Startseite Medizin Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
Artikel Open Access

Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway

  • Yong Yang , Huajun Wang , Huige Hou , Jiwen Chen , Xiaolei Chen , Hongjian Zheng , Kai Zheng , Baofei Ye , Chunhui Wu EMAIL logo , Xiaofei Zheng EMAIL logo , Shiguo Yuan EMAIL logo und Boyuan Zheng EMAIL logo
Veröffentlicht/Copyright: 6. Mai 2025

Abstract

Appropriate formation of blood vessels is critical for tendon-bone healing during tendon injury, as excessive angiogenesis would exacerbate scar formation and lead to chronic pain and dysfunction. The mechanism to regulate inflammatory angiogenesis during tendon-bone healing remains to be elucidated. Here, we utilized lipopolysaccharide (LPS) to induce tenocyte inflammation and applied the conditioned medium from inflammatory tenocytes to treat rat aortic vascular endothelial cells (RAOECs). The results that indicated LPS treatment significantly induced the mRNA and protein upregulation of NLRP3, tumor necrosis factor α, IL-1β, and vascular endothelial growth factor A (VEGFA), as well as the secretion of VEGFA. Furthermore, the conditioned medium stimulated RAOEC angiogenesis. Celastrol, a quinone-methylated triterpenoid from Tripterygium wilfordii, has been reported to treat osteoarthritis. Here, celastrol could suppress LPS-induced upregulation of NLRP3 and IL-1β, and the secretion of VEGFA. Celastrol treatment also suppressed the conditioned medium-induced angiogenesis in RAOEC. Moreover, we established a rotator cuff tear rat model to stimulate tendon injury. Celastrol administration at the lesion significantly promoted tendon healing and functional recovery in injured mice by regulating NLRP3 and VEGFA levels. Taken together, these data suggest that the inflammation-induced tenocyte injury leads to angiogenesis, and that celastrol administration could suppress the inflammatory tenocyte-induced angiogenesis to promote tendon-bone healing via the NLRP3 pathway.

1 Introduction

Shoulder rotator cuff injury is a common shoulder injury that leads to recurring joint pain and severe mobility impairment, with the incidence accounting for 50–85% of shoulder joint diseases [1,2]. It is reported that approximately 40% of shoulder pain is due to rotator cuff injuries, and every year there are 4.5 million patients seeking treatment, with nearly 250,000 cases needing surgery [3,4]. Like other sports-related injuries, rotator cuff injuries impose a significant economic and psychological burden on society [5,6]. Currently, there are various clinical approaches to treat rotator cuff injuries, mainly categorized as surgical and non-surgical treatments. Non-surgical treatments typically include biophysical stimulation, rehabilitation training, steroid hormone, or non-steroidal anti-inflammatory drug injections [7,8]. Surgical treatment is the primary modality for clinical management of rotator cuff injury. Despite the increasing maturity of surgical repair techniques, the postoperative re-tear rate remains as high as 25–75% [9,10].

The mechanism of tendon-bone healing is a complex process that involves a series of factors, including stem cells, biological factors, immune-inflammatory responses, and vascular regeneration [11]. Increasing evidence indicates an inseparable relationship between inflammation and tendinopathy [12]. Recent studies have shown elevated levels of various pro-inflammatory mediators, such as PGE2, IL-1, and IL-6 [13]. When compared to normal tendon tissue, early-stage tendon tissues exhibit activation of downstream signaling pathways, such as IFN, NF-κB, and STAT-6 and that of late-stage shows the activation of M2 microglia and STAT-6 pathway [14]. Inflammation response also contributes to the angiogenesis [15]. Uncontrolled angiogenesis is closely related to many diseases, such as tendinitis, arthritis, psoriasis, and cancer [16]. Unregulated proangiogenic factors induced by inflammation may exacerbate scar formation and improper tissue healing would [17] be delayed by large amounts of extracellular matrix [18]. High proangiogenic pressure may lead to the dysfunction of early vasculature and controlling blood vessel density would increase the functionality of early vasculature and long-term outcomes [19]. VEGF is one of the important factors that regulate tissue vascular generation [20,21]. It is mainly expressed in endothelial cells but also expressed in various non-endothelial cells [22]. Its function is generally considered to be related to vascular generation in local tissues. Inflammatory mediators like tumor necrosis factor-α (TNF-α) and IL-6 can up-regulate vascular endothelial growth factor A (VEGFA) and other angiogenic factors, thereby linking inflammation to angiogenesis [23]. Thus, to elucidate the mechanism under inflammation induced angiogenesis needs to be explored in detail and further control of angiogenesis would reduce vascular regression, edema, and promote tendon-bone healing.

Celastrol is a quinone triterpenoid compound extracted from the roots of the plant Tripterygium wilfordii [24]. Its molecular formula is C29H38O4, with very low toxicity it has gained widespread attention for its immunosuppressive and anti-inflammatory properties [25,26], against many diseases, such as rheumatoid arthritis [27,28], systemic lupus erythematosus [29], allergic skin inflammation [30], inflammatory bowel disease [31], and cancers [32]. The anti-inflammatory effects of celastrol can be summarized as follows: regulating the production of chemotactic factors [32]; modulating the function of inflammatory cells, including macrophages [33]; regulating the expression of inflammatory mediators [26]; and regulating osteoclast differentiation [34]. However, the role of celastrol in regulating rotator cuff injures remains to be supplemented.

Here, in the current study, we developed a model of lipopolysaccharide (LPS)-induced tenocyte inflammatory response and tenocytes-induced rat aortic vascular endothelial cell (RAOEC) angiogenesis. We tried to elucidate the role of celastrol on these processes in vitro and the mechanism in promoting tendon-bone healing in a rotator cuff tear (RCT) model in vivo.

2 Materials and methods

2.1 Animal use

Sprague-Dawley (SD) rats weighting about 100 g (5–6-week-old, female) were purchased from the Guangdong medical laboratory animal center.

2.2 Cell culture

Primary rat tenocytes were isolated from SD rats. Briefly, for tendon culture, the cervical dislocation method was applied, and the tendons of the extremities were isolated and cut into pieces. Then the cut tissues were attached to the bottom of a culture bottle and cultured with DMEM (Gibco, CA, USA) with 10% FBS (Sigma-Aldrich, MO, USA) and 1% antibiotic-antimycotic (Gibco). After 6 h, the tissue blocks were removed and washed with PBS, and digested with 0.25% trypsin (Gibco), and passed down for 3 or 4 passages before usage. Tenocytes were seeded in six-well plates with the concentration of 1 × 105/mL and cultured for 1 day before the administration of LPS (0.5 or 1 μg/mL, Sigma, USA). The RAOEC line was purchased from Yaji Biological Co., Ltd (#YS2272C, Shanghai, China).

2.3 Tube formation assay

To assess the angiogenic potential of substances secreted by tenocytes after exposure to LPS, a modified tube formation assay was utilized [35]. These media collected from LPS-exposed tenocytes were used to coat 96-well plates with a Matrigel layer (BD, USA). RAOECs were then suspended in either the LPS-stimulated tenocyte media or the control medium for a duration of 24 h. Subsequently, about 10,000 cells were dispensed into each well for a 6 h incubation period to form the capillary-like structures. The images were captured using a digital imaging system (Axio Observer, Zeiss, Germany) and then were quantitatively evaluated using AngioTool (NIH, USA) [36].

2.4 ELISA

Tenocytes were treated with or without LPS, or with other treatments with or without celastrol administration. Then the supernatants were collected and rat VEGFA secreted proteins from supernatants were determined by ELISA analysis using VEGFA (#PV960, Beyotime, Shanghai, China) ELISA kits, and the concentration was measured by a Bio-Rad enzyme-linked immunosorbent assay reader (Bio-Rad, USA).

2.5 Rat RCT model

Rat RCT model construction was performed as we previously reported [37]. Briefly, a 1.5 cm cut was made along the front and outer aspect of the shoulder. This allowed for the exposure of the supraspinatus muscle and its tendon. Next, a precise division of half of these tendons from the greater tuberosity was performed. Following this, the tendons of the supraspinatus were carefully stitched in successive layers with a suture size of 4-0. Then rats were randomly divided into three groups: Sham, RCT, RCT + Celastrol groups. RCT + Celastrol group, rats were injected with 1 mg/kg celastrol (Sigma-Aldrich, Darmstadt, Germany) intra-articularly per week. Four or eight weeks later, tendons were subjected to biomechanical testing.

2.6 Biomechanical testing

Biomechanical testing was also performed as we previously reported [37]. Briefly, at intervals of 4 or 8 weeks post-RCT construction, the full-length tendons from the rat’s supraspinatus muscle along with the proximal part of the humerus were harvested for biomechanical evaluation. This evaluation was conducted using an MTS 858 material testing system (MTS System, Minneapolis, MN, USA), initiating the procedure with a preload range up to 5 N, to a constant extension rate of 14 mm/s. The maximal load the tendons could withstand before failure (measured in Newtons) and their stiffness (measured in Newtons per millimeter) were both determined and logged using a Sigma-Aldrich Plot 8.0 software application (Sigma). The ultimate force was ascertained using the load versus displacement graph, whereas stiffness was derived by calculating the gradient of the slope.

2.7 RNA isolation and real-time qPCR

Total RNA was isolated utilizing the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), adhering to the protocol provided by the supplier. The conversion of mRNA to cDNA was carried out using the EasyScript cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). For the synthesis of cDNA, the TransScript mRNA First-Strand cDNA Synthesis SuperMix (TransGen) was employed. Quantitative real-time PCR analyses were conducted with the aid of the TransStart Top Green qPCR SuperMix (TransGen). The specific primer sequences that were used can be found in Table 1.

Table 1

Primer sequences for real-time qPCR

Gene Forward (5′–3′) Reverse (5′–3′)
IL-1β CCAGGACATGCTAGGGAGC CAGAGGCAGGGAGGGAAA
Tnf-α AAAACTCGAGTGACAAGCCCGT TCCCTTGAAGAGAACCTGGGAG
Nlrp3 CAGAAGCTGGGGTTGGTGAA CCCATGTCTCCAAGGGCATT
Vegfa GCACATAGGAGAGATGAGCTTCC CACGCCTTGGCTTGTCACAT
Gapdh TGATTCTACCCACGGCAAGTT TGATGGGTTTCCCATTGATGA

2.8 Western blotting

Using RIPA buffer supplemented with protease inhibitors from Beyotime, China, the samples were lysed. The proteins were then resolved using 10% SDS-PAGE and subsequently transferred onto PVDF membranes sourced from Millipore. After blocking with milk, the membranes were treated with primary antibodies specific to NLRP3 (#ab263899; Abcam, Cambridge, UK), IL-1β (#EPR21086; Abcam), and GAPDH (#ab8245; Abcam). This was followed by a 1 h room temperature incubation with secondary antibodies from Abclonal Biotechnology, Wuhan, China. The blots were visualized utilizing an enhanced chemiluminescence method provided by Beyotime. For normalization purposes, GAPDH serves as the internal standard.

2.9 Immunocytochemistry

Tenocytes were grown on coverslips coated with poly-l-lysine in 24-well plates. After treatment, the cells were fixed using a 4% paraformaldehyde solution in PBS. For immunolabeling, the cells were incubated at 4°C overnight with the following primary antibody: NLRP3 (#ab263899; Abcam, Cambridge, UK), and post-primary antibody incubation, the cells were washed and then incubated with the appropriate AlexaFluor 488 conjugated secondary antibodies (Invitrogen). After further washing with PBS, the cells were mounted using DAPI-Fluoromount. The samples were then imaged with a LSM 880 confocal microscope (Carl Zeiss, Germany).

2.10 Statistical analyses

All experiments were conducted from three repeated experiments and subjected to statistical analysis using SPSS software version 27.0 to calculate the mean value and standard deviation. Student’s t-test was employed for the analysis of two independent samples. In cases where comparisons involved three or more groups, a one-way ANOVA was utilized. All the experiments were repeated at least three times. A P-value of less than 0.05 was considered to indicate statistical significance.

  1. Ethical approval: All animal procedures were approved by the Ethics Committee of the First Affiliated Hospital, Jinan University (202108246-25), and were conducted in accordance with institutional guidelines for animal care and use.

3 Results

3.1 Conditioned medium from LPS-induced tenocytes induces RAOEC angiogenesis

To determine the role of tenocyte inflammation during angiogenesis, the primarily cultured tenocyte was treated with different concentrations of LPS (0.5 or 1 μg/mL for 6 or 12 h). As shown in Figure 1, LPS administration significantly induced the mRNA expressions of NLRP3, TNFα, and IL-1β in tenocytes, in a time- and concentration-dependent manner (Figure 1a–c). The results showed that LPS also significantly induced the mRNA upregulation of VEGFA in tenocytes (Figure 1d). Protein levels of NLRP3 and IL-1β were significantly upregulated upon the treatment of LPS (Figure 1e and f), with the highest levels observed at a concentration of 0.5 μg/mL for 12 h. Thus, this condition was chosen for the subsequent cell experiments. Moreover, the ELISA assays revealed that LPS markedly induced the secreted level of VEGFA in cultured medium of tenocytes (Figure 1g). Then cultured RAOEC cells were treated with this conditioned medium for tube formation assay. The data showed that medium from LPS-treated tenocyte significantly induced the angiogenesis in RAOECs. Taken together, these results showed that LPS-induced inflammation in tenocytes and the conditioned medium from inflammatory tenocytes induced angiogenesis of RAOECs.

Figure 1 
                  Conditioned medium from LPS-induced tenocytes induces angiogenesis. (a) Cultured tenocytes were treated with LPS at different concentrations for 6 or 12 h. Then the mRNA levels of NLRP3 (a), TNF-alpha (b), IL-1beta (c), and VEGFA (d) were determined. The protein levels of NLRP3 and IL-1beta were also detected (e) and (f) by western blotting. (g) The secreted levels from LPS-treated tenocytes were determined by ELISA. (h) RAOEC cells were treated with conditioned medium from LPS-induced tenocytes and then subjected to a tube formation assay. The representative images are shown. Scale bar, 100 μm. The total tube length was quantified and shown (i). Data are shown as mean ± SD from three repeated experiments (n = 3). *denotes P < 0.05; **denotes P < 0.01; ***denotes P < 0.001; ****denotes P < 0.0001.
Figure 1

Conditioned medium from LPS-induced tenocytes induces angiogenesis. (a) Cultured tenocytes were treated with LPS at different concentrations for 6 or 12 h. Then the mRNA levels of NLRP3 (a), TNF-alpha (b), IL-1beta (c), and VEGFA (d) were determined. The protein levels of NLRP3 and IL-1beta were also detected (e) and (f) by western blotting. (g) The secreted levels from LPS-treated tenocytes were determined by ELISA. (h) RAOEC cells were treated with conditioned medium from LPS-induced tenocytes and then subjected to a tube formation assay. The representative images are shown. Scale bar, 100 μm. The total tube length was quantified and shown (i). Data are shown as mean ± SD from three repeated experiments (n = 3). *denotes P < 0.05; **denotes P < 0.01; ***denotes P < 0.001; ****denotes P < 0.0001.

3.2 Celastrol suppresses LPS-induced inflammation in tenocytes via NLRP3

Celastrol (the structure is shown in Figure 2a) has been reported to suppress inflammation [38]; however, the role in tenocyte inflammation has not been determined. Thus, the administration of celastrol was applied to LPS-induced tenocytes. As shown in Figure 2b, the upregulated mRNA levels of NLRP3 and IL-1β by LPS treatment were significantly suppressed after the administration of celastrol. The protein levels of NLRP3 and IL-1β were also significantly downregulated by celastrol revealed by western blotting assay (Figure 2c and d). Furthermore, the immunocytochemistry assays also showed that celastrol could suppress the expression of NLRP3 in tenocytes (Figure 2e and f). Taken together, these data suggest that celastrol suppresses LPS-induced inflammation in tenocytes via regulation of NLRP3.

Figure 2 
                  Celastrol suppresses LPS-induced inflammation in tenocytes via NLRP3. (a) Chemical formula and structure of celastrol. Tenocytes treated with LPS, with or without celastrol, were subjected to RT-qPCR or western blotting assays to determine the mRNA levels of NLRP3 and IL-1β (b), and the protein levels of NLRP3 and IL-1β (c) and (d). Tenocytes were also subjected to immunocytochemistry for the detection of NLRP3 expression (e) and (f). Scale bar, 10 μm. Data are shown as mean ± SD from three repeated experiments (n = 3). *denotes P < 0.05; **denotes P < 0.01; ***denotes P < 0.001.
Figure 2

Celastrol suppresses LPS-induced inflammation in tenocytes via NLRP3. (a) Chemical formula and structure of celastrol. Tenocytes treated with LPS, with or without celastrol, were subjected to RT-qPCR or western blotting assays to determine the mRNA levels of NLRP3 and IL-1β (b), and the protein levels of NLRP3 and IL-1β (c) and (d). Tenocytes were also subjected to immunocytochemistry for the detection of NLRP3 expression (e) and (f). Scale bar, 10 μm. Data are shown as mean ± SD from three repeated experiments (n = 3). *denotes P < 0.05; **denotes P < 0.01; ***denotes P < 0.001.

3.3 Celastrol suppresses angiogenesis induced by inflammatory tenocytes

To verify the role of celastrol in the tube formation ability of RAOECs, we determined the effect of celastrol on the secretion of VEGFA level in tenocytes. As shown in Figure 3a, the administration of celastrol significantly suppressed the secretion of VEGFA in LPS-induced tenocytes. Then RAOECs were treated with the conditioned medium from both groups. The results showed that tube-formation ability of RAOECs was significantly inhibited (Figure 3b and c), demonstrating that the celastrol suppresses angiogenesis via regulation of the VEGFA pathway.

Figure 3 
                  Celastrol suppresses angiogenesis by inflammatory tenocytes. (a) LPS-induced tenocytes were treated with or without celastrol, and then the secreted levels of VEGFA from the culture medium were determined. (b) and (c) RAOEC cells were administered conditioned medium from tenocytes with the indicated treatments. Then the angiogenesis assay was conducted. Scale bar, 100 μm. Data are shown as mean ± SD from three repeated experiments (n = 3). ***denotes P < 0.001.
Figure 3

Celastrol suppresses angiogenesis by inflammatory tenocytes. (a) LPS-induced tenocytes were treated with or without celastrol, and then the secreted levels of VEGFA from the culture medium were determined. (b) and (c) RAOEC cells were administered conditioned medium from tenocytes with the indicated treatments. Then the angiogenesis assay was conducted. Scale bar, 100 μm. Data are shown as mean ± SD from three repeated experiments (n = 3). ***denotes P < 0.001.

3.4 Celastrol promotes tendon-bone healing in RCT rats

To further elucidate the role of celastrol during tendon injury in vivo, we constructed a rat RCT model as we previously reported [37]. After successfully establishing the model, rats were intra-articularly injected with celastrol every week. Then the animals were subjected to biomechanical testing after 4 or 8 weeks, according to a well-established protocol [39,40]. As shown in Figure 4a, the ultimate load to failure was significantly impaired by the injection of LPS; however, this process could be reversed by the administration of celastrol both at 4- or 8-week points. The same trend was observed in stiffness testing, injection of celastrol could significantly rescue the impaired stiffness ability in RCT rats (Figure 4b). Then tendon samples were harvested and subjected to reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. The data showed that LPS significantly upregulated the mRNA level of both VEGFA and NLRP3 in RCT rats (Figure 4c and d), which could be suppressed by the administration of celastrol. These data indicate that celastrol treatment protects the tenon-bone healing in RCT rats, via modulating VEGFA and NLRP3 pathway.

Figure 4 
                  Celastrol promotes tendon-bone healing in RCT. RCT rats were administered LPS with or without celastrol injection. Four or eight weeks later, RCT rats were subjected to mechanical testing. The ultimate load to failure (a) and stiffness test (b) is shown. Then the mRNA levels of VEGFA (c) and NLRP3 (d) from rat tendons were determined. There were three rats in each group at each time points. *denotes P < 0.05; **denotes P < 0.01; ***denotes P < 0.001; ****denotes P < 0.0001.
Figure 4

Celastrol promotes tendon-bone healing in RCT. RCT rats were administered LPS with or without celastrol injection. Four or eight weeks later, RCT rats were subjected to mechanical testing. The ultimate load to failure (a) and stiffness test (b) is shown. Then the mRNA levels of VEGFA (c) and NLRP3 (d) from rat tendons were determined. There were three rats in each group at each time points. *denotes P < 0.05; **denotes P < 0.01; ***denotes P < 0.001; ****denotes P < 0.0001.

4 Discussion

In this study, we established an inflammatory model in LPS-induced tenocytes. LPS significantly upregulated the inflammatory factors, NLRP3 and IL-1β, and enhanced the secretion of VEGFA. The conditioned medium from LPS-induced tenocytes markedly stimulated the angiogenesis of cultured RAOECs. Furthermore, celastrol, an active component from traditional Chinese medicine, was found to alleviate the levels of NLRP3 and the secretion of VEGFA, hence suppressing the LPS-induced inflammation in tenocytes. Additionally, the administration of celastrol inhibited the angiogenesis of RAOECs triggered by the conditioned medium from LPS-induced tenocytes. Finally, the administration of celastrol significantly improved shoulder function in an RCT animal model. These data point to a novel role of celastrol in the neovascularization of inflammatory tenocytes, achieved by modulating the NLRP3 pathway, both in vitro and in vivo.

Inflammatory regulation of blood vessel formation during tendon-bone healing is crucial for the recovery of RCT. Due to the limited blood supply and regenerative capacity at the bone-tendon interface, injuries frequently lead to the formation of fibrous scars in the transition zone between bone and tendon, resulting in very slow bone-tendon healing [41]. After RCT, the matrix components and structure become disordered, making it challenging to restore the original biomechanical properties [42]. Angiogenesis regulation is important for the recovery of tendon injury. However, during tissue repair processes, angiogenesis may contribute adverse effects by exacerbating scarring and reducing the post-repair hardness [43]. Factors such as HIF-1α and VEGF would increase carcinogenic signals, leading to poor prognosis due to the upregulation of crucial genes involved in angiogenesis [44]. Restricting rather than promoting blood vessel growth may be more advantageous for the long-term outcome of tissue repair [45].

Deng reported that VEGF can induce cell differentiation, and it has the function of inducing differentiation of bone marrow mesenchymal stem cells into endothelial cells [46]. Sun found that VEGF can promote tendon-to-bone healing by activating Yes-related protein, inducing blood vessel generation and shoulder reconstruction in rats [47]. VEGF not only promotes blood vessel formation in the body but also increases the permeability of blood vessel walls and promotes the growth and proliferation of endothelial cells and perivascular cells, which are essential for self-renewal and regeneration [48,49]. Here, we found that celastrol could not only inhibit the mRNA upregulation but also the secretion of VEGFA in tenocytes, and finally suppressed the blood vessel growth of RAOECs. Our data confirmed that the reduction in angiogenesis would benefit the outcome and promote the recovery of RCT in animal model.

Due to limited metabolic demands and mechanical functions, vascular endothelial growth factors can be completely negligible in healthy tendons [50]. VEGA expression increases in various tendon diseases and tendon healing processes [51]. Following acute tendon injury, vascular endothelial growth factor levels typically increase for a period of time. Boyer et al. detected levels of VEGF in the canine flexor digitorum superficialis tendon at various time points following tendon transection and found that the expression levels of VEGF peaked 1 week later, then gradually decreased, and returned to a lower level in the third week [52]. In contrast to the direct surgical incision tendon injury model mentioned, Petersen et al. [53] and Yoshikawa et al. [54] studied autologous tendon transplantation after anterior cruciate ligament reconstruction and found that the expression of VEGF increased in the late stage after transplantation and then gradually decreased. Riggin et al. [55] demonstrated that local injection of VEGF or anti-VEGF antibody showed that only in the early stage, the vascular response might contribute to tendon healing, but on the contrary, reducing the vascular response may improve healing potential at later time points. In the current study, we found that celastrol suppressed the expression of VEGF, which could inhibit angiogenesis and promote functional recovery in RCT rats. Our results are consistent with the above reports that restricting blood vessel growth is beneficial for tendon-bone healing.

The occurrence of tendon disease is closely related to inflammation. Recent research has shown that in chronic tendon disease, levels of various pro-inflammatory mediators such as PGE2, IL-1, and IL-6 are upregulated compared to normal tendon tissues [56]. In early-stage tendon disease tissues, downstream signaling pathways of M1 and M2 such as IFN and STAT-6 are activated, while in the late stage, the M2 pathway is activated [57]. Clinical studies have shown that treatment with anti-inflammatory drugs such as glucocorticoids during the acute pain period inhibits tendon regeneration and repair, leading to a higher risk of tendon re-rupture, indicating that the inflammatory response in the acute phase promotes tendon repair [58]. Our results also confirmed the upregulated inflammation response during tendon repair.

NLRP3 is one critical component of the NLRP3 inflammasome, which is the most widely studied inflammasome to date [59]. When stimulated in danger, NLRP3 inflammasome could be activated, which promotes the activation of pro-inflammatory cytokines such as IL-1β or other interleukins [60]. NLRP3 protein levels increased in rat RCT tendons [61]. Here, in this study, we found that levels of NLRP3 and IL-1β were upregulated in LPS-induced tenocytes and in rat RCT models, which is consistent with the above studies [62]. Thus, NLRP3 inflammasome is a key regulator during tendon-bone healing. Increased NLRP3 activation may lead to fibrosis, indicating a potential role for NLRP3 in regulating collagen deposition [63]. Blood vessel growth and fibrosis suppress the tendon-bone healing, making easy re-occurrence of RCT.

T. wilfordii is found in East Asia, Australasia, Africa, and the Americas and has been used in traditional medicine for years [64]. Celastrol is one of the most abundant bioactive compounds [65]. Research has shown that celastrol possesses various biological activities, such as antioxidant, anti-inflammatory, and anticancer properties [65]. It can be applied in the treatment of many diseases by modulating various molecular targets, including cancer, metabolic diseases, autoimmune diseases, and neurodegenerative diseases [66]. For example, celastrol inhibits the expression of CXCR4 to block the invasion and metastasis of cancer cells [32]. The anti-inflammatory effects of celastrol are mainly attributed to modulating inflammatory signaling pathways, inhibiting the production of inflammatory factors, and regulating the activity of immune cells [67]. Celastrol regulates the anti-inflammatory effect in bone diseases, such as bone healing, osteoarthritis, and osteosarcoma. Deng et al. reported that celastrol could suppress inflammation in rats with advanced arthritis by targeting apoptosis of macrophages and osteoclasts in joints [68]. Celastrol improves osteoarthritis by controlling the TLR2/NF-κB signaling pathway [69]. Celastrol also promotes bone-wound healing in rats of a tibia injury model [70]. Here, consistent with the previous study, we found that administration of celastrol significantly suppressed the inflammation in LPS-induced tenocytes and the subsequent angiogenesis in RAOECs, and inhibited the expression of NLRP3 in RCT rats. Interestingly, celastrol is reported to inhibit the activation of the NLRP3 inflammasome in LPS-induced liver damage and monosodium urate-induced gouty arthritis by blocking the de-ubiquitination of NLRP3 and cleavage of pro-IL-1β, without affecting the total protein level of NLRP3 [71]. We detected the downregulation of cleaved IL-1β, and we did not observe the post-modification but found the downregulation of expression of NLRP3, this may due to the different models induced in different cell types. This controversy should be further clarified in the future study.

There are several limitations in the current study: (1) the detailed molecular mechanism underlying NLRP3/IL-1β signals is lacking, such as pathways related to collagen production [72], ECM disorganization [62], and cytoskeleton dynamics [73]. Particularly, we did not observe other signaling pathways beyond NLRP3/IL-1β underlying celastrol treatment, this could be determined by RNA-seq or proteomic approaches in our future study. (2) We did not determine all the inflammatory response factors, including pro-inflammatory and anti-inflammatory factors, such as IL-2, IL-6, IL-10, etc., also, the secreted compounds more than VEGFA were not included, which would be further supplemented in our future study. (3) While celastrol is highly effective in treating various diseases and can interact with multiple cellular targets, it has limitations, including poor water solubility and low bioavailability. A major concern with the clinical application of celastrol is its narrow therapeutic dose range, which is accompanied by the potential for adverse effects [74]. Additionally, the long-term use of celastrol should be carefully evaluated due to its immunosuppressive effects, which are vital for maintaining normal immune function. Therefore, various strategies should be adopted to mitigate the side effects associated with the clinical application of celastrol.

In conclusion, the present study demonstrates the impact of celastrol on the NLRP3 pathway during LPS-induced tenocyte inflammation, the angiogenesis of RAOEC cells, and functional recovery in RCT rats. These findings suggest that celastrol plays a critical role as a potential anti-angiogenic agent in promoting tendon-to-bone healing during RCT.


# These authors contributed equally to this work.


  1. Funding information: This study was supported by scientific research and cultivation fund of the Affiliated Shunde Hospital of Jinan University (No. 202101002), Hainan Provincial Natural Science Foundation of China (823RC596), Hainan Provincial Health Industry Research Project (No. 22A200106), Project of Clinical Medical Research in the First Affiliated Hospital of Jinan University (2018009), the Fundamental Research Funds for the Central Universities (21623319), Medical Joint Fund of Jinan University (No. YXJC2022005), Medical Scientific Research Foundation of Guangdong Province (A2023143), and Hainan Province Clinical Medical Center ([2021] No. 276).

  2. Author contributions: The conception and design of the study were carried out by Chunhui Wu, Xiaofei Zheng, Shiguo Yuan, and Boyuan Zheng, who also provided administrative and financial support. Yong Yang, Huajun Wang, and Huige Hou were responsible for the provision of study materials or data. The collection and assembly of data involved contributions from Yong Yang, Huajun Wang, Huige Hou, and Jiwen Chen. Data analysis and interpretation were conducted by Huige Hou, Jiwen Chen, and Xiaolei Chen. Yong Yang and Huajun Wang wrote the manuscript. Hongjian Zheng, Kai Zheng, and Baofei Ye participated in the critical revision of the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The data that support the findings will be available on request.

References

[1] Doiron-Cadrin P, Lafrance S, Saulnier M, Cournoyer E, Roy JS, Dyer JO, et al. Shoulder rotator cuff disorders: a systematic review of clinical practice guidelines and semantic analyses of recommendations. Arch Phys Med Rehabil. 2020;101(7):1233–42.10.1016/j.apmr.2019.12.017Suche in Google Scholar PubMed

[2] De Rus Aznar I, Avila Lafuente JL, Hachem AI, Diaz Heredia J, Kany J, Elhassan B, et al. Tendon transfers for the management of irreparable subscapularis tears. Bone Jt J. 2024;106-B(9):970–7.10.1302/0301-620X.106B9.BJJ-2024-0165.R1Suche in Google Scholar PubMed

[3] Linsell L, Dawson J, Zondervan K, Rose P, Randall T, Fitzpatrick R, et al. Prevalence and incidence of adults consulting for shoulder conditions in UK primary care; patterns of diagnosis and referral. Rheumatology (Oxford). 2006;45(2):215–21.10.1093/rheumatology/kei139Suche in Google Scholar PubMed

[4] Genuario JW, Donegan RP, Hamman D, Bell JE, Boublik M, Schlegel T, et al. The cost-effectiveness of single-row compared with double-row arthroscopic rotator cuff repair. J Bone Jt Surg Am. 2012;94(15):1369–77.10.2106/JBJS.J.01876Suche in Google Scholar PubMed PubMed Central

[5] Mather RC, 3rd, Koenig L, Acevedo D, Dall TM, Gallo P, Romeo A, et al. The societal and economic value of rotator cuff repair. J Bone Jt Surg Am. 2013;95(22):1993–2000.10.2106/JBJS.L.01495Suche in Google Scholar PubMed PubMed Central

[6] Longo UG, Salvatore G, Rizzello G, Berton A, Ciuffreda M, Candela V, et al. The burden of rotator cuff surgery in Italy: a nationwide registry study. Arch Orthop Trauma Surg. 2017;137(2):217–24.10.1007/s00402-016-2610-xSuche in Google Scholar PubMed

[7] Buchbinder R, Haas R. Optimising treatment for patients with rotator cuff disorders. Lancet. 2021;398(10298):369–70.10.1016/S0140-6736(21)00987-9Suche in Google Scholar PubMed

[8] Millar NL, Silbernagel KG, Thorborg K, Kirwan PD, Galatz LM, Abrams GD, et al. Tendinopathy. Nat Rev Dis Primers. 2021;7(1):1.10.1038/s41572-020-00234-1Suche in Google Scholar PubMed

[9] Lichtenberg S, Liem D, Magosch P, Habermeyer P. Influence of tendon healing after arthroscopic rotator cuff repair on clinical outcome using single-row Mason-Allen suture technique: a prospective, MRI controlled study. Knee Surg Sports Traumatol Arthrosc. 2006;14(11):1200–6.10.1007/s00167-006-0132-8Suche in Google Scholar PubMed

[10] Galatz LM, Ball CM, Teefey SA, Middleton WD, Yamaguchi K. The outcome and repair integrity of completely arthroscopically repaired large and massive rotator cuff tears. J Bone Jt Surg Am. 2004;86(2):219–24.10.2106/00004623-200402000-00002Suche in Google Scholar PubMed

[11] Atesok K, Fu FH, Wolf MR, Ochi M, Jazrawi LM, Doral MN, et al. Augmentation of tendon-to-bone healing. J Bone Jt Surg Am. 2014;96(6):513–21.10.2106/JBJS.M.00009Suche in Google Scholar PubMed

[12] Agabalyan N. Tendinopathy – from basic science to treatment. Int J Exp Pathol. 2013;94(4):A1.10.1111/iep.12034Suche in Google Scholar PubMed PubMed Central

[13] Abat F, Alfredson H, Cucchiarini M, Madry H, Marmotti A, Mouton C, et al. Current trends in tendinopathy: consensus of the ESSKA basic science committee. Part II: treatment options. J Exp Orthop. 2018;5(1):38.10.1186/s40634-018-0145-5Suche in Google Scholar PubMed PubMed Central

[14] Dakin SG, Martinez FO, Yapp C, Wells G, Oppermann U, Dean BJ, et al. Inflammation activation and resolution in human tendon disease. Sci Transl Med. 2015;7(311):311ra173.10.1126/scitranslmed.aac4269Suche in Google Scholar PubMed PubMed Central

[15] Jelinsky SA, Rodeo SA, Li J, Gulotta LV, Archambault JM, Seeherman HJ. Regulation of gene expression in human tendinopathy. BMC Musculoskelet Disord. 2011;12:86.10.1186/1471-2474-12-86Suche in Google Scholar PubMed PubMed Central

[16] Li X, Sun X, Carmeliet P. Hallmarks of endothelial cell metabolism in health and disease. Cell Metab. 2019;30(3):414–33.10.1016/j.cmet.2019.08.011Suche in Google Scholar PubMed

[17] Korntner S, Lehner C, Gehwolf R, Wagner A, Grutz M, Kunkel N, et al. Limiting angiogenesis to modulate scar formation. Adv Drug Deliv Rev. 2019;146:170–89.10.1016/j.addr.2018.02.010Suche in Google Scholar PubMed

[18] Petersen W, Pufe T, Zantop T, Tillmann B, Mentlein R. Hypoxia and PDGF have a synergistic effect that increases the expression of the angiogenetic peptide vascular endothelial growth factor in Achilles tendon fibroblasts. Arch Orthop Trauma Surg. 2003;123(9):485–8.10.1007/s00402-003-0493-0Suche in Google Scholar PubMed

[19] Nagy JA, Benjamin L, Zeng H, Dvorak AM, Dvorak HF. Vascular permeability, vascular hyperpermeability and angiogenesis. Angiogenesis. 2008;11(2):109–19.10.1007/s10456-008-9099-zSuche in Google Scholar PubMed PubMed Central

[20] Bentley K, Chakravartula S. The temporal basis of angiogenesis. Philos Trans R Soc Lond B Biol Sci. 2017;372(1720):20150522.10.1098/rstb.2015.0522Suche in Google Scholar PubMed PubMed Central

[21] Chen Y, Zhang L, Liu WX, Wang K. VEGF and SEMA4D have synergistic effects on the promotion of angiogenesis in epithelial ovarian cancer. Cell Mol Biol Lett. 2018;23:2.10.1186/s11658-017-0058-9Suche in Google Scholar PubMed PubMed Central

[22] Shibuya M. Vascular endothelial growth factor (VEGF) and its receptor (VEGFR) signaling in angiogenesis: a crucial target for anti- and pro-angiogenic therapies. Genes Cancer. 2011;2(12):1097–105.10.1177/1947601911423031Suche in Google Scholar PubMed PubMed Central

[23] Lin CM, Chang H, Li SY, Wu IH, Chiu JH. Chrysin inhibits lipopolysaccharide-induced angiogenesis via down-regulation of VEGF/VEGFR-2(KDR) and IL-6/IL-6R pathways. Planta Med. 2006;72(8):708–14.10.1055/s-2006-931602Suche in Google Scholar PubMed

[24] Corson TW, Crews CM. Molecular understanding and modern application of traditional medicines: triumphs and trials. Cell. 2007;130(5):769–74.10.1016/j.cell.2007.08.021Suche in Google Scholar PubMed PubMed Central

[25] Sethi G, Ahn KS, Pandey MK, Aggarwal BB. Celastrol, a novel triterpene, potentiates TNF-induced apoptosis and suppresses invasion of tumor cells by inhibiting NF-kappaB-regulated gene products and TAK1-mediated NF-kappaB activation. Blood. 2007;109(7):2727–35.10.1182/blood-2006-10-050807Suche in Google Scholar PubMed

[26] Kim DH, Shin EK, Kim YH, Lee BW, Jun JG, Park JH, et al. Suppression of inflammatory responses by celastrol, a quinone methide triterpenoid isolated from Celastrus regelii. Eur J Clin Invest. 2009;39(9):819–27.10.1111/j.1365-2362.2009.02186.xSuche in Google Scholar PubMed

[27] Xu S, Feng Y, He W, Xu W, Xu W, Yang H, et al. Celastrol in metabolic diseases: progress and application prospects. Pharmacol Res. 2021;167:105572.10.1016/j.phrs.2021.105572Suche in Google Scholar PubMed

[28] An L, Li Z, Shi L, Wang L, Wang Y, Jin L, et al. Inflammation-targeted celastrol nanodrug attenuates collagen-induced arthritis through NF-kappaB and Notch1 pathways. Nano Lett. 2020;20(10):7728–36.10.1021/acs.nanolett.0c03279Suche in Google Scholar PubMed

[29] Xinqiang S, Yu Z, Ningning Y, Erqin D, Lei W, Hongtao D. Molecular mechanism of celastrol in the treatment of systemic lupus erythematosus based on network pharmacology and molecular docking technology. Life Sci. 2020;240:117063.10.1016/j.lfs.2019.117063Suche in Google Scholar PubMed

[30] Kim Y, Kim K, Lee H, Han S, Lee YS, Choe J, et al. Celastrol binds to ERK and inhibits FcepsilonRI signaling to exert an anti-allergic effect. Eur J Pharmacol. 2009;612(1-3):131–42.10.1016/j.ejphar.2009.03.071Suche in Google Scholar PubMed

[31] Li M, Guo W, Dong Y, Wang W, Tian C, Zhang Z, et al. Beneficial effects of celastrol on immune balance by modulating gut microbiota in experimental ulcerative colitis mice. Genomics Proteom Bioinform. 2022;20(2):288–303.10.1016/j.gpb.2022.05.002Suche in Google Scholar PubMed PubMed Central

[32] Yadav VR, Sung B, Prasad S, Kannappan R, Cho SG, Liu M, et al. Celastrol suppresses invasion of colon and pancreatic cancer cells through the downregulation of expression of CXCR4 chemokine receptor. J Mol Med (Berl). 2010;88(12):1243–53.10.1007/s00109-010-0669-3Suche in Google Scholar PubMed PubMed Central

[33] Luo D, Guo Y, Cheng Y, Zhao J, Wang Y, Rong J. Natural product celastrol suppressed macrophage M1 polarization against inflammation in diet-induced obese mice via regulating Nrf2/HO-1, MAP kinase and NF-kappaB pathways. Aging (Albany NY). 2017;9(10):2069–82.10.18632/aging.101302Suche in Google Scholar PubMed PubMed Central

[34] Xu Q, Chen G, Xu H, Xia G, Zhu M, Zhan H, et al. Celastrol attenuates RANKL-induced osteoclastogenesis in vitro and reduces titanium particle-induced osteolysis and ovariectomy-induced bone loss in vivo. Front Pharmacol. 2021;12:682541.10.3389/fphar.2021.682541Suche in Google Scholar PubMed PubMed Central

[35] Arnaoutova I, Kleinman HK. In vitro angiogenesis: endothelial cell tube formation on gelled basement membrane extract. Nat Protoc. 2010;5(4):628–35.10.1038/nprot.2010.6Suche in Google Scholar PubMed

[36] Zudaire E, Gambardella L, Kurcz C, Vermeren S. A computational tool for quantitative analysis of vascular networks. PLoS One. 2011;6(11):e27385.10.1371/journal.pone.0027385Suche in Google Scholar PubMed PubMed Central

[37] Liu YJ, Wang HJ, Xue ZW, Cheang LH, Tam MS, Li RW, et al. Long noncoding RNA H19 accelerates tenogenic differentiation by modulating miR-140-5p/VEGFA signaling. Eur J Histochem. 2021;65(3):3297.10.4081/ejh.2021.3297Suche in Google Scholar PubMed PubMed Central

[38] Bu X, Guo H, Gao W, Zhang L, Hou J, Li B, et al. Neuroprotection of celastrol against postoperative cognitive dysfunction through dampening cGAS-STING signaling. Exp Neurol. 2024;382:114987.10.1016/j.expneurol.2024.114987Suche in Google Scholar PubMed

[39] Ni M, Lui PP, Rui YF, Lee YW, Lee YW, Tan Q, et al. Tendon-derived stem cells (TDSCs) promote tendon repair in a rat patellar tendon window defect model. J Orthop Res. 2012;30(4):613–9.10.1002/jor.21559Suche in Google Scholar PubMed

[40] Lu YF, Liu Y, Fu WM, Xu J, Wang B, Sun YX, et al. Long noncoding RNA H19 accelerates tenogenic differentiation and promotes tendon healing through targeting miR-29b-3p and activating TGF-beta1 signaling. FASEB J. 2017;31(3):954–64.10.1096/fj.201600722RSuche in Google Scholar PubMed

[41] Capelluto DG, Kutateladze TG, Habas R, Finkielstein CV, He X, Overduin M. The DIX domain targets dishevelled to actin stress fibres and vesicular membranes. Nature. 2002;419(6908):726–9.10.1038/nature01056Suche in Google Scholar PubMed

[42] Liao H, Yu HP, Song W, Zhang G, Lu B, Zhu YJ, et al. Amorphous calcium phosphate nanoparticles using adenosine triphosphate as an organic phosphorus source for promoting tendon-bone healing. J Nanobiotechnol. 2021;19(1):270.10.1186/s12951-021-01007-ySuche in Google Scholar PubMed PubMed Central

[43] Mota Gomes T, Guerra-Pinto F, Soares S, Andrade R, Pereira B, Espregueira-Mendes J, et al. The vascularization of the peroneal tendons: an anatomic study. Foot Ankle Surg. 2021;27(4):450–6.10.1016/j.fas.2020.06.004Suche in Google Scholar PubMed

[44] Li T, Hu J, Gao F, Du X, Chen Y, Wu Q. Transcription factors regulate GPR91-mediated expression of VEGF in hypoxia-induced retinopathy. Sci Rep. 2017;7:45807.10.1038/srep45807Suche in Google Scholar PubMed PubMed Central

[45] Liu X, Zhu B, Li Y, Liu X, Guo S, Wang C, et al. The role of vascular endothelial growth factor in tendon healing. Front Physiol. 2021;12:766080.10.3389/fphys.2021.766080Suche in Google Scholar PubMed PubMed Central

[46] Brown KR, England KM, Goss KL, Snyder JM, Acarregui MJ. VEGF induces airway epithelial cell proliferation in human fetal lung in vitro. Am J Physiol Lung Cell Mol Physiol. 2001;281(4):L1001–10.10.1152/ajplung.2001.281.4.L1001Suche in Google Scholar PubMed

[47] Huang Y, Pan M, Shu H, He B, Zhang F, Sun L. Vascular endothelial growth factor enhances tendon-bone healing by activating Yes-associated protein for angiogenesis induction and rotator cuff reconstruction in rats. J Cell Biochem. 2020;121(3):2343–53.10.1002/jcb.29457Suche in Google Scholar PubMed

[48] Molloy T, Wang Y, Murrell G. The roles of growth factors in tendon and ligament healing. Sports Med. 2003;33(5):381–94.10.2165/00007256-200333050-00004Suche in Google Scholar PubMed

[49] Parsons-Wingerter P, Chandrasekharan UM, McKay TL, Radhakrishnan K, DiCorleto PE, Albarran B, et al. A VEGF165-induced phenotypic switch from increased vessel density to increased vessel diameter and increased endothelial NOS activity. Microvasc Res. 2006;72(3):91–100.10.1016/j.mvr.2006.05.008Suche in Google Scholar PubMed

[50] Pufe T, Petersen WJ, Mentlein R, Tillmann BN. The role of vasculature and angiogenesis for the pathogenesis of degenerative tendons disease. Scand J Med Sci Sports. 2005;15(4):211–22.10.1111/j.1600-0838.2005.00465.xSuche in Google Scholar PubMed

[51] Schulze-Tanzil G, Al-Sadi O, Wiegand E, Ertel W, Busch C, Kohl B, et al. The role of pro-inflammatory and immunoregulatory cytokines in tendon healing and rupture: new insights. Scand J Med Sci Sports. 2011;21(3):337–51.10.1111/j.1600-0838.2010.01265.xSuche in Google Scholar PubMed

[52] Boyer MI, Watson JT, Lou J, Manske PR, Gelberman RH, Cai SR. Quantitative variation in vascular endothelial growth factor mRNA expression during early flexor tendon healing: an investigation in a canine model. J Orthop Res. 2001;19(5):869–72.10.1016/S0736-0266(01)00017-1Suche in Google Scholar PubMed

[53] Petersen W, Pufe T, Unterhauser F, Zantop T, Mentlein R, Weiler A. The splice variants 120 and 164 of the angiogenic peptide vascular endothelial cell growth factor (VEGF) are expressed during Achilles tendon healing. Arch Orthop Trauma Surg. 2003;123(9):475–80.10.1007/s00402-003-0490-3Suche in Google Scholar PubMed

[54] Yoshikawa T, Tohyama H, Enomoto H, Matsumoto H, Toyama Y, Yasuda K. Expression of vascular endothelial growth factor and angiogenesis in patellar tendon grafts in the early phase after anterior cruciate ligament reconstruction. Knee Surg Sports Traumatol Arthrosc. 2006;14(9):804–10.10.1007/s00167-006-0051-8Suche in Google Scholar PubMed

[55] Riggin CN, Rodriguez AB, Weiss SN, Raja HA, Chen M, Schultz SM, et al. Modulation of vascular response after injury in the rat Achilles tendon alters healing capacity. J Orthop Res. 2021;39(9):2000–16.10.1002/jor.24861Suche in Google Scholar PubMed PubMed Central

[56] He K, Zhou X, Zheng F, Ju X, Fu SN, Wong AYL. Histological, physiological and biomechanical effects of low-level laser therapy on tendon healing in animals and humans: a systematic review. Ann Biomed Eng. 2023;51(12):2659–707.10.1007/s10439-023-03364-1Suche in Google Scholar PubMed

[57] Gurtner GC, Werner S, Barrandon Y, Longaker MT. Wound repair and regeneration. Nature. 2008;453(7193):314–21.10.1038/nature07039Suche in Google Scholar PubMed

[58] Jomaa G, Kwan CK, Fu SC, Ling SK, Chan KM, Yung PS, et al. A systematic review of inflammatory cells and markers in human tendinopathy. BMC Musculoskelet Disord. 2020;21(1):78.10.1186/s12891-020-3094-ySuche in Google Scholar PubMed PubMed Central

[59] Schroder K, Tschopp J. The inflammasomes. Cell. 2010;140(6):821–32.10.1016/j.cell.2010.01.040Suche in Google Scholar PubMed

[60] Leemans JC, Cassel SL, Sutterwala FS. Sensing damage by the NLRP3 inflammasome. Immunol Rev. 2011;243(1):152–62.10.1111/j.1600-065X.2011.01043.xSuche in Google Scholar PubMed PubMed Central

[61] Grishman EK, White PC, Savani RC. Toll-like receptors, the NLRP3 inflammasome, and interleukin-1beta in the development and progression of type 1 diabetes. Pediatr Res. 2012;71(6):626–32.10.1038/pr.2012.24Suche in Google Scholar PubMed

[62] Thankam FG, Roesch ZK, Dilisio MF, Radwan MM, Kovilam A, Gross RM, et al. Association of inflammatory responses and ECM disorganization with HMGB1 upregulation and NLRP3 inflammasome activation in the injured rotator cuff tendon. Sci Rep. 2018;8(1):8918.10.1038/s41598-018-27250-2Suche in Google Scholar PubMed PubMed Central

[63] Amores-Iniesta J, Barbera-Cremades M, Martinez CM, Pons JA, Revilla-Nuin B, Martinez-Alarcon L, et al. Extracellular ATP activates the NLRP3 inflammasome and is an early danger signal of skin allograft rejection. Cell Rep. 2017;21(12):3414–26.10.1016/j.celrep.2017.11.079Suche in Google Scholar PubMed PubMed Central

[64] Zhang L, Xu ZJ, Feng YJ, Wang DY. Chemical constituents of roots of Celastrus orbiculatus. Zhong Yao Cai. 2013;36(4):569–72.Suche in Google Scholar

[65] Cascao R, Fonseca JE, Moita LF. Celastrol: a spectrum of treatment opportunities in chronic diseases. Front Med (Lausanne). 2017;4:69.10.3389/fmed.2017.00069Suche in Google Scholar PubMed PubMed Central

[66] Guo L, Zhang Y, Al-Jamal KT. Recent progress in nanotechnology-based drug carriers for celastrol delivery. Biomater Sci. 2021;9(19):6355–80.10.1039/D1BM00639HSuche in Google Scholar

[67] Li GQ, Liu D, Zhang Y, Qian YY, Zhu YD, Guo SY, et al. Anti-invasive effects of celastrol in hypoxia-induced fibroblast-like synoviocyte through suppressing of HIF-1alpha/CXCR4 signaling pathway. Int Immunopharmacol. 2013;17(4):1028–36.10.1016/j.intimp.2013.10.006Suche in Google Scholar PubMed

[68] Deng C, Zhang Q, He P, Zhou B, He K, Sun X, et al. Targeted apoptosis of macrophages and osteoclasts in arthritic joints is effective against advanced inflammatory arthritis. Nat Commun. 2021;12(1):2174.10.1038/s41467-021-22454-zSuche in Google Scholar PubMed PubMed Central

[69] Yang G, Wang K, Song H, Zhu R, Ding S, Yang H, et al. Celastrol ameliorates osteoarthritis via regulating TLR2/NF-kappaB signaling pathway. Front Pharmacol. 2022;13:963506.10.3389/fphar.2022.963506Suche in Google Scholar PubMed PubMed Central

[70] Hu X, Gu Y, Wu Q, Jiang F, Song Z. Celastrol enhances bone wound healing in rats. Acta Biochim Pol. 2022;69(4):839–45.10.18388/abp.2020_6270Suche in Google Scholar PubMed

[71] Yan CY, Ouyang SH, Wang X, Wu YP, Sun WY, Duan WJ, et al. Celastrol ameliorates Propionibacterium acnes/LPS-induced liver damage and MSU-induced gouty arthritis via inhibiting K63 deubiquitination of NLRP3. Phytomedicine. 2021;80:153398.10.1016/j.phymed.2020.153398Suche in Google Scholar PubMed

[72] Penin-Franch A, Garcia-Vidal JA, Martinez CM, Escolar-Reina P, Martinez-Ojeda RM, Gomez AI, et al. Galvanic current activates the NLRP3 inflammasome to promote Type I collagen production in tendon. Elife. 2022;11:e73675.10.7554/eLife.73675Suche in Google Scholar PubMed PubMed Central

[73] Chen Q, Zhou J, Zhang B, Chen Z, Luo Q, Song G. Cyclic stretching exacerbates tendinitis by enhancing NLRP3 inflammasome activity via F-actin depolymerization. Inflammation. 2018;41(5):1731–43.10.1007/s10753-018-0816-5Suche in Google Scholar PubMed

[74] Shi J, Li J, Xu Z, Chen L, Luo R, Zhang C, et al. Celastrol: a review of useful strategies overcoming its limitation in anticancer application. Front Pharmacol. 2020;11:558741.10.3389/fphar.2020.558741Suche in Google Scholar PubMed PubMed Central

Received: 2024-06-28
Revised: 2024-11-28
Accepted: 2024-12-03
Published Online: 2025-05-06

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
  156. Influence of sevoflurane combined with propofol anesthesia on the anesthesia effect and adverse reactions in children with acute appendicitis
  157. Review Articles
  158. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  159. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  160. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  161. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  162. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  163. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  164. The application of augmented reality in robotic general surgery: A mini-review
  165. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  166. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  167. Plant polyphenols, terpenes, and terpenoids in oral health
  168. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  169. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  170. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  171. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  172. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  173. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  174. Giant borderline ovarian tumours – review of the literature
  175. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  176. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  177. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  178. Supplement strategies for infertility in overweight women: Evidence and legal insights
  179. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  180. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  181. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  182. Strategies for hyperkalemia management in dialysis patients: A systematic review
  183. C-reactive protein-to-albumin ratio in peripheral artery disease
  184. Case Reports
  185. Delayed graft function after renal transplantation
  186. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  187. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  188. Giant right atrial hemangioma presenting with ascites: A case report
  189. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  190. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  191. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  192. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  193. Rapid Communication
  194. Biological properties of valve materials using RGD and EC
  195. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  196. Letter to the Editor
  197. Role of enhanced external counterpulsation in long COVID
  198. Expression of Concern
  199. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  200. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  201. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  202. Corrigendum
  203. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  204. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  205. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  206. Retraction
  207. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  208. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  209. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  210. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  211. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  212. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  213. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  214. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  215. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  216. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  217. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  218. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  219. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  220. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  221. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  222. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  223. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  224. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  225. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  226. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  227. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  228. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  229. A review of brain research on T2DM-related cognitive dysfunction
  230. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  231. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  232. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
Heruntergeladen am 10.12.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2024-1121/html
Button zum nach oben scrollen