Relationship between CTCs and different clinical characteristics after induction chemotherapy and before radiotherapy

Spearman Rho Total number of CTCs Number of epithelial CTCs Number of hybrid CTCs Number of mesenchymal CTCs Total number of CTCs (<5/≥5) Number of epithelial-type CTCs Number of mesenchymal -type CTCs Mesenchymal CTCs (negative/positive)
Tumor size Correlation coefficient N = 19 0.103 −0.155 0.196 0.000 0.080 −0.031 0.062 0.164
P value 0.673 0.527 0.421 1.000 0.746 0.901 0.800 0.503
T stage (1–2/3–4) Correlation coefficient N = 23 0.027 −0.014 −0.035 −0.171 0.095 0.027 0.014 0.016
P value 0.902 0.950 0.873 0.435 0.666 0.903 0.951 0.944
Lymph node metastasis (N0/N+) Correlation coefficient N = 23 0.212 −0.048 0.147 −0.066 0.247 0.094 0.082 0.041
P value 0.332 0.830 0.504 0.765 0.255 0.671 0.710 0.854
TNM stage (1–2/3/4) Correlation coefficient N = 24 −0.408 −0.395 −0.243 −0.389 −0.422 −0.282 −0.452 −0.324
P value 0.048 0.056 0.252 0.060 0.040 0.182 0.027 0.123
EBV-CA (negative/positive) Correlation coefficient N = 21 0.000 −0.132 −0.059 −0.181 0.032 −0.084 −0.093 −0.085
P value 1.000 0.568 0.800 0.431 0.890 0.718 0.688 0.713
EBV-EA (negative/positive) Correlation coefficient N = 21 0.228 0.091 −0.147 0.080 0.085 0.269 0.033 −0.159
P value 0.320 0.695 0.526 0.732 0.714 0.238 0.888 0.491
EA/IgG (negative/positive) Correlation coefficient N = 7 0.612 0.412 −0.428 NA 0.471 0.618 0.408 −0.471
P value 0.144 0.358 0.338 NA 0.286 0.139 0.363 0.286
EBV-DNA (negative/positive) Correlation coefficient N = 17 0.113 −0.013 0.200 0.112 −0.044 0.000 0.152 0.044
P value 0.665 0.961 0.441 0.668 0.868 1.000 0.560 0.868
Disease recurrence/progression (yes/no) Correlation coefficient N = 19 0.010 0.184 0.259 0.094 0.131 0.060 0.151 0.288
P value 0.967 0.451 0.283 0.703 0.593 0.806 0.538 0.233
Table 3

Relationship between CTCs and different clinical characteristics during radiotherapy

Spearman Rho Total number of CTCs Number of epithelial CTCs Number of hybrid CTCs Number of mesenchymal CTCs Total number of CTCs (<5/≥5) Number of epithelial-type CTCs Number of mesenchymal -type CTCs Mesenchymal CTCs (negative/positive)
Tumor size Correlation coefficient N = 41 0.153 −0.139 0.191 −0.017 0.033 0.155 0.187 −0.082
P value 0.338 0.387 0.230 0.915 0.837 0.334 0.242 0.612
T stage (1–2/3–4) Correlation coefficient N = 42 0.303 −0.060 0.340 −0.023 0.303 0.324 0.310 −0.096
P value 0.051 0.707 0.028 0.887 0.051 0.036 0.046 0.544
Lymph node metastasis (N0/N+) Correlation coefficient N = 42 −0.004 −0.099 −0.004 0.080 0.000 0.008 −0.011 0.133
P value 0.981 0.531 0.981 0.616 1.000 0.962 0.942 0.400
TNM stage (1−2/3/4) Correlation coefficient N = 42 0.410 −0.232 0.449 0.335 0.304 0.346 0.490 0.300
P value 0.007 0.139 0.003 0.030 0.050 0.025 0.001 0.054
EBV-CA (negative/positive) Correlation coefficient N = 40 0.079 −0.144 0.093 −0.232 −0.191 0.090 0.057 −0.303
P value 0.629 0.375 0.570 0.150 0.238 0.582 0.726 0.057
EBV-EA (negative/positive) Correlation coefficient N = 40 −0.002 −0.123 −0.012 −0.247 −0.310 0.000 −0.028 −0.342
P value 0.988 0.449 0.942 0.125 0.052 1.000 0.862 0.031
EA/IgG (negative/positive) Correlation coefficient N = 22 0.315 0.187 0.545 0.066 0.239 0.438 0.396 0.174
P value 0.154 0.404 0.009 0.770 0.284 0.041 0.068 0.440
EBV-DNA (negative/positive) Correlation coefficient N = 37 −0.137 −0.037 −0.146 0.039 0.137 −0.143 −0.106 0.083
P value 0.418 0.826 0.388 0.820 0.420 0.398 0.533 0.625
Disease recurrence/progression (yes/no) Correlation coefficient N = 40 −0.214 0.028 −0.298 −0.094 −0.053 −0.268 −0.257 −0.118
P value 0.186 0.865 0.062 0.563 0.744 0.094 0.109 0.468
Table 4

Relationship between CTCs and different clinical characteristics first time after radiotherapy

