Startseite Medizin Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
Artikel Open Access

Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway

  • Xianjian Wu , Ruifeng Liang , Guoman Liu , Quan Fang , Zuoming Xu , Wenchuan Li , Chuan Tan und Jian Pu EMAIL logo
Veröffentlicht/Copyright: 19. August 2025

Abstract

Objective

Peptide-encoding roles of lncRNAs are emerging in cancer biology. This study explores the function of the CCAT1-70aa peptide in hepatocellular carcinoma (HCC) and its underlying mechanisms.

Methods

Immunohistochemistry was used to detect CCAT1-70aa expression in HCC and adjacent tissues. An expression vector verified CCAT1’s role in encoding CCAT1-70aa. Cell counting kit-8 and Transwell assays assessed the effects of CCAT1-70aa on HCC cell proliferation and invasion. Small-interfering RNAs (siRNAs) targeting CCAT1 were transfected into HCC cells to examine CCAT1-70aa expression. The role of the MAPK/ERK pathway was confirmed via Western blot and the ERK inhibitor FR180204.

Results

CCAT1-70aa was significantly upregulated in HCC tissues, correlating with tumor stage, serum alpha-fetoprotein levels, and vascular invasion. siRNA-mediated CCAT1 silencing reduced CCAT1-70aa expression, supporting that CCAT1-70aa is translated from lncRNA CCAT1. CCAT1-70aa, a 70-amino acid peptide, enhanced proliferation and invasion, activating the MAPK/ERK pathway, with its effects mitigated by ERK inhibition.

Conclusion

The CCAT1-70aa peptide is overexpressed in HCC and linked to aggressive tumor characteristics. It promotes proliferation and invasion via the MAPK/ERK pathway, providing insights for HCC diagnosis and treatment strategies.

1 Introduction

Hepatocellular carcinoma (HCC), also referred to as liver cancer, is the second most common cancer in China and the third highest cause of cancer-related death globally with a mortality rate of 8.2% [1]. Despite the relatively favorable prognosis with early treatment and a 5-year survival rate exceeding 72%, the annual incidence of HCC in China remains high, reaching 350,000 and accounting for 50% of newly diagnosed cases worldwide [2]. Unfortunately, many HCC patients are diagnosed at advanced stages due to factors, such as tumor size, spread, and co-existing liver disease. This situation often results in suboptimal outcomes [2]. The lack of specific symptoms in the early stages, along with the absence of effective screening mechanisms and early diagnostic methods, leads to many patients presenting with late-stage HCC at their initial clinical consultation [3]. Consequently, there is an urgent need for new diagnostic and therapeutic strategies to improve the prognosis for HCC. In terms of etiology, HCC usually evolves from chronic liver disease, primarily associated with hepatitis B or C virus infection, alcohol consumption, or metabolic syndrome [4]. Although HCC poses a severe threat to human health, the cellular and molecular mechanisms underlying the initiation and progression of HCC are still poorly understood [5]. A more in-depth elucidation of the key molecules and their regulatory mechanisms involved in HCC is crucial in developing more effective treatment strategies for this deadly disease [6].

Long non-coding RNAs (lncRNAs) are RNA molecules longer than 200 nucleotides that lack protein-coding capacity. They have been reported to play significant regulatory roles in various types of cancers [7]. They often participate in disease regulation through mechanisms such as direct binding to specific targets [8], serving as sponges for microRNAs (miRNAs) [9], or through epigenetic processes [10]. The lncRNA colon cancer-associated transcript 1 (lncRNA CCAT1) has been proven to promote various types of cancers, including colorectal cancer, gastric cancer, and pancreatic cancer [11,12,13]. The role of lncRNA CCAT1 in HCC has received extensive investigation in recent literature, for example, recent research indicates that lncRNA CCAT1 is upregulated in HCC and promotes the development of HCC through interactions with let-7 [14], miR-30c-2-3p [15], and miR-222-5p [16]. These pathways include enhancing the resistance of HCC to chemotherapy [17], promoting the proliferation and invasion of HCC cells [18], and promoting autophagy in HCC by regulating ATG7 [19]. Moreover, the aberrant expression of CCAT1 is regulated by c-Myc and can predict the prognosis of HCC [20]. Additionally, CCAT1 regulates the expression of the IRF5 gene by adsorbing miR-375-3p [21], regulates the expression of cell cycle-dependent kinase 1 as a competitive endogenous RNA of miR-490-3p [22], and is activated by tumor-associated macrophages via the CCAT1/let-7b/HMGA2 pathway, thus promoting HCC [23].

Previous studies from our research group have shown that the lncRNA CCAT1 promotes the progression of HCC by enhancing EGFR signaling, as well as through the miR-222-5p/CYLD pathway [16]. Recent studies have indicated that certain lncRNAs possess an open reading frame (ORF) and can encode peptides to participate in disease regulation [24,25]. Our experimental data demonstrate that lncRNA CCAT1 encodes a peptide, confirmed as CCAT1-70aa through in vitro translation assays. The function and mechanism of the peptide CCAT1-70aa in HCC remain unexplored and warrant further investigation. In this study, we aim to elucidate how lncRNA CCAT1 encodes the peptide CCAT1-70aa and how this peptide can promote the proliferation and metastasis of HCC through the mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) pathway. This study aims to deepen our understanding of the molecular mechanisms driving HCC development and progression.

2 Materials and methods

2.1 Clinical samples

From January 2022 to December 2022, 88 cases of HCC and adjacent tissues were collected from the Affiliated Hospital of the Right River Institute of Ethnic Medicine. The inclusion criteria for subjects included (1) absence of preoperative radiotherapy, chemotherapy, or other clinical adjuvant therapies, such as radiofrequency ablation, and (2) HCC diagnosis was confirmed by two or more pathologists. Exclusion criteria included (1) subjects with serious medical conditions, such as heart disease, kidney disease, or other malignant tumors; (2) subjects who had previously undergone radiation therapy or chemotherapy; (3) conditions that might affect their participation in the study, including mental illness, drug or alcohol abuse, etc.; and (4) inability or unwillingness to sign the informed consent. Tumor pathological staging followed the TNM classification of the International Union Against Cancer. Tumor differentiation was assessed using WHO grading criteria. Other information was collected according to routine clinical records.

2.2 Cell culture

The HCC cell lines, Huh-7 and Hep3B, were purchased from Wuhan Procell Life Technology Co., Ltd. The cells were cultured in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. The cells were cultured in an incubator (3111, Thermo Fisher) set at 37°C with 95% air and 5% CO2. The medium was changed 2–3 times per week with a subculture ratio of 1:3. When treating with FR180204 (Sigma-Aldrich, F3672), a concentration of 20 nM was used for 24 h.

2.3 Anti-CCAT1-70aa antibody preparation

The CCAT1-70aa antibody was prepared by SinoBiologica Inc. (Beijing, China). Briefly, a KLH-coupled peptide corresponding to the CCAT1-70aa sequence was synthesized based on the following primers: forward primer 5′-ATGGTTGAGAAAAGTCATC-3′ and reverse primer 5′-AAGTTTTCCTGTGTGGCTC-3′. Polyclonal antibodies against the CCAT1-70aa peptide were obtained from inoculated rabbits.

2.4 Immunohistochemistry

Tissues were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned to a thickness of 4 µm. After deparaffinization, antigen retrieval was performed by high-pressure boiling. Immunohistochemical staining was conducted using a CCAT1-70aa-specific antibody. Visualization was achieved using 3,3′-diaminobenzidine and the intensity of positive staining was quantified to conduct a statistical analysis. The stained sections were examined under a light microscope at magnifications of 200× to assess the distribution and intensity of positive staining.