Spearman Rho Total number of CTCs Number of epithelial CTCs Number of hybrid CTCs Number of mesenchymal CTCs Total number of CTCs (<5/≥5) Number of epithelial-type CTCs Number of mesenchymal -type CTCs Mesenchymal CTCs (negative/positive)
Tumor size Correlation coefficient N = 43 −0.012 −0.049 −0.048 −0.076 0.016 −0.024 −0.035 −0.137
P value 0.941 0.757 0.759 0.630 0.919 0.876 0.824 0.382
T stage (1–2/3–4) Correlation coefficient N = 54 −0.050 −0.017 −0.019 −0.047 −0.045 −0.022 −0.055 −0.116
P value 0.722 0.903 0.894 0.738 0.749 0.874 0.695 0.403
Lymph node metastasis (N0/N+) Correlation coefficient N = 55 0.022 −0.035 −0.008 0.034 −0.049 0.010 −0.016 0.058
P value 0.873 0.801 0.952 0.803 0.722 0.941 0.907 0.677
TNM stage (1–2/3/4) Correlation coefficient N = 55 0.192 0.222 0.208 0.061 0.064 0.286 0.124 0.193
P value 0.161 0.104 0.127 0.656 0.641 0.034 0.365 0.159
EBV-CA (negative/positive) Correlation coefficient N = 41 0.018 0.433 0.075 −0.056 0.040 0.154 −0.040 0.012
P value 0.909 0.005 0.639 0.730 0.806 0.338 0.806 0.941
EBV-EA (negative/positive) Correlation coefficient N = 41 −0.028 0.153 0.090 −0.041 −0.037 0.045 −0.013 0.020
P value 0.863 0.341 0.577 0.801 0.818 0.779 0.936 0.904
EA/IgG (negative/positive) Correlation coefficient N = 17 0.086 −0.100 0.165 0.051 0.070 0.062 0.099 0.029
P value 0.743 0.702 0.528 0.847 0.788 0.813 0.706 0.913
EBV-DNA (negative/positive) Correlation coefficient N = 36 0.210 0.123 0.000 0.281 0.235 0.054 0.179 0.278
P value 0.218 0.474 1.000 0.097 0.167 0.752 0.295 0.100
Disease recurrence/progression (yes/no) Correlation coefficient N = 27 −0.399 −0.117 0.433 −0.170 −0.317 −0.430 −0.401 −0.227
P value 0.039 0.562 0.024 0.396 0.107 0.025 0.038 0.256

3.3 Relationship between MMP2 protein expression on CTC and various clinical indicators of NPC

Because MMP2 plays an important role in the EMT state transition of CTCs, we conducted 62 CTC sample tests to explore the relationship between MMP2 protein expression in CTCs and various clinical indicators of NPC, mainly analyzing the relationship between the number of MMP2 + CTCs, the number of MMP2 + mesenchymal CTCs, and the clinical characteristics previously described. Compared to before radiotherapy, the positive rate of MMP2 + total CTCs in patients with NPC increased after receiving radiotherapy. However, the positive rate of MMP2 + mesenchymal CTCs decreased during radiotherapy and then rose back to pre-radiotherapy levels after the treatment was completed (Table 5). After induction chemotherapy, the MMP2 protein levels on CTCs before and after radiotherapy were unrelated to clinical pathological indicators. In patients undergoing radiotherapy, the positivity of EBV-EA showed a negative correlation with MMP2 protein expression on CTCs, indicating that patients who are positive for EBV-EA tend to have a lower MMP2 protein expression detected on their CTCs (Figure 2).

Table 5

Relationship between MMP2 expression on CTCs and different clinical characteristics

Spearman Rho MMP2+
Total number of CTCs Total number of CTCs (negative/positive)
Tumor size Correlation coefficient N = 27 −0.018 −0.058
P value 0.927 0.774
T stage (1–2/3–4) Correlation coefficient N = 27 0.015 0.045
P value 0.941 0.825
Lymph node metastasis (N0/N+) Correlation coefficient N = 27 −0.150 −0.053
P value 0.456 0.792
TNM stage (1–2/3/4) Correlation coefficient N = 27 0.075 0.039
P value 0.711 0.845
EBV-CA (negative/positive) Correlation coefficient N = 26 −0.135 −0.185
P value 0.511 0.365
EBV-EA (negative/positive) Correlation coefficient N = 26 −0.477 −0.409
P value 0.022 0.038
EA/IgG (negative/positive) Correlation coefficient N = 19 0.349 0.391
P value 0.144 0.098
EBV-DNA (negative/positive) Correlation coefficient N = 26 −0.329 −0.228
P value 0.100 0.262
Disease recurrence/progression (yes/no) Correlation coefficient N = 26 −0.249 −0.158
P value 0.220 0.440
Figure 2 Relationship between CTCs and different clinical characteristics in patients undergoing radiotherapy. Red indicates positive correlation and blue indicates negative correlation.
Figure 2

Relationship between CTCs and different clinical characteristics in patients undergoing radiotherapy. Red indicates positive correlation and blue indicates negative correlation.

3.4 Relationship between MMP2 protein expression on CTCs and their EMT status

Among all the CTC test results, there were 24 cases of epithelial-type CTCs expressing MMP2 protein and 77 cases without MMP2 expression; 132 cases of mesenchymal-type CTCs expressing MMP2 and 22 cases without MMP2 expression; and 296 cases of hybrid-type CTCs expressing MMP2 and 128 cases without MMP2 expression. Chi-square test indicated that the positive protein expression rate of MMP2 in hybrid-type and epithelial-type CTCs was higher than that in mesenchymal-type CTCs, and the difference was statistically significant (P < 0.001, Figure 3). Moreover, comparing patients before, during, and after radiotherapy, it was found that the total number of CTCs and the number of hybrid-type CTCs increased during radiotherapy and decreased after the therapy, with the difference being statistically significant. The changes in the number of epithelial-type CTCs, mesenchymal-type CTCs, and MMP2 positive CTCs showed no significant differences (Figure 4).

Figure 3 Comparison of MMP2 protein expression in different types of CTCs. The graph shows the distribution of epithelial-type, mesenchymal-type, and hybrid-type CTCs expressing MMP2 protein.
Figure 3

Comparison of MMP2 protein expression in different types of CTCs. The graph shows the distribution of epithelial-type, mesenchymal-type, and hybrid-type CTCs expressing MMP2 protein.

Figure 4 Changes in the total number of CTCs and the number of hybrid CTCs before, during, and after radiotherapy.
Figure 4

Changes in the total number of CTCs and the number of hybrid CTCs before, during, and after radiotherapy.

4 Discussion

Recent progress in grasping the risk elements and mechanisms behind nasopharyngeal cancer, coupled with innovations in diagnostic and therapeutic methods, has created fresh avenues for the early identification and betterment of patient prognoses. The technique of liquid biopsy, which analyzes CTCs or cell-free DNA, emerges as a more economical and less intrusive method for the early detection of cancer, monitoring the effectiveness of treatments, and recognizing signs of tumor recurrence, when contrasted with traditional diagnostic procedures [19,20]. The clinical application of counting CTC has been extensively explored across a range of solid tumors, such as those found in the lung, prostate, breast, colorectal, head and neck, and pancreas [21–25]. Elevated count CTCs have been consistently linked with adverse outcomes, such as metastasis, treatment resistance, or recurrence of cancer, across multiple cancer types. For instance, in a study focusing on small-cell lung cancer, elevated CTC levels (≥10 CTCs per 5 mL of blood) were strongly linked to a more advanced TNM stage, including extensive lymph node and distant metastases, suggesting a poorer prognosis [26]. In research on hormone receptor-positive (HR+) metastatic breast cancer, findings indicated that patients with ≥5 CTCs per 7.5 mL of blood post-treatment experienced significantly poorer OS and progression-free survival (PFS) compared to those with fewer than five CTCs [27]. In NPC, baseline and post-treatment CTC levels, along with their longitudinal changes, were significantly linked to shorter PFS as determined by Kaplan–Meier analysis [28]. This study also found that nasopharyngeal cancer patients receiving radiotherapy with higher total counts of CTCs were more prone to relapse. Our results are consistent with previous studies and also demonstrate that high CTC counts are associated with nasopharyngeal cancer recurrence.

EMT involves the transformation of epithelial tumor cells, leading them to shed their cell-to-cell adhesion and develop mesenchymal characteristics that enhance invasiveness. In the course of spreading, tumor cells activate EMT to separate from the basement membrane and directly infiltrate the bloodstream [29–32]. The heterogeneity of CTCs reflects critical features related to metastatic progression, particularly EMT plasticity. During the EMT process, the phenotypes of CTCs transition dynamically between epithelial (E-CTCs), mesenchymal (M-CTCs), and hybrid forms (E/M-CTCs) [33,34]. In early-stage cancer, CTCs often mirror the primary tumor’s epithelial characteristics. Yet, as cancer progresses to advanced stages, the CTC profile shifts toward a mesenchymal phenotype due to the metastatic processes driven by EMT. This phenotypic flexibility, rooted in EMT, allows CTCs to navigate through various stages of metastasis, enhancing their drug resistance, survival, mobility, and invasive capabilities. Different states of EMT have been reported to contribute to cancer progression in different cancers [35–37]. For instance, a study indicates that a high total count of CTCs is associated with a poorer prognosis in all subtypes of lung cancer, and this effect intensifies as the detection threshold for CTCs increases. Moreover, epithelial CTCs have a greater prognostic value in lung cancer than CTCs of other EMT states [38]. Additional research indicates that in squamous cell carcinoma, the loss of FAT1 function facilitates tumor initiation, progression, invasiveness, stemness, and metastasis by triggering a hybrid state of EMT [39]. Counts of M-CTC and E/M-CTC are linked to the prognosis of patients with malignancies of the urinary system. Elevated numbers of M-CTC and E/M-CTC serve as indicators of a poorer prognosis in individuals suffering from urinary system [40]. In NPC research, a study demonstrated that 3 months after concurrent chemoradiotherapy, the total count of CTCs and epithelial/mesenchymal hybrid CTCs significantly decreased, while the counts of purely epithelial or purely mesenchymal CTCs did not decrease. Cases with an E/M hybrid dominance showed lower disease-free survival rates and distant metastasis-free survival rates compared to cases without E/M hybrid dominance [41]. In addition, previous studies also demonstrate that in NPC patients, higher counts of CTCs and mesenchymal CTCs are significantly correlated with advanced TNM staging, shorter PFS, and OS, making them valuable biomarkers for predicting patient outcomes and therapy response [42–44]. However, the changes in CTCs of different EMT statuses during radiotherapy following induction chemotherapy and their impact on prognosis remain unclear. This study suggested that during radiotherapy, the total count of CTCs and the number of hybrid CTCs increased, but these values decreased after the completion of radiotherapy, a difference that was statistically significant. In contrast, the changes in the number of epithelial CTCs and mesenchymal CTCs were not significant. Moreover, the total count of CTCs and the number of hybrid CTCs after radiotherapy were associated with patient disease progression or relapse. These results indicate that hybrid CTCs play a significant role in predicting the effectiveness of different treatment regimens and the prognosis of patients with NPC.

MMPs are enzymes capable of degrading components of the ECM, providing a physical pathway for tumor cell migration and invasion. During the EMT process, the expression of MMPs by tumor cells increases, aiding the cells in crossing the basement membrane and surrounding tissues, thereby promoting tumor invasion and metastasis [45,46]. In contrast to numerous studies on EMT in CTCs, there are few studies on MMPs expression in CTCs. In a study on breast cancer, MMP9 expression showed no significant difference across different EMT states, and there was no difference in prognosis between patients with varying EMT states of CTCs expressing different levels of MMP9 [47]. In this study, the results indicated that the positive expression of MMP2 on hybrid and epithelial CTCs was higher than on mesenchymal CTCs. However, after undergoing radiotherapy, the proportion of MMP2 + CTCs increased compared to before receiving radiotherapy, yet the count of MMP2 + CTCs was not associated with the prognosis of nasopharyngeal cancer patients. This result suggests that MMP2 may play a significant role in maintaining the epithelial state of EMT, or at least a partial epithelial characteristic, in nasopharyngeal cancer CTCs. However, the specific mechanisms behind this remain to be further investigated by us. Moreover, this study showed that the positivity rate of MMP2 in CTCs was not related to the recurrence of nasopharyngeal cancer in patients, a finding that could be attributed to the insufficient sample size of this study. Future studies will require larger cohorts to establish the relationship between MMP2 expression in CTCs and the prognosis of patients with NPC.

In conclusion, this study is the first to explore the relationship between different EMT states of CTCs and prognosis of nasopharyngeal cancer patients after induction chemotherapy followed by radiotherapy. In this context, the count of hybrid CTCs and the expression of MMP2 in these types of CTCs may play a significant role, which could be of great importance for guiding the treatment and monitoring disease progression in nasopharyngeal cancer.

# Xiaoju Wang, Yuxin Zhang, and Yiqing Wang contributed to this work equally.

tel: +8613919197080

Acknowledgements

Not applicable.

  1. Funding information: This study was supported by Hangzhou Science and Technology Development Plan Project (20220919Y047 and 20201203B).

  2. Author contributions: Guarantor of integrity of the entire study: Yanjiao Mao; study concepts: Yanjiao Mao, Yaoshu Teng, Jing Li; study design: Yanjiao Mao; definition of intellectual content: Yanjiao Mao; literature research: Yanjiao Mao, Xiaoju Wang; clinical studies: Yanjiao Mao, Xiaoju Wang, Caiqin Yuan; experimental studies: Xiaoju Wang, Yuxin Zhang; data acquisition: Xiaoju Wang, Yuxin Zhang, Wei Yin; data analysis: Xiaoju Wang, Yuxin Zhang, Yiqing Wang; statistical analysis: Lei Shi, Yuxin Zhang, Wei Yin; manuscript preparation: Xiaoju Wang, Yuxin Zhang; manuscript editing: Xiaoju Wang, Yuxin Zhang; manuscript review: Yanjiao Mao, Yaoshu Teng, Jing Li.

  3. Conflict of interest: The authors declare that they have no competing interests.

  4. Data availability statement: All data generated or analyzed during this study are included in this published article. The raw data are available from the corresponding author upon reasonable request.

References

[1] Chen YP, Ismaila N, Chua MLK, Colevas AD, Haddad R, Huang SH, et al. Chemotherapy in combination with radiotherapy for definitive-intent treatment of stage II-IVA nasopharyngeal carcinoma: CSCO and ASCO guideline. J Clin Oncol. 2021;39(7):840–59.10.1200/JCO.20.03237Search in Google Scholar PubMed

[2] Tsao SW, Tsang CM, Lo KW. Epstein-Barr virus infection and nasopharyngeal carcinoma. Philos Trans R Soc Lond B Biol Sci. 2017;372(1732):20160270.10.1098/rstb.2016.0270Search in Google Scholar PubMed PubMed Central

[3] Shen Y, Zhang S, Sun R, Wu T, Qian J. Understanding the interplay between host immunity and Epstein-Barr virus in NPC patients. Emerg Microbes Infect. 2015;4(3):e20.10.1038/emi.2015.20Search in Google Scholar PubMed PubMed Central

[4] Lam WKJ, Chan JYK. Recent advances in the management of nasopharyngeal carcinoma. F1000Res. 2018;7:F1000 Faculty Rev-1829.10.12688/f1000research.15066.1Search in Google Scholar PubMed PubMed Central

[5] Wong KCW, Hui EP, Lo KW, Lam WKJ, Johnson D, Li L, et al. Nasopharyngeal carcinoma: an evolving paradigm. Nat Rev Clin Oncol. 2021;18(11):679–95.10.1038/s41571-021-00524-xSearch in Google Scholar PubMed

[6] Chang ET, Ye W, Zeng YX, Adami HO. The evolving epidemiology of nasopharyngeal carcinoma. Cancer Epidemiol Biomarkers Prev. 2021;30(6):1035–47.10.1158/1055-9965.EPI-20-1702Search in Google Scholar PubMed

[7] Lee AWM, Ng WT, Chan JYW, Corry J, Mäkitie A, Mendenhall WM, et al. Management of locally recurrent nasopharyngeal carcinoma. Cancer Treat Rev. 2019;79:101890.10.1016/j.ctrv.2019.101890Search in Google Scholar PubMed

[8] Lin D, Shen L, Luo M, Zhang K, Li J, Yang Q, et al. Circulating tumor cells: biology and clinical significance. Signal Transduct Target Ther. 2021;6(1):404.10.1038/s41392-021-00817-8Search in Google Scholar PubMed PubMed Central

[9] Castro-Giner F, Aceto N. Tracking cancer progression: from circulating tumor cells to metastasis. Genome Med. 2020;12(1):31.10.1186/s13073-020-00728-3Search in Google Scholar PubMed PubMed Central

[10] Deng Z, Wu S, Wang Y, Shi D. Circulating tumor cell isolation for cancer diagnosis and prognosis. EBioMedicine. 2022;83:104237.10.1016/j.ebiom.2022.104237Search in Google Scholar PubMed PubMed Central

[11] Ganesh K, Massagué J. Targeting metastatic cancer. Nat Med. 2021;27(1):34–44.10.1038/s41591-020-01195-4Search in Google Scholar PubMed PubMed Central

[12] Ou G, Xing S, Li J, Zhang L, Chen S. Circulating tumor cells: a valuable marker of poor prognosis for advanced nasopharyngeal carcinoma. Mol Med. 2019;25(1):50.10.1186/s10020-019-0112-3Search in Google Scholar PubMed PubMed Central

[13] Kitz J, Goodale D, Postenka C, Lowes LE, Allan AL. EMT-independent detection of circulating tumor cells in human blood samples and pre-clinical mouse models of metastasis. Clin Exp Metastasis. 2021;38(1):97–108.10.1007/s10585-020-10070-ySearch in Google Scholar PubMed PubMed Central

[14] Genna A, Vanwynsberghe AM, Villard AV, Pottier C, Ancel J, Polette M, et al. EMT-associated heterogeneity in circulating tumor cells: sticky friends on the road to metastasis. Cancers (Basel). 2020;12(6):1632.10.3390/cancers12061632Search in Google Scholar PubMed PubMed Central

[15] Pastushenko I, Blanpain C. EMT transition states during tumor progression and metastasis. Trends Cell Biol. 2019;29(3):212–26.10.1016/j.tcb.2018.12.001Search in Google Scholar PubMed

[16] Cox TR. The matrix in cancer. Nat Rev Cancer. 2021;21(4):217–38.10.1038/s41568-020-00329-7Search in Google Scholar PubMed

[17] Alaseem A, Alhazzani K, Dondapati P, Alobid S, Bishayee A, Rathinavelu A. Matrix metalloproteinases: a challenging paradigm of cancer management. Semin Cancer Biol. 2019;56:100–15.10.1016/j.semcancer.2017.11.008Search in Google Scholar PubMed

[18] Muniz-Bongers LR, McClain CB, Saxena M, Bongers G, Merad M, Bhardwaj N. MMP2 and TLRs modulate immune responses in the tumor microenvironment. JCI Insight. 2021;6(12):e144913.10.1172/jci.insight.144913Search in Google Scholar PubMed PubMed Central

[19] Alix-Panabières C, Pantel K. Liquid biopsy: from discovery to clinical application. Cancer Discov. 2021;11(4):858–73.10.1158/2159-8290.CD-20-1311Search in Google Scholar PubMed

[20] Nikanjam M, Kato S, Kurzrock R. Liquid biopsy: current technology and clinical applications. J Hematol Oncol. 2022;15(1):131.10.1186/s13045-022-01351-ySearch in Google Scholar PubMed PubMed Central

[21] Poellmann MJ, Bu J, Kim D, Iida M, Hong H, Wang AZ, et al. Circulating tumor cell abundance in head and neck squamous cell carcinoma decreases with successful chemoradiation and cetuximab treatment. Cancer Lett. 2023;562:216187.10.1016/j.canlet.2023.216187Search in Google Scholar PubMed PubMed Central

[22] Armstrong AJ, Azad AA, Iguchi T, Szmulewitz RZ, Petrylak DP, Holzbeierlein J, et al. Improved survival with enzalutamide in patients with metastatic hormone-sensitive prostate cancer. J Clin Oncol. 2022;40(15):1616–22.10.1200/JCO.22.00193Search in Google Scholar PubMed PubMed Central

[23] Hugenschmidt H, Labori KJ, Brunborg C, Verbeke CS, Seeberg LT, Schirmer CB, et al. Circulating tumor cells are an independent predictor of shorter survival in patients undergoing resection for pancreatic and periampullary adenocarcinoma. Ann Surg. 2020;271(3):549–58.10.1097/SLA.0000000000003035Search in Google Scholar PubMed

[24] Gueguen P, Metoikidou C, Dupic T, Lawand M, Goudot C, Baulande S, et al. Contribution of resident and circulating precursors to tumor-infiltrating CD8(+) T cell populations in lung cancer. Sci Immunol. 2021;6(55):eabd5778.10.1126/sciimmunol.abd5778Search in Google Scholar PubMed

[25] Wei C, Yang C, Wang S, Shi D, Zhang C, Lin X, et al. Crosstalk between cancer cells and tumor associated macrophages is required for mesenchymal circulating tumor cell-mediated colorectal cancer metastasis. Mol Cancer. 2019;18(1):64.10.1186/s12943-019-0976-4Search in Google Scholar PubMed PubMed Central

[26] Nguyen TNA, Huang PS, Chu PY, Hsieh CH, Wu MH. Recent progress in enhanced cancer diagnosis, prognosis, and monitoring using a combined analysis of the number of circulating tumor cells (CTCs) and other clinical parameters. Cancers (Basel). 2023;15(22):5372.10.3390/cancers15225372Search in Google Scholar PubMed PubMed Central

[27] Magbanua MJM, Savenkov O, Asmus EJ, Ballman KV, Scott JH, Park JW, et al. Clinical significance of circulating tumor cells in hormone receptor-positive metastatic breast cancer patients who received letrozole with or without bevacizumab. Clin Cancer Res. 2020;26(18):4911–20.10.1158/1078-0432.CCR-20-1329Search in Google Scholar PubMed PubMed Central

[28] Lu L, Huang HW, Du H, Liu ZX, Zha ZQ, Wang PP, et al. Prognostic value of circulating tumor cells and its association with the expression of cancer stem cells in nasopharyngeal carcinoma patients. Neoplasma. 2022;69(2):303–10.10.4149/neo_2021_210707N906Search in Google Scholar PubMed

[29] Shi E, Wu Z, Karaoglan BS, Schwenk-Zieger S, Kranz G, Abdul Razak N, et al. 5′-Ectonucleotidase CD73/NT5E supports EGFR-mediated invasion of HPV-negative head and neck carcinoma cells. J Biomed Sci. 2023;30(1):72.10.1186/s12929-023-00968-6Search in Google Scholar PubMed PubMed Central

[30] Wang H, Guo S, Kim SJ, Shao F, Ho JWK, Wong KU, et al. Cisplatin prevents breast cancer metastasis through blocking early EMT and retards cancer growth together with paclitaxel. Theranostics. 2021;11(5):2442–59.10.7150/thno.46460Search in Google Scholar PubMed PubMed Central

[31] Yang S, Liu Y, Li MY, Ng CSH, Yang SL, Wang S, et al. FOXP3 promotes tumor growth and metastasis by activating Wnt/β-catenin signaling pathway and EMT in non-small cell lung cancer. Mol Cancer. 2017;16(1):124.10.1186/s12943-017-0700-1Search in Google Scholar PubMed PubMed Central

[32] Bakir B, Chiarella AM, Pitarresi JR, Rustgi AK. EMT, MET, plasticity, and tumor metastasis. Trends Cell Biol. 2020;30(10):764–76.10.1016/j.tcb.2020.07.003Search in Google Scholar PubMed PubMed Central

[33] Satelli A, Mitra A, Brownlee Z, Xia X, Bellister S, Overman MJ, et al. Epithelial-mesenchymal transitioned circulating tumor cells capture for detecting tumor progression. Clin Cancer Res. 2015;21(4):899–906.10.1158/1078-0432.CCR-14-0894Search in Google Scholar PubMed PubMed Central

[34] Aiello NM, Maddipati R, Norgard RJ, Balli D, Li J, Yuan S, et al. EMT subtype influences epithelial plasticity and mode of cell migration. Dev Cell. 2018;45(6):681–95 e4.10.1016/j.devcel.2018.05.027Search in Google Scholar PubMed PubMed Central

[35] Horimoto Y, Tokuda E, Murakami F, Uomori T, Himuro T, Nakai K, et al. Analysis of circulating tumour cell and the epithelial mesenchymal transition (EMT) status during eribulin-based treatment in 22 patients with metastatic breast cancer: a pilot study. J Transl Med. 2018;16(1):287.10.1186/s12967-018-1663-8Search in Google Scholar PubMed PubMed Central

[36] Schuster E, Taftaf R, Reduzzi C, Albert MK, Romero-Calvo I, Liu H. Better together: circulating tumor cell clustering in metastatic cancer. Trends Cancer. 2021;7(11):1020–32.10.1016/j.trecan.2021.07.001Search in Google Scholar PubMed PubMed Central

[37] Joosse SA, Gorges TM, Pantel K. Biology, detection, and clinical implications of circulating tumor cells. EMBO Mol Med. 2015;7(1):1–11.10.15252/emmm.201303698Search in Google Scholar PubMed PubMed Central

[38] Jin F, Zhu L, Shao J, Yakoub M, Schmitt L, Reißfelder C, et al. Circulating tumour cells in patients with lung cancer universally indicate poor prognosis. Eur Respir Rev. 2022;31(166):220151.10.1183/16000617.0151-2022Search in Google Scholar PubMed PubMed Central

[39] Pastushenko I, Mauri F, Song Y, de Cock F, Meeusen B, Swedlund B, et al. Fat1 deletion promotes hybrid EMT state, tumour stemness and metastasis. Nature. 2021;589(7842):448–55.10.1038/s41586-020-03046-1Search in Google Scholar PubMed PubMed Central

[40] Wang L, Ding D. Correlation between mesenchymal circulating tumor cells and prognosis of urologic malignancies: a single-center retrospective analysis. Am J Transl Res. 2023;15(1):502–10.Search in Google Scholar

[41] Wei J, Deng W, Weng J, Li M, Lan G, Li X, et al. Epithelia–mesenchymal transition classification of circulating tumor cells predicts clinical outcomes in progressive nasopharyngeal carcinoma. Front Oncol. 2022;12:988458.10.3389/fonc.2022.988458Search in Google Scholar PubMed PubMed Central

[42] Liu T, Liu J, Wang G, Chen C, He L, Wang R, et al. Circulating tumor cells: a valuable indicator for locally advanced nasopharyngeal carcinoma. Eur Arch Otorhinolaryngol. 2024;281(9):4963–72.10.1007/s00405-024-08714-wSearch in Google Scholar PubMed

[43] Liu T, Li Y, Song J, Li B, Wang R, Huang T, et al. Prognostic significance of excision repair cross-complementation group 1 on circulating tumor cells for nasopharyngeal carcinoma. Cancer Control. 2024;31:10732748241251562.10.1177/10732748241251562Search in Google Scholar PubMed PubMed Central

[44] Gao T, Mao J, Huang J, Luo F, Lin L, Lian Y, et al. Prognostic significance of circulating tumor cell measurement in the peripheral blood of patients with nasopharyngeal carcinoma. Clinics (Sao Paulo). 2023;78:100179.10.1016/j.clinsp.2023.100179Search in Google Scholar PubMed PubMed Central

[45] Conlon GA, Murray GI. Recent advances in understanding the roles of matrix metalloproteinases in tumour invasion and metastasis. J Pathol. 2019;247(5):629–40.10.1002/path.5225Search in Google Scholar PubMed

[46] Sleeboom JJF, van Tienderen GS, Schenke-Layland K, van der Laan LJW, Khalil AA, Verstegen MMA. The extracellular matrix as hallmark of cancer and metastasis: from biomechanics to therapeutic targets. Sci Transl Med. 2024;16(728):eadg3840.10.1126/scitranslmed.adg3840Search in Google Scholar PubMed

[47] Kalavska K, Cierna Z, Karaba M, Minarik G, Benca J, Sedlackova T, et al. Prognostic role of matrix metalloproteinase 9 in early breast cancer. Oncol Lett. 2021;21(2):78.10.3892/ol.2020.12339Search in Google Scholar PubMed PubMed Central

Received: 2024-03-08
Revised: 2024-09-23
Accepted: 2024-10-03
Published Online: 2025-03-11

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
  156. Influence of sevoflurane combined with propofol anesthesia on the anesthesia effect and adverse reactions in children with acute appendicitis
  157. Identification of hub genes related to acute kidney injury caused by sevoflurane anesthesia and endoplasmic reticulum stress
  158. Efficacy and safety of PD-1/PD-L1 inhibitors in pancreatic ductal adenocarcinoma: a systematic review and Meta-analysis of randomized controlled trials
  159. The value of diagnostic experience in O-RADS MRI score for ovarian-adnexal lesions
  160. Health education pathway for individuals with temporary enterostomies using patient journey mapping
  161. Serum TLR8 as a potential diagnostic biomarker of coronary heart disease
  162. Intraoperative temperature management and its effect on surgical outcomes in elderly patients undergoing lichtenstein unilateral inguinal hernia repair
  163. Immunohistochemical profiling and neuroepithelial heterogeneity in immature ovarian teratomas: a retrospective digital pathology-based study
  164. Associated risk factors and prevalence of human papillomavirus infection among females visiting tertiary care hospital: a cross-sectional study from Nepal
  165. Comparative evaluation of various disc elution methods for the detection of colistin-resistant gram-negative bacteria
  166. Effect of timing of cholecystectomy on weight loss after sleeve gastrectomy in morbidly obese individuals with cholelithiasis: a retrospective cohort study
  167. Causal association between ceramide levels and central precocious puberty: a mendelian randomization study
  168. Novel predictive model for colorectal liver metastases recurrence: a radiomics and clinical data approach
  169. Relationship between resident physicians’ perceived professional value and exposure to violence
  170. Multiple sclerosis and type 1 diabetes: a Mendelian randomization study of European ancestry
  171. Rapid pathogen identification in peritoneal dialysis effluent by MALDI-TOF MS following blood culture enrichment
  172. Comparison of open and percutaneous A1 pulley release in pediatric trigger thumb: a retrospective cohort study
  173. Impact of combined diaphragm-lung ultrasound assessment on postoperative respiratory function in patients under general anesthesia recovery
  174. Development and internal validation of a nomogram for predicting short-term prognosis in ICU patients with acute pyelonephritis
  175. The association between hypoxic burden and blood pressure in patients with obstructive sleep apnea
  176. Promotion of asthenozoospermia by C9orf72 through suppression of spermatogonia activity via fructose metabolism and mitophagy
  177. Review Articles
  178. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  179. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  180. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  181. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  182. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  183. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  184. The application of augmented reality in robotic general surgery: A mini-review
  185. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  186. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  187. Plant polyphenols, terpenes, and terpenoids in oral health
  188. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  189. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  190. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  191. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  192. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  193. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  194. Giant borderline ovarian tumours – review of the literature
  195. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  196. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  197. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  198. Supplement strategies for infertility in overweight women: Evidence and legal insights
  199. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  200. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  201. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  202. Strategies for hyperkalemia management in dialysis patients: A systematic review
  203. C-reactive protein-to-albumin ratio in peripheral artery disease
  204. Research progress on autophagy and its roles in sepsis induced organ injury
  205. Neuronutrition in autism spectrum disorders
  206. Pumilio 2 in neural development, function, and specific neurological disorders
  207. Antibiotic prescribing patterns in general dental practice- a scoping review
  208. Clinical and medico-legal reflections on non-invasive prenatal testing
  209. Smartphone use and back pain: a narrative review of postural pathologies
  210. Targeting endothelial oxidative stress in hypertension
  211. Exploring links between acne and metabolic syndrome: a narrative review
  212. Case Reports
  213. Delayed graft function after renal transplantation
  214. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  215. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  216. Giant right atrial hemangioma presenting with ascites: A case report
  217. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  218. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  219. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  220. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  221. Combined VAT and retroperitoneoscopy for pleural empyema due to nephro-pleuric fistula in xanthogranulomatous pyelonephritis
  222. A rare case of Opalski syndrome with a suspected multiple sclerosis etiology
  223. Newly diagnosed B-cell acute lymphoblastic leukemia demonstrating localized bone marrow infiltration exclusively in the lower extremities
  224. Rapid Communication
  225. Biological properties of valve materials using RGD and EC
  226. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  227. Repeat influenza incidence across two consecutive influenza seasons
  228. Letter to the Editor
  229. Role of enhanced external counterpulsation in long COVID
  230. Expression of Concern
  231. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  232. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  233. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  234. Corrigendum
  235. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  236. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  237. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  238. Retraction
  239. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  240. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  241. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  242. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  243. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  244. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  245. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  246. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  247. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  248. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  249. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  250. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  251. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  252. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  253. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  254. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  255. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  256. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  257. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  258. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  259. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  260. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  261. A review of brain research on T2DM-related cognitive dysfunction
  262. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  263. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  264. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
https://doi.org/10.1515/med-2024-1074
Keywords for this article
epithelial–mesenchymal transition; circulating tumor cells; nasopharyngeal carcinoma; MMP2; prognostic value
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
  156. Influence of sevoflurane combined with propofol anesthesia on the anesthesia effect and adverse reactions in children with acute appendicitis
  157. Identification of hub genes related to acute kidney injury caused by sevoflurane anesthesia and endoplasmic reticulum stress
  158. Efficacy and safety of PD-1/PD-L1 inhibitors in pancreatic ductal adenocarcinoma: a systematic review and Meta-analysis of randomized controlled trials
  159. The value of diagnostic experience in O-RADS MRI score for ovarian-adnexal lesions
  160. Health education pathway for individuals with temporary enterostomies using patient journey mapping
  161. Serum TLR8 as a potential diagnostic biomarker of coronary heart disease
  162. Intraoperative temperature management and its effect on surgical outcomes in elderly patients undergoing lichtenstein unilateral inguinal hernia repair
  163. Immunohistochemical profiling and neuroepithelial heterogeneity in immature ovarian teratomas: a retrospective digital pathology-based study
  164. Associated risk factors and prevalence of human papillomavirus infection among females visiting tertiary care hospital: a cross-sectional study from Nepal
  165. Comparative evaluation of various disc elution methods for the detection of colistin-resistant gram-negative bacteria
  166. Effect of timing of cholecystectomy on weight loss after sleeve gastrectomy in morbidly obese individuals with cholelithiasis: a retrospective cohort study
  167. Causal association between ceramide levels and central precocious puberty: a mendelian randomization study
  168. Novel predictive model for colorectal liver metastases recurrence: a radiomics and clinical data approach
  169. Relationship between resident physicians’ perceived professional value and exposure to violence
  170. Multiple sclerosis and type 1 diabetes: a Mendelian randomization study of European ancestry
  171. Rapid pathogen identification in peritoneal dialysis effluent by MALDI-TOF MS following blood culture enrichment
  172. Comparison of open and percutaneous A1 pulley release in pediatric trigger thumb: a retrospective cohort study
  173. Impact of combined diaphragm-lung ultrasound assessment on postoperative respiratory function in patients under general anesthesia recovery
  174. Development and internal validation of a nomogram for predicting short-term prognosis in ICU patients with acute pyelonephritis
  175. The association between hypoxic burden and blood pressure in patients with obstructive sleep apnea
  176. Promotion of asthenozoospermia by C9orf72 through suppression of spermatogonia activity via fructose metabolism and mitophagy
  177. Review Articles
  178. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  179. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  180. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  181. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  182. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  183. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  184. The application of augmented reality in robotic general surgery: A mini-review
  185. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  186. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  187. Plant polyphenols, terpenes, and terpenoids in oral health
  188. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  189. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  190. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  191. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  192. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  193. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  194. Giant borderline ovarian tumours – review of the literature
  195. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  196. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  197. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  198. Supplement strategies for infertility in overweight women: Evidence and legal insights
  199. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  200. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  201. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  202. Strategies for hyperkalemia management in dialysis patients: A systematic review
  203. C-reactive protein-to-albumin ratio in peripheral artery disease
  204. Research progress on autophagy and its roles in sepsis induced organ injury
  205. Neuronutrition in autism spectrum disorders
  206. Pumilio 2 in neural development, function, and specific neurological disorders
  207. Antibiotic prescribing patterns in general dental practice- a scoping review
  208. Clinical and medico-legal reflections on non-invasive prenatal testing
  209. Smartphone use and back pain: a narrative review of postural pathologies
  210. Targeting endothelial oxidative stress in hypertension
  211. Exploring links between acne and metabolic syndrome: a narrative review
  212. Case Reports
  213. Delayed graft function after renal transplantation
  214. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  215. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  216. Giant right atrial hemangioma presenting with ascites: A case report
  217. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  218. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  219. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  220. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  221. Combined VAT and retroperitoneoscopy for pleural empyema due to nephro-pleuric fistula in xanthogranulomatous pyelonephritis
  222. A rare case of Opalski syndrome with a suspected multiple sclerosis etiology
  223. Newly diagnosed B-cell acute lymphoblastic leukemia demonstrating localized bone marrow infiltration exclusively in the lower extremities
  224. Rapid Communication
  225. Biological properties of valve materials using RGD and EC
  226. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  227. Repeat influenza incidence across two consecutive influenza seasons
  228. Letter to the Editor
  229. Role of enhanced external counterpulsation in long COVID
  230. Expression of Concern
  231. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  232. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  233. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  234. Corrigendum
  235. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  236. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  237. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  238. Retraction
  239. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  240. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  241. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  242. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  243. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  244. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  245. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  246. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  247. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  248. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  249. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  250. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  251. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  252. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  253. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  254. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  255. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  256. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  257. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  258. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  259. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  260. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  261. A review of brain research on T2DM-related cognitive dysfunction
  262. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  263. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  264. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 18.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/med-2024-1074/html
Scroll to top button