2.5 Vector construction and cell transfection

The peptide sequence encoded by the lncRNA CCAT1 was predicted using the CPC 2.0 database (http://cpc2.gao-lab.org/). The CCAT1-70aa construct was designed with a 3 × Flag tag at the N-terminus. The full-length sequence of CCAT1-70aa was synthesized according to the gene sequence and cloned into the GV358 vector (element sequence: Ubi-MCS-3FLAG-SV40-EGFP-IRES-puromycin). The vector construction followed the methods outlined in reference [26]. The choice of the GV358 vector was made based on several factors: its ubiquitin promoter enables high expression efficiency in mammalian cells, facilitating robust and stable expression of CCAT1-70aa in HCC cells; the inclusion of EGFP allows for visual tracking of transduction efficiency; and the puromycin resistance marker enables antibiotic selection of successfully transduced cells. Additionally, this vector is compatible with the generation of mutant constructs, essential for studying both wild-type and mutant forms of CCAT1-70aa. After sequencing verification, the vector was co-transfected with helper plasmids into 293T cells. The supernatant was collected, concentrated, and lentivirus was obtained. A sequence from the 5′UTR of lncRNA CCAT1 was added to generate a 5′UTR-70aa sequence. By mutating the start codon ATG to ATT in the predicted ORF sequence, a 5′UTR-70aa-MUT sequence was obtained. A corresponding lentiviral vector was constructed in the same way as the CCAT1-70aa overexpression lentivirus. Hep3B and Huh-7 cells were transduced with the lentivirus in the presence of polybrene at a multiplicity of infection of 10. Transduction efficiency was evaluated under a fluorescence microscope after 96 h and followed by further experiments. An empty GV358 vector containing only the 3× Flag tag, without the CCAT1-70aa insert, was used as the negative control (NC).

For gene knockdown experiments, small-interfering RNAs (siRNAs) targeting CCAT1 were synthesized and transfected into Huh-7 cells using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s protocol. The sequences of the siRNAs were as follows: si-CCAT1#1 (AGCCTTGTAGAAACACTATCA), si-CCAT1#2 (ATCTGATTTGACTAAACATGA), and a non-targeting siRNA control (si-NC, UUCUCCGAACGAGUCACGUTT). The siRNAs and si-NC were synthesized by Guangzhou Anernor Biotechnology Co., Ltd. Huh-7 cells were harvested 48 h post-transfection for subsequent analysis.

2.6 Reverse transcription polymerase chain reaction (RT-PCR)

Total RNA was extracted from Huh-7 cells using TRIzol reagent (Invitrogen, USA) and reverse transcribed into cDNA using the PrimeScript™ RT reagent kit (Takara, Japan). RT-PCR was performed using 2× Taq PCR Master Mix (Takara, Japan) with specific primers for CCAT1-70aa (forward primer: 5′-CATTGGGAAAGGTGCCGAGA-3′, reverse primer: 5′-ACGCTTAGCCATACAGAGCC-3′) and GAPDH (forward primer: 5′-CCAGGTGGTCTCCTCTGA-3′, reverse primer: 5′-GCTGTAGCCAAATCGTTGT-3′). Band intensities were quantified using ImageJ software (NIH, USA), and relative expression levels of CCAT1-70aa were calculated using the 2−ΔΔCt method, with GAPDH as an internal control.

2.7 Western blot

Cells were washed three times with phosphate-buffered saline (PBS) and lysed in cell lysis buffer, followed by incubation at 4°C for 20 min. The lysate was centrifuged at 14,000 rpm for 10 min, and the supernatant was collected and stored at −80°C. Protein concentration was determined using a BCA assay (P0012, Beyotime). Samples were diluted 15-fold and then mixed with 200 μl of BCA working solution, followed by incubation at 37°C for 30 min. Absorbance was measured at 562 nm, and protein concentration in the samples was calculated using a standard curve. The acrylamide gel plates separating gel and stacking gel were prepared. 20 μg of the sample was loaded and electrophoresis was performed at 100 V for approximately 1.5 h. After electrophoresis, the gel was transferred onto a PVDF membrane at 300 mA for 39 min. After blocking the membrane, primary antibodies against CCAT1-70aa, Flag (Abcam, ab205606, 1:2,000), ERK (Abcam, ab32537, 1:1,000), p-ERK (Abcam, ab194770, 1:1,000), Ras (Abcam, ab52939, 1:5,000), c-Raf (Abcam, ab236003, 1:2,000), p-c-Raf (Abcam, ab150365, 1:2,000), MEK (Abcam, ab32576, 1:10,000), p-MEK (Abcam, ab96379, 1:2,000), and GAPDH (Abcam, ab181602, 1:10,000) were added and incubated overnight at 4°C. After washing, the secondary antibody (Abcam, ab6721, 1:10,000) was added and incubated at room temperature for 40 min. Equal volumes of detection reagents A and B were mixed and added to the PVDF membrane (Millipore) for film development. When the bands became clear, the membrane was exposed and fixed for 10 min using the developing solution. The intensity of the bands was analyzed using ImageJ software (V1.8.0, National Institutes of Health) after scanning the film. GAPDH was used as an internal reference to calculate relative protein expression.

2.8 Immunofluorescence

Cell smear slides were prepared and incubated at 60°C for 30 min. The slides were deparaffinized in xylene and rehydrated in a descending ethanol series, followed by a distilled water rinse. Antigen retrieval was conducted using citrate buffer and microwave heating, before washing with PBS. Endogenous peroxidase activity was blocked with 3% H2O2, and slides were washed with PBS. An optional step involved treating the slides with an autofluorescence quencher A prior to immunolabeling. Serum blocking was performed, followed by incubation with the primary antibody, recombinant Anti-DDDDK tag (Binds to FLAG® tag sequence) antibody (Abcam, ab205606, 1:100) overnight at 4°C. Slides were then washed and incubated with the fluorescent secondary antibody (A0516, Beyotime, 1:200) at 37°C, followed by further washing. Operations from this point were performed in the dark. 4′,6-Diamidino-2-phenylindole (DAPI) was used for nucleus staining with subsequent PBS washes. The slides were treated with autofluorescence quencher B. Finally, the slides were dried slightly, sealed with a fluorescence quenching sealant, and observed under a fluorescence microscope (DM2000 LED, Leica Camera AG).

2.9 Cell counting kit-8 (CCK-8) assay

HCC cells were resuspended in culture medium and seeded in a 96-well plate at a density of 1 × 104 cells per well. The plate was then incubated at 37°C in a 5% CO2 atmosphere. Pre-diluted CCK-8 reagent (Dojindo, Shanghai, China) was added, and the plate was further incubated to allow the cells to react. Absorbance at 450 nm was measured for each well using a spectrophotometer (UV-1900, Shimadzu) for 5 consecutive days.

2.10 Transwell assay

The upper chamber of the transwell (3422, Corning) was pre-coated with Matrigel (354248, Corning) and then equilibrated at 37°C. After treatment, HCC cells were resuspended in culture medium and seeded in the upper chamber of the transwell at a density of 1 × 104 cells per well in the lower chamber. Culture medium containing 10% serum was added to the lower chamber. The transwell was then incubated in a 37°C, 5% CO2 cell culture incubator for 24 h. After incubation, cells that did not migrate through the pores were removed from the upper chamber, while the cells that had migrated were fixed with paraformaldehyde and stained with crystal violet (C0121, Beyotime). Finally, the stained cells were counted under a microscope (DS-Fi3, Nikon).

2.11 Statistical analysis

All data were analyzed using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA). Quantitative data were presented as mean ± standard deviation (SD). Comparisons between groups were conducted using Student’s t-test or one-way analysis of variance, depending on the number of groups and the distribution of the data. Chi-square tests were used to analyze categorical data. The p-value of <0.05 was considered statistically significant.

  1. Informed consent: All subjects signed an informed consent.

  2. Ethical approval: All procedures were approved by the Ethics Committee of the Affiliated Hospital of the Youjiang Medical University for Nationalities of Ethnic Medicine (ethics review number: YYFY-LL-2013-128).

3 Results

3.1 The peptide CCAT1-70aa is significantly overexpressed in HCC

Immunohistochemistry results demonstrated that CCAT1-70aa is highly expressed in HCC tissues but minimally in the adjacent non-tumorous liver tissues (Figure 1a). Quantitative analysis of immunohistochemistry showed that the positive cell percentage of CCAT1-70aa in HCC tissues is significantly higher than in normal adjacent tissues (P < 0.001, Figure 1b). Furthermore, the overexpression of CCAT1-70aa is significantly associated with the tumor pathological stage (P = 0.049), serum alpha-fetoprotein (AFP) concentration (P = 0.030), and vascular invasion (P = 0.020), as shown in Table 1, suggesting that CCAT1-70aa may serve as a potential biomarker for the diagnosis and prognosis of HCC.

Figure 1 
                  Overexpression of peptide CCAT1-70aa in HCC. (a) Immunohistochemistry of CCAT1-70aa. (b) Quantitative comparison of CCAT1-70aa expression. Means ± SD (n = 44, ***P < 0.001).
Figure 1

Overexpression of peptide CCAT1-70aa in HCC. (a) Immunohistochemistry of CCAT1-70aa. (b) Quantitative comparison of CCAT1-70aa expression. Means ± SD (n = 44, ***P < 0.001).

Table 1

Correlation of CCAT1-70aa expression with characteristics of HCC patients

Characteristics CCAT1-70aa P value
Low (n = 44) High (n = 44)
Age 0.286
>50 20 25
≤50 24 19
Gender 0.269
Male 34 38
Female 10 6
Pathologic stage 0.049*
I + II 37 29
III + IV 7 15
Tumor size (cm) 0.517
>5 27 24
≤5 17 20
AFP (ng/ml) 0.030*
≤400 23 13
>400 21 31
Vascular invasion 0.020*
No 41 33
Yes 3 11

AFP: alpha-fetoprotein. *P < 0.05.

3.2 Investigation of CCAT1-70aa as a peptide encoded by lncRNA CCAT1

Database annotation suggested that lncRNA CCAT1 possesses an open reading frame capable of encoding a peptide of 70 amino acids (Figure 2a). The expression constructs were tagged with a 3× Flag epitope, and both the Western blot and immunofluorescence analyses were performed using anti-Flag antibodies to specifically detect the CCAT1-70aa peptide. Western blot analysis disclosed no band in the NC group or 5′UTR-70aa-MUT group, whereas a band of 11 kDa was detected in the CCAT1-70aa group and 5′UTR-70aa group (Figure 2b). This corresponds to the expected size of the peptide: 70 amino acids (70 × 110 Da = 7.7 kDa) plus 3× Flag (2.73 kDa) equals approximately 10.4 kDa, which is consistent with an 11 kDa band. Immunofluorescence results further confirmed that the CCAT1-70aa peptide is expressed exclusively in the CCAT1-70aa group and the 5′UTR-70aa group, with expression observed in both the nucleus and cytoplasm (Figure 2c).

Figure 2 
                  Investigation of CCAT1-70aa as a peptide encoded by lncRNA CCAT1. (a) Open reading frame in lncRNA CCAT1 encoding a peptide was predicted using CPC 2.0 database. (b) Western blot. (c) Immunofluorescence. Blue indicates DAPI staining for nuclear visualization, and red represents the fluorescence signal of CCAT1-70aa, marking the expression location of the CCAT1-70aa protein. (d) RT-PCR analysis of CCAT1 expression after knockdown with si-CCAT1#1 and si-CCAT1#2. (e) Western blot analysis of CCAT1-70aa protein expression after CCAT1 knockdown. Mean ± SD (n = 3, ***P < 0.001).
Figure 2

Investigation of CCAT1-70aa as a peptide encoded by lncRNA CCAT1. (a) Open reading frame in lncRNA CCAT1 encoding a peptide was predicted using CPC 2.0 database. (b) Western blot. (c) Immunofluorescence. Blue indicates DAPI staining for nuclear visualization, and red represents the fluorescence signal of CCAT1-70aa, marking the expression location of the CCAT1-70aa protein. (d) RT-PCR analysis of CCAT1 expression after knockdown with si-CCAT1#1 and si-CCAT1#2. (e) Western blot analysis of CCAT1-70aa protein expression after CCAT1 knockdown. Mean ± SD (n = 3, ***P < 0.001).

To further validate whether CCAT1-70aa is naturally translated from lncRNA CCAT1, CCAT1 knockdown experiments in Huh-7 cells were performed. RT-PCR analysis revealed that silencing CCAT1 using two independent siRNAs (si-CCAT1#1 and si-CCAT1#2) significantly reduced CCAT1 expression compared to the si-NC group (Figure 2d). Western blot analysis further demonstrated that CCAT1-70aa protein expression was significantly decreased following CCAT1 knockdown (Figure 2e). These findings indicate a potential for CCAT1-70aa to be encoded by lncRNA CCAT1.

3.3 CCAT1-70aa promotes the proliferation and invasion of Huh-7 and Hep3B cells

The CCK-8 assay indicated that in Huh-7 and Hep3B cells, the CCAT1-70aa group significantly promoted cell viability compared to the NC group (P < 0.001). Similarly, 5′UTR-70aa significantly promoted cell viability compared to the 5′UTR-70aa-MUT group (P < 0.001, Figure 3a). Transwell assay results displayed that in Huh-7 and Hep3B cells, compared to the NC group, the CCAT1-70aa group had a significant increase in invasive cells (P < 0.001). Compared to the 5′UTR-70aa-MUT group, the 5′UTR-70aa group had a significant increase in invasive cells (P < 0.001, Figure 3b). These results suggest that CCAT1-70aa promotes the proliferation and invasion of Hep3B and Huh-7 HCC cells.

Figure 3 
                  CCAT1-70aa promotes the proliferation and invasion of Huh-7 and Hep3B cells. (a) CCK-8 assay. (b) Transwell assay. Mean ± SD (n = 3, ***P < 0.001).
Figure 3

CCAT1-70aa promotes the proliferation and invasion of Huh-7 and Hep3B cells. (a) CCK-8 assay. (b) Transwell assay. Mean ± SD (n = 3, ***P < 0.001).

3.4 CCAT1-70aa promotes Huh-7 cell proliferation and invasion via the MAPK/ERK pathway

In Huh-7 cells, Western blot analysis revealed that, compared to the NC group, the relative protein expression levels of p-ERK/ERK, Ras, p-c-Raf/c-Raf, and p-MEK/MEK were significantly increased in the CCAT1-70aa group (P < 0.001). In contrast, these protein expression levels were significantly decreased in the CCAT1-70aa + FR180204 group compared to the CCAT1-70aa group (P < 0.001, Figure 4a and b). CCK-8 assays showed that cell viability was significantly higher in the CCAT1-70aa group than in the NC group (P < 0.001), whereas cell viability significantly decreased in the CCAT1-70aa + FR180204 group compared to the CCAT1-70aa group (P < 0.001, Figure 4c). Transwell assays indicated a significant increase in the number of invasive cells in the CCAT1-70aa group compared to the NC group (P < 0.001), while the number of invasive cells was significantly reduced in the CCAT1-70aa + FR180204 group compared to the CCAT1-70aa group (P < 0.001, Figure 4d). These findings suggest that CCAT1-70aa activates the MAPK/ERK pathway and that the ERK inhibitor FR180204 can attenuate the proliferative and invasive effects of CCAT1-70aa in Huh-7 cells, supporting that CCAT1-70aa promotes HCC cell proliferation and invasion via the MAPK/ERK pathway.

Figure 4 
                  CCAT1-70aa promotes Huh-7 cell proliferation and invasion via the MAPK/ERK pathway. (a) Western blot showing expression of ERK and p-ERK proteins. (b) Western blot showing expression of MAPK/ERK pathway proteins. (c) CCK-8 assay. (d) Transwell assay. Mean ± SD (n = 3, ***P < 0.001).
Figure 4

CCAT1-70aa promotes Huh-7 cell proliferation and invasion via the MAPK/ERK pathway. (a) Western blot showing expression of ERK and p-ERK proteins. (b) Western blot showing expression of MAPK/ERK pathway proteins. (c) CCK-8 assay. (d) Transwell assay. Mean ± SD (n = 3, ***P < 0.001).

4 Discussion

HCC is one of the most common and lethal malignant tumors, and the urgent need in clinical practice is to further improve its diagnosis and treatment [27]. Peptides, characterized by their small size, stability, capacity for systemic migration, low immunogenicity, and ability to be secreted into the bloodstream, are promising clinical diagnostic biomarkers [28,29]. Our research suggests that the peptide CCAT1-70aa is significantly overexpressed in HCC, and its high expression is strongly correlated with tumor pathological staging, serum AFP concentration, and vascular invasion. This implies that CCAT1-70aa could potentially serve as an auxiliary diagnostic indicator for HCC to determine the progression of the tumor. It remains to be investigated whether CCAT1-70aa is secreted into the bloodstream and whether its expression in the blood is correlated with the pathophysiology of HCC, which requires further investigation. Moreover, siRNA-mediated silencing of CCAT1 significantly reduced CCAT1-70aa expression. This supports the notion that CCAT1-70aa is translated from lncRNA CCAT1, though further validation is needed to confirm direct translation.

Non-coding RNAs, through the peptides they encode, have emerged as a novel regulatory mechanism playing significant roles in HCC. For instance, a novel peptide encoded by N6-methyladenosine modified circMAP3K4 inhibits apoptosis in HCC cells [30]. The endogenous peptide SMIM30, encoded by LINC00998, promotes the development of HCC by inducing the activation of SRC/YES1 and the MAPK pathway [31]. Additionally, the peptide PINT87aa, encoded by lncRNA, induces cellular senescence in HCC by blocking FOXM1-mediated PHB2 transcription [32]. A novel polypeptide, encoded by the circular RNA ZKSCAN1, has been shown to suppress HCC by degrading mTOR [33]. Similar studies have reported the involvement of peptides encoded by non-coding RNAs in various other tumors [34]. Our study indicates that CCAT1-70aa is potentially encoded by lncRNA CCAT1 and promotes the proliferation and invasion of HCC cells via the MAPK/ERK pathway. This defines a novel functional peptide in HCC, which also provides a reference for studying the function and mechanism of this peptide.

The MAPK family plays crucial roles in a wide range of physiological and pathological processes. ERK, c-Jun N-terminal kinase (JNK), and p38MAPK are typical representatives of MAPKs, which can be activated in HCC [35]. Upon activation by RAS, RAF protein kinases RAF1 and c-Raf are phosphorylated and subsequently activate their dual-specificity protein kinase substrates MEK1 and MEK2 (also known as MAP2K1 and MAP2K2) [36]. Subsequently, MEK1/2 phosphorylates substrates such as ERK, thereby regulating proliferation, differentiation, and migration, among others [37]. Research shows that the MAPK/ERK pathway is extensively involved in the progression regulation of various tumors, and targeted inhibition of the MAPK/ERK pathway has become one of the potential tumor treatment methods [38]. CCAT1-70aa promotes HCC cell proliferation and invasion via the MAPK/ERK pathway. Inhibiting the expression of the CCAT1-70aa peptide and thereby inhibiting the MAPK/ERK pathway may be a potential therapeutic approach for treating HCC. Studies on peptide-drug conjugate-based novel molecular drug delivery systems [39] and novel peptide therapeutic approaches for cancer treatment [40] have opened more possibilities for the application of peptides in clinical cancer treatment.

However, our study has certain limitations. First, we could not conduct in vivo animal studies to verify the function and mechanism of CCAT1-70aa. Second, we lack further molecular biological experiments to confirm how the CCAT1-70aa peptide regulates the MAPK/ERK pathway through interaction. Additionally, although our study explored the relationship between the CCAT1-70aa peptide and the clinical pathology of HCC, survival analysis was not conducted, and the clinical samples used for verification were limited to formalin-fixed paraffin-embedded tissues, which restricts our ability to perform more analyses on HCC tumors versus normal adjacent tissues. As a result, we were unable to confirm the expression of CCAT1-70aa in the context of surrounding normal tissues. Furthermore, we did not include a group treated with only FR180204, as the focus of our study was on the effects of CCAT1-70aa. However, this absence does represent a limitation in evaluating the specific effects of FR180204 alone. Therefore, further validation is needed with more clinical samples from multiple institutions.

In conclusion, our study reveals that CCAT1-70aa, a peptide composed of 70 amino acids potentially encoded by lncRNA CCAT1, is significantly overexpressed in HCC. High expression of CCAT1-70aa correlates significantly with tumor pathological staging, serum AFP concentration, and vascular invasion. CCAT1-70aa promotes the proliferation and invasion of HCC cells via the MAPK/ERK pathway. This provides fresh insights and avenues for the diagnosis and treatment of HCC.

Acknowledgments

Not applicable.

  1. Funding information: This work was supported by the Education Department of Guangxi Zhuang Autonomous Region (2022KY0540) and the Affiliated Hospital of Youjiang Medical University for Nationalities (Y20212611).

  2. Author contributions: XJW designed the study and performed immunohistochemistry testing. RFL constructed the CCAT1 expression vector and conceptualized the study. GML conducted cell proliferation and invasion assays. QF assisted in these assays and confirmed the role of the MAPK/ERK pathway using s Western blot. ZMX supervised the experimental procedures. WCL analyzed data. CT analyzed data regarding the mechanistic aspect. JP led the manuscript writing as the corresponding author. All authors approved the final manuscript.

  3. Conflict of interest: The authors declare that they have no conflicts of interest.

  4. Data availability statement: The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

References

[1] Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin. 2023;73(1):17–48. 10.3322/caac.21763.Suche in Google Scholar PubMed

[2] Zhang CH, Cheng Y, Zhang S, Fan J, Gao Q. Changing epidemiology of hepatocellular carcinoma in Asia. Liver Int. 2022;42(9):2029–41. 10.1111/liv.15251.Suche in Google Scholar PubMed

[3] Vogel A, Meyer T, Sapisochin G, Salem R, Saborowski A. Hepatocellular carcinoma. Lancet. 2022;400(10360):1345–62. 10.1016/s0140-6736(22)01200-4.Suche in Google Scholar

[4] Ganesan P, Kulik LM. Hepatocellular carcinoma: New developments. Clin Liver Dis. 2023;27(1):85–102. 10.1016/j.cld.2022.08.004.Suche in Google Scholar PubMed

[5] Brown ZJ, Tsilimigras DI, Ruff SM, Mohseni A, Kamel IR, Cloyd JM, et al. Management of hepatocellular carcinoma: A review. JAMA Surg. 2023;158(4):410–20. 10.1001/jamasurg.2022.7989.Suche in Google Scholar PubMed

[6] Yang C, Zhang H, Zhang L, Zhu AX, Bernards R, Qin W, et al. Evolving therapeutic landscape of advanced hepatocellular carcinoma. Nat Rev Gastroenterol Hepatol. 2023;20(4):203–22. 10.1038/s41575-022-00704-9.Suche in Google Scholar PubMed

[7] Anbiyaiee A, Ramazii M, Bajestani SS, Meybodi SM, Keivan M, Khoshnam SE, et al. The function of LncRNA-ATB in cancer. Clin Transl Oncol. 2023;25(1):1–9. 10.1007/s12094-022-02848-1.Suche in Google Scholar PubMed

[8] Lv C, Yu H, Wang K, Chen C, Tang J, Han F, et al. ENO2 promotes colorectal cancer metastasis by interacting with the LncRNA CYTOR and activating YAP1-induced EMT. Cells. 2022;11(15):2363. 10.3390/cells11152363.Suche in Google Scholar PubMed PubMed Central

[9] Shetty A, Venkatesh T, Kabbekodu SP, Tsutsumi R, Suresh PS. LncRNA-miRNA-mRNA regulatory axes in endometrial cancer: A comprehensive overview. Arch Gynecol Obstet. 2022;306(5):1431–47. 10.1007/s00404-022-06423-5.Suche in Google Scholar PubMed

[10] Fang D, Ou X, Sun K, Zhou X, Li Y, Shi P, et al. m6A modification-mediated lncRNA TP53TG1 inhibits gastric cancer progression by regulating CIP2A stability. Cancer Sci. 2022;113(12):4135–50. 10.1111/cas.15581.Suche in Google Scholar PubMed PubMed Central

[11] Han W, Sulidankazha Q, Nie X, Yilidan R, Len K. Pancreatic cancer cells-derived exosomal long non-coding RNA CCAT1/microRNA-138-5p/HMGA1 axis promotes tumor angiogenesis. Life Sci. 2023;319:121429. 10.1016/j.lfs.2023.121429.Suche in Google Scholar PubMed

[12] Li B, Zheng L, Ye J, Zhang C, Zhou J, Huang Q, et al. CREB1 contributes colorectal cancer cell plasticity by regulating lncRNA CCAT1 and NF-κB pathways. Sci China Life Sci. 2022;65(8):1481–97. 10.1007/s11427-022-2108-x.Suche in Google Scholar PubMed

[13] Yang F, Peng ZX, Ji WD, Yu JD, Qian C, Liu JD, et al. LncRNA CCAT1 upregulates ATG5 to enhance autophagy and promote gastric cancer development by absorbing miR-140-3p. Dig Dis Sci. 2022;67(8):3725–41. 10.1007/s10620-021-07187-9.Suche in Google Scholar PubMed

[14] Deng L, Yang SB, Xu FF, Zhang JH. Long noncoding RNA CCAT1 promotes hepatocellular carcinoma progression by functioning as let-7 sponge. J Exp Clin Cancer Res. 2015;34(1):18. 10.1186/s13046-015-0136-7.Suche in Google Scholar PubMed PubMed Central

[15] Zhang J, Cai M, Jiang D, Xu L. Upregulated LncRNA-CCAT1 promotes hepatocellular carcinoma progression by functioning as miR-30c-2-3p sponge. Cell Biochem Funct. 2019;37(2):84–92. 10.1002/cbf.3375.Suche in Google Scholar PubMed

[16] Pu J, Wu X, Wu Y, Shao Z, Luo C, Tang Q, et al. Anti-oncogenic effects of SOX2 silencing on hepatocellular carcinoma achieved by upregulating miR-222-5p-dependent CYLD via the long noncoding RNA CCAT1. Aging (Albany NY). 2021;13(8):12207–23. 10.18632/aging.103797.Suche in Google Scholar PubMed PubMed Central

[17] Xia C, Sun Y, Li Y, Ma J, Shi J. LncRNA CCAT1 enhances chemoresistance in hepatocellular carcinoma by targeting QKI-5. Sci Rep. 2022;12(1):7826. 10.1038/s41598-022-11644-4.Suche in Google Scholar PubMed PubMed Central

[18] Zhu H, Zhou X, Chang H, Li H, Liu F, Ma C, et al. CCAT1 promotes hepatocellular carcinoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015;8(5):5427–34.Suche in Google Scholar

[19] Guo J, Ma Y, Peng X, Jin H, Liu J. LncRNA CCAT1 promotes autophagy via regulating ATG7 by sponging miR-181 in hepatocellular carcinoma. J Cell Biochem. 2019;120(10):17975–83. 10.1002/jcb.29064.Suche in Google Scholar PubMed

[20] Zhu HQ, Zhou X, Chang H, Li HG, Liu FF, Ma CQ, et al. Aberrant expression of CCAT1 regulated by c-Myc predicts the prognosis of hepatocellular carcinoma. Asian Pac J Cancer Prev. 2015;16(13):5181–5. 10.7314/apjcp.2015.16.13.5181.Suche in Google Scholar PubMed

[21] Liu Z, Ma C, Tang X, Tang Q, Lou L, Yu Y, et al. The reciprocal interaction between LncRNA CCAT1 and miR-375-3p contribute to the downregulation of IRF5 gene expression by solasonine in HepG2 human hepatocellular carcinoma cells. Front Oncol. 2019;9:1081. 10.3389/fonc.2019.01081.Suche in Google Scholar PubMed PubMed Central

[22] Dou C, Sun L, Jin X, Han M, Zhang B, Li T. Long non-coding RNA colon cancer-associated transcript 1 functions as a competing endogenous RNA to regulate cyclin-dependent kinase 1 expression by sponging miR-490-3p in hepatocellular carcinoma progression. Tumour Biol. 2017;39(4):1010428317697572. 10.1177/1010428317697572.Suche in Google Scholar PubMed

[23] Deng L, Huang S, Chen B, Tang Y, Huang F, Li D, et al. Tumor-linked macrophages promote HCC development by mediating the CCAT1/Let-7b/HMGA2 signaling pathway. Onco Targets Ther. 2020;13:12829–43. 10.2147/ott.s283786.Suche in Google Scholar

[24] Choi SW, Kim HW, Nam JW. The small peptide world in long noncoding RNAs. Brief Bioinform. 2019;20(5):1853–64. 10.1093/bib/bby055.Suche in Google Scholar PubMed PubMed Central

[25] Zou Q, Du X, Zhou L, Yao D, Dong Y, Jin J. A short peptide encoded by long non-coding RNA small nucleolar RNA host gene 6 promotes cell migration and epithelial-mesenchymal transition by activating transforming growth factor-beta/SMAD signaling pathway in human endometrial cells. J Obstet Gynaecol Res. 2023;49(1):232–42. 10.1111/jog.15476.Suche in Google Scholar PubMed

[26] Huang JZ, Chen M, Chen D, Gao XC, Zhu S, Huang H, et al. A peptide encoded by a putative lncRNA HOXB-AS3 suppresses colon cancer growth. Mol Cell. 2017;68(1):171–84.e6. 10.1016/j.molcel.2017.09.015.Suche in Google Scholar PubMed

[27] Johnson P, Zhou Q, Dao DY, Lo YMD. Circulating biomarkers in the diagnosis and management of hepatocellular carcinoma. Nat Rev Gastroenterol Hepatol. 2022;19(10):670–81. 10.1038/s41575-022-00620-y.Suche in Google Scholar PubMed

[28] Mahendru S, Roy K, Kukreti S. Peptide biomarkers: Exploring the diagnostic aspect. Curr Protein Pept Sci. 2017;18(9):914–9. 10.2174/1389203717666160724203746.Suche in Google Scholar PubMed

[29] Tang Y, Xu H, Dai Y, Wang F, Huang W, Liu P, et al. A novel peptide targeting c-Met for hepatocellular carcinoma diagnosis. J Mater Chem B. 2021;9(22):4577–86. 10.1039/d1tb00408e.Suche in Google Scholar PubMed

[30] Duan JL, Chen W, Xie JJ, Zhang ML, Nie RC, Liang H, et al. A novel peptide encoded by N6-methyladenosine modified circMAP3K4 prevents apoptosis in hepatocellular carcinoma. Mol Cancer. 2022;21(1):93. 10.1186/s12943-022-01537-5.Suche in Google Scholar PubMed PubMed Central

[31] Pang Y, Liu Z, Han H, Wang B, Li W, Mao C, et al. Peptide SMIM30 promotes HCC development by inducing SRC/YES1 membrane anchoring and MAPK pathway activation. J Hepatol. 2020;73(5):1155–69. 10.1016/j.jhep.2020.05.028.Suche in Google Scholar PubMed

[32] Xiang X, Fu Y, Zhao K, Miao R, Zhang X, Ma X, et al. Cellular senescence in hepatocellular carcinoma induced by a long non-coding RNA-encoded peptide PINT87aa by blocking FOXM1-mediated PHB2. Theranostics. 2021;11(10):4929–44. 10.7150/thno.55672.Suche in Google Scholar PubMed PubMed Central

[33] Song R, Ma S, Xu J, Ren X, Guo P, Liu H, et al. A novel polypeptide encoded by the circular RNA ZKSCAN1 suppresses HCC via degradation of mTOR. Mol Cancer. 2023;22(1):16. 10.1186/s12943-023-01719-9.Suche in Google Scholar PubMed PubMed Central

[34] Wu P, Mo Y, Peng M, Tang T, Zhong Y, Deng X, et al. Emerging role of tumor-related functional peptides encoded by lncRNA and circRNA. Mol Cancer. 2020;19(1):22. 10.1186/s12943-020-1147-3.Suche in Google Scholar PubMed PubMed Central

[35] Wang Q, Feng J, Tang L. Non-coding RNA related to MAPK signaling pathway in liver cancer. Int J Mol Sci. 2022;23(19):11908. 10.3390/ijms231911908.Suche in Google Scholar PubMed PubMed Central

[36] Roskoski Jr R . MEK1/2 dual-specificity protein kinases: Structure and regulation. Biochem Biophys Res Commun. 2012;417(1):5–10. 10.1016/j.bbrc.2011.11.145.Suche in Google Scholar PubMed

[37] Ullah R, Yin Q, Snell AH, Wan L. RAF-MEK-ERK pathway in cancer evolution and treatment. Semin Cancer Biol. 2022;85:123–54. 10.1016/j.semcancer.2021.05.010.Suche in Google Scholar PubMed

[38] Park JI. MAPK-ERK pathway. Int J Mol Sci. 2023;24(11):9666. 10.3390/ijms24119666.Suche in Google Scholar PubMed PubMed Central

[39] Zhu YS, Tang K, Lv J. Peptide-drug conjugate-based novel molecular drug delivery system in cancer. Trends Pharmacol Sci. 2021;42(10):857–69. 10.1016/j.tips.2021.07.001.Suche in Google Scholar PubMed

[40] Li CM, Haratipour P, Lingeman RG, Perry JJP, Gu L, Hickey RJ, et al. Novel peptide therapeutic approaches for cancer treatment. Cells. 2021;10(11):2908. 10.3390/cells10112908.Suche in Google Scholar PubMed PubMed Central

Received: 2024-06-04
Revised: 2025-04-02
Accepted: 2025-04-29
Published Online: 2025-08-19

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Network pharmacological analysis and in vitro testing of the rutin effects on triple-negative breast cancer
  3. Impact of diabetes on long-term survival in elderly liver cancer patients: A retrospective study
  4. Knockdown of CCNB1 alleviates high glucose-triggered trophoblast dysfunction during gestational diabetes via Wnt/β-catenin signaling pathway
  5. Risk factors for severe adverse drug reactions in hospitalized patients
  6. Analysis of the effect of ALA-PDT on macrophages in footpad model of mice infected with Fonsecaea monophora based on single-cell sequencing
  7. Development and validation of headspace gas chromatography with a flame ionization detector method for the determination of ethanol in the vitreous humor
  8. CMSP exerts anti-tumor effects on small cell lung cancer cells by inducing mitochondrial dysfunction and ferroptosis
  9. Predictive value of plasma sB7-H3 and YKL-40 in pediatric refractory Mycoplasma pneumoniae pneumonia
  10. Antiangiogenic potential of Elaeagnus umbellata extracts and molecular docking study by targeting VEGFR-2 pathway
  11. Comparison of the effectiveness of nurse-led preoperative counseling and postoperative follow-up care vs standard care for patients with gastric cancer
  12. Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis
  13. Adhered macrophages as an additional marker of cardiomyocyte injury in biopsies of patients with dilated cardiomyopathy
  14. Association between statin administration and outcome in patients with sepsis: A retrospective study
  15. Exploration of the association between estimated glucose disposal rate and osteoarthritis in middle-aged and older adults: An analysis of NHANES data from 2011 to 2018
  16. A comparative analysis of the binary and multiclass classified chest X-ray images of pneumonia and COVID-19 with ML and DL models
  17. Lysophosphatidic acid 2 alleviates deep vein thrombosis via protective endothelial barrier function
  18. Transcription factor A, mitochondrial promotes lymph node metastasis and lymphangiogenesis in epithelial ovarian carcinoma
  19. Serum PM20D1 levels are associated with nutritional status and inflammatory factors in gastric cancer patients undergoing early enteral nutrition
  20. Hydromorphone reduced the incidence of emergence agitation after adenotonsillectomy in children with obstructive sleep apnea: A randomized, double-blind study
  21. Vitamin D replacement therapy may regulate sleep habits in patients with restless leg syndrome
  22. The first-line antihypertensive nitrendipine potentiated the therapeutic effect of oxaliplatin by downregulating CACNA1D in colorectal cancer
  23. Health literacy and health-related quality of life: The mediating role of irrational happiness
  24. Modulatory effects of Lycium barbarum polysaccharide on bone cell dynamics in osteoporosis
  25. Mechanism research on inhibition of gastric cancer in vitro by the extract of Pinellia ternata based on network pharmacology and cellular metabolomics
  26. Examination of the causal role of immune cells in non-alcoholic fatty liver disease by a bidirectional Mendelian randomization study
  27. Clinical analysis of ten cases of HIV infection combined with acute leukemia
  28. Investigating the cardioprotective potential of quercetin against tacrolimus-induced cardiotoxicity in Wistar rats: A mechanistic insights
  29. Clinical observation of probiotics combined with mesalazine and Yiyi Baitouweng Decoction retention enema in treating mild-to-moderate ulcerative colitis
  30. Diagnostic value of ratio of blood inflammation to coagulation markers in periprosthetic joint infection
  31. Sex-specific associations of sex hormone binding globulin and risk of bladder cancer
  32. Core muscle strength and stability-oriented breathing training reduces inter-recti distance in postpartum women
  33. The ERAS nursing care strategy for patients undergoing transsphenoidal endoscopic pituitary tumor resection: A randomized blinded controlled trial
  34. The serum IL-17A levels in patients with traumatic bowel rupture post-surgery and its predictive value for patient prognosis
  35. Impact of Kolb’s experiential learning theory-based nursing on caregiver burden and psychological state of caregivers of dementia patients
  36. Analysis of serum NLR combined with intraoperative margin condition to predict the prognosis of cervical HSIL patients undergoing LEEP surgery
  37. Commiphora gileadensis ameliorate infertility and erectile dysfunction in diabetic male mice
  38. The correlation between epithelial–mesenchymal transition classification and MMP2 expression of circulating tumor cells and prognosis of advanced or metastatic nasopharyngeal carcinoma
  39. Tetrahydropalmatine improves mitochondrial function in vascular smooth muscle cells of atherosclerosis in vitro by inhibiting Ras homolog gene family A/Rho-associated protein kinase-1 signaling pathway
  40. A cross-sectional study: Relationship between serum oxidative stress levels and arteriovenous fistula maturation in maintenance dialysis patients
  41. A comparative analysis of the impact of repeated administration of flavan 3-ol on brown, subcutaneous, and visceral adipose tissue
  42. Identifying early screening factors for depression in middle-aged and older adults: A cohort study
  43. Perform tumor-specific survival analysis for Merkel cell carcinoma patients undergoing surgical resection based on the SEER database by constructing a nomogram chart
  44. Unveiling the role of CXCL10 in pancreatic cancer progression: A novel prognostic indicator
  45. High-dose preoperative intraperitoneal erythropoietin and intravenous methylprednisolone in acute traumatic spinal cord injuries following decompression surgeries
  46. RAB39B: A novel biomarker for acute myeloid leukemia identified via multi-omics and functional validation
  47. Impact of peripheral conditioning on reperfusion injury following primary percutaneous coronary intervention in diabetic and non-diabetic STEMI patients
  48. Clinical efficacy of azacitidine in the treatment of middle- and high-risk myelodysplastic syndrome in middle-aged and elderly patients: A retrospective study
  49. The effect of ambulatory blood pressure load on mitral regurgitation in continuous ambulatory peritoneal dialysis patients
  50. Expression and clinical significance of ITGA3 in breast cancer
  51. Single-nucleus RNA sequencing reveals ARHGAP28 expression of podocytes as a biomarker in human diabetic nephropathy
  52. rSIG combined with NLR in the prognostic assessment of patients with multiple injuries
  53. Toxic metals and metalloids in collagen supplements of fish and jellyfish origin: Risk assessment for daily intake
  54. Exploring causal relationship between 41 inflammatory cytokines and marginal zone lymphoma: A bidirectional Mendelian randomization study
  55. Gender beliefs and legitimization of dating violence in adolescents
  56. Effect of serum IL-6, CRP, and MMP-9 levels on the efficacy of modified preperitoneal Kugel repair in patients with inguinal hernia
  57. Effect of smoking and smoking cessation on hematological parameters in polycythemic patients
  58. Pathogen surveillance and risk factors for pulmonary infection in patients with lung cancer: A retrospective single-center study
  59. Necroptosis of hippocampal neurons in paclitaxel chemotherapy-induced cognitive impairment mediates microglial activation via TLR4/MyD88 signaling pathway
  60. Celastrol suppresses neovascularization in rat aortic vascular endothelial cells stimulated by inflammatory tenocytes via modulating the NLRP3 pathway
  61. Cord-lamina angle and foraminal diameter as key predictors of C5 palsy after anterior cervical decompression and fusion surgery
  62. GATA1: A key biomarker for predicting the prognosis of patients with diffuse large B-cell lymphoma
  63. Influencing factors of false lumen thrombosis in type B aortic dissection: A single-center retrospective study
  64. MZB1 regulates the immune microenvironment and inhibits ovarian cancer cell migration
  65. Integrating experimental and network pharmacology to explore the pharmacological mechanisms of Dioscin against glioblastoma
  66. Trends in research on preterm birth in twin pregnancy based on bibliometrics
  67. Four-week IgE/baseline IgE ratio combined with tryptase predicts clinical outcome in omalizumab-treated children with moderate-to-severe asthma
  68. Single-cell transcriptomic analysis identifies a stress response Schwann cell subtype
  69. Acute pancreatitis risk in the diagnosis and management of inflammatory bowel disease: A critical focus
  70. Effect of subclinical esketamine on NLRP3 and cognitive dysfunction in elderly ischemic stroke patients
  71. Interleukin-37 mediates the anti-oral tumor activity in oral cancer through STAT3
  72. CA199 and CEA expression levels, and minimally invasive postoperative prognosis analysis in esophageal squamous carcinoma patients
  73. Efficacy of a novel drainage catheter in the treatment of CSF leak after posterior spine surgery: A retrospective cohort study
  74. Comprehensive biomedicine assessment of Apteranthes tuberculata extracts: Phytochemical analysis and multifaceted pharmacological evaluation in animal models
  75. Relation of time in range to severity of coronary artery disease in patients with type 2 diabetes: A cross-sectional study
  76. Dopamine attenuates ethanol-induced neuronal apoptosis by stimulating electrical activity in the developing rat retina
  77. Correlation between albumin levels during the third trimester and the risk of postpartum levator ani muscle rupture
  78. Factors associated with maternal attention and distraction during breastfeeding and childcare: A cross-sectional study in the west of Iran
  79. Mechanisms of hesperetin in treating metabolic dysfunction-associated steatosis liver disease via network pharmacology and in vitro experiments
  80. The law on oncological oblivion in the Italian and European context: How to best uphold the cancer patients’ rights to privacy and self-determination?
  81. The prognostic value of the neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and prognostic nutritional index for survival in patients with colorectal cancer
  82. Factors affecting the measurements of peripheral oxygen saturation values in healthy young adults
  83. Comparison and correlations between findings of hysteroscopy and vaginal color Doppler ultrasonography for detection of uterine abnormalities in patients with recurrent implantation failure
  84. The effects of different types of RAGT on balance function in stroke patients with low levels of independent walking in a convalescent rehabilitation hospital
  85. Causal relationship between asthma and ankylosing spondylitis: A bidirectional two-sample univariable and multivariable Mendelian randomization study
  86. Correlations of health literacy with individuals’ understanding and use of medications in Southern Taiwan
  87. Correlation of serum calprotectin with outcome of acute cerebral infarction
  88. Comparison of computed tomography and guided bronchoscopy in the diagnosis of pulmonary nodules: A systematic review and meta-analysis
  89. Curdione protects vascular endothelial cells and atherosclerosis via the regulation of DNMT1-mediated ERBB4 promoter methylation
  90. The identification of novel missense variant in ChAT gene in a patient with gestational diabetes denotes plausible genetic association
  91. Molecular genotyping of multi-system rare blood types in foreign blood donors based on DNA sequencing and its clinical significance
  92. Exploring the role of succinyl carnitine in the association between CD39⁺ CD4⁺ T cell and ulcerative colitis: A Mendelian randomization study
  93. Dexmedetomidine suppresses microglial activation in postoperative cognitive dysfunction via the mmu-miRNA-125/TRAF6 signaling axis
  94. Analysis of serum metabolomics in patients with different types of chronic heart failure
  95. Diagnostic value of hematological parameters in the early diagnosis of acute cholecystitis
  96. Pachymaran alleviates fat accumulation, hepatocyte degeneration, and injury in mice with nonalcoholic fatty liver disease
  97. Decrease in CD4 and CD8 lymphocytes are predictors of severe clinical picture and unfavorable outcome of the disease in patients with COVID-19
  98. METTL3 blocked the progression of diabetic retinopathy through m6A-modified SOX2
  99. The predictive significance of anti-RO-52 antibody in patients with interstitial pneumonia after treatment of malignant tumors
  100. Exploring cerebrospinal fluid metabolites, cognitive function, and brain atrophy: Insights from Mendelian randomization
  101. Development and validation of potential molecular subtypes and signatures of ocular sarcoidosis based on autophagy-related gene analysis
  102. Widespread venous thrombosis: Unveiling a complex case of Behçet’s disease with a literature perspective
  103. Uterine fibroid embolization: An analysis of clinical outcomes and impact on patients’ quality of life
  104. Discovery of lipid metabolism-related diagnostic biomarkers and construction of diagnostic model in steroid-induced osteonecrosis of femoral head
  105. Serum-derived exomiR-188-3p is a promising novel biomarker for early-stage ovarian cancer
  106. Enhancing chronic back pain management: A comparative study of ultrasound–MRI fusion guidance for paravertebral nerve block
  107. Peptide CCAT1-70aa promotes hepatocellular carcinoma proliferation and invasion via the MAPK/ERK pathway
  108. Electroacupuncture-induced reduction of myocardial ischemia–reperfusion injury via FTO-dependent m6A methylation modulation
  109. Hemorrhoids and cardiovascular disease: A bidirectional Mendelian randomization study
  110. Cell-free adipose extract inhibits hypertrophic scar formation through collagen remodeling and antiangiogenesis
  111. HALP score in Demodex blepharitis: A case–control study
  112. Assessment of SOX2 performance as a marker for circulating cancer stem-like cells (CCSCs) identification in advanced breast cancer patients using CytoTrack system
  113. Risk and prognosis for brain metastasis in primary metastatic cervical cancer patients: A population-based study
  114. Comparison of the two intestinal anastomosis methods in pediatric patients
  115. Factors influencing hematological toxicity and adverse effects of perioperative hyperthermic intraperitoneal vs intraperitoneal chemotherapy in gastrointestinal cancer
  116. Endotoxin tolerance inhibits NLRP3 inflammasome activation in macrophages of septic mice by restoring autophagic flux through TRIM26
  117. Lateral transperitoneal laparoscopic adrenalectomy: A single-centre experience of 21 procedures
  118. Petunidin attenuates lipopolysaccharide-induced retinal microglia inflammatory response in diabetic retinopathy by targeting OGT/NF-κB/LCN2 axis
  119. Procalcitonin and C-reactive protein as biomarkers for diagnosing and assessing the severity of acute cholecystitis
  120. Factors determining the number of sessions in successful extracorporeal shock wave lithotripsy patients
  121. Development of a nomogram for predicting cancer-specific survival in patients with renal pelvic cancer following surgery
  122. Inhibition of ATG7 promotes orthodontic tooth movement by regulating the RANKL/OPG ratio under compression force
  123. A machine learning-based prognostic model integrating mRNA stemness index, hypoxia, and glycolysis‑related biomarkers for colorectal cancer
  124. Glutathione attenuates sepsis-associated encephalopathy via dual modulation of NF-κB and PKA/CREB pathways
  125. FAHD1 prevents neuronal ferroptosis by modulating R-loop and the cGAS–STING pathway
  126. Association of placenta weight and morphology with term low birth weight: A case–control study
  127. Investigation of the pathogenic variants induced Sjogren’s syndrome in Turkish population
  128. Nucleotide metabolic abnormalities in post-COVID-19 condition and type 2 diabetes mellitus patients and their association with endocrine dysfunction
  129. TGF-β–Smad2/3 signaling in high-altitude pulmonary hypertension in rats: Role and mechanisms via macrophage M2 polarization
  130. Ultrasound-guided unilateral versus bilateral erector spinae plane block for postoperative analgesia of patients undergoing laparoscopic cholecystectomy
  131. Profiling gut microbiome dynamics in subacute thyroiditis: Implications for pathogenesis, diagnosis, and treatment
  132. Delta neutrophil index, CRP/albumin ratio, procalcitonin, immature granulocytes, and HALP score in acute appendicitis: Best performing biomarker?
  133. Anticancer activity mechanism of novelly synthesized and characterized benzofuran ring-linked 3-nitrophenyl chalcone derivative on colon cancer cells
  134. H2valdien3 arrests the cell cycle and induces apoptosis of gastric cancer
  135. Prognostic relevance of PRSS2 and its immune correlates in papillary thyroid carcinoma
  136. Association of SGLT2 inhibition with psychiatric disorders: A Mendelian randomization study
  137. Motivational interviewing for alcohol use reduction in Thai patients
  138. Luteolin alleviates oxygen-glucose deprivation/reoxygenation-induced neuron injury by regulating NLRP3/IL-1β signaling
  139. Polyphyllin II inhibits thyroid cancer cell growth by simultaneously inhibiting glycolysis and oxidative phosphorylation
  140. Relationship between the expression of copper death promoting factor SLC31A1 in papillary thyroid carcinoma and clinicopathological indicators and prognosis
  141. CSF2 polarized neutrophils and invaded renal cancer cells in vitro influence
  142. Proton pump inhibitors-induced thrombocytopenia: A systematic literature analysis of case reports
  143. The current status and influence factors of research ability among community nurses: A sequential qualitative–quantitative study
  144. OKAIN: A comprehensive oncology knowledge base for the interpretation of clinically actionable alterations
  145. The relationship between serum CA50, CA242, and SAA levels and clinical pathological characteristics and prognosis in patients with pancreatic cancer
  146. Identification and external validation of a prognostic signature based on hypoxia–glycolysis-related genes for kidney renal clear cell carcinoma
  147. Engineered RBC-derived nanovesicles functionalized with tumor-targeting ligands: A comparative study on breast cancer targeting efficiency and biocompatibility
  148. Relationship of resting echocardiography combined with serum micronutrients to the severity of low-gradient severe aortic stenosis
  149. Effect of vibration on pain during subcutaneous heparin injection: A randomized, single-blind, placebo-controlled trial
  150. The diagnostic performance of machine learning-based FFRCT for coronary artery disease: A meta-analysis
  151. Comparing biofeedback device vs diaphragmatic breathing for bloating relief: A randomized controlled trial
  152. Serum uric acid to albumin ratio and C-reactive protein as predictive biomarkers for chronic total occlusion and coronary collateral circulation quality
  153. Multiple organ scoring systems for predicting in-hospital mortality of sepsis patients in the intensive care unit
  154. Single-cell RNA sequencing data analysis of the inner ear in gentamicin-treated mice via intraperitoneal injection
  155. Suppression of cathepsin B attenuates myocardial injury via limiting cardiomyocyte apoptosis
  156. Influence of sevoflurane combined with propofol anesthesia on the anesthesia effect and adverse reactions in children with acute appendicitis
  157. Review Articles
  158. The effects of enhanced external counter-pulsation on post-acute sequelae of COVID-19: A narrative review
  159. Diabetes-related cognitive impairment: Mechanisms, symptoms, and treatments
  160. Microscopic changes and gross morphology of placenta in women affected by gestational diabetes mellitus in dietary treatment: A systematic review
  161. Review of mechanisms and frontier applications in IL-17A-induced hypertension
  162. Research progress on the correlation between islet amyloid peptides and type 2 diabetes mellitus
  163. The safety and efficacy of BCG combined with mitomycin C compared with BCG monotherapy in patients with non-muscle-invasive bladder cancer: A systematic review and meta-analysis
  164. The application of augmented reality in robotic general surgery: A mini-review
  165. The effect of Greek mountain tea extract and wheat germ extract on peripheral blood flow and eicosanoid metabolism in mammals
  166. Neurogasobiology of migraine: Carbon monoxide, hydrogen sulfide, and nitric oxide as emerging pathophysiological trinacrium relevant to nociception regulation
  167. Plant polyphenols, terpenes, and terpenoids in oral health
  168. Laboratory medicine between technological innovation, rights safeguarding, and patient safety: A bioethical perspective
  169. End-of-life in cancer patients: Medicolegal implications and ethical challenges in Europe
  170. The maternal factors during pregnancy for intrauterine growth retardation: An umbrella review
  171. Intra-abdominal hypertension/abdominal compartment syndrome of pediatric patients in critical care settings
  172. PI3K/Akt pathway and neuroinflammation in sepsis-associated encephalopathy
  173. Screening of Group B Streptococcus in pregnancy: A systematic review for the laboratory detection
  174. Giant borderline ovarian tumours – review of the literature
  175. Leveraging artificial intelligence for collaborative care planning: Innovations and impacts in shared decision-making – A systematic review
  176. Cholera epidemiology analysis through the experience of the 1973 Naples epidemic
  177. Risk factors of frailty/sarcopenia in community older adults: Meta-analysis
  178. Supplement strategies for infertility in overweight women: Evidence and legal insights
  179. Scurvy, a not obsolete disorder: Clinical report in eight young children and literature review
  180. A meta-analysis of the effects of DBS on cognitive function in patients with advanced PD
  181. Protective role of selenium in sepsis: Mechanisms and potential therapeutic strategies
  182. Strategies for hyperkalemia management in dialysis patients: A systematic review
  183. C-reactive protein-to-albumin ratio in peripheral artery disease
  184. Case Reports
  185. Delayed graft function after renal transplantation
  186. Semaglutide treatment for type 2 diabetes in a patient with chronic myeloid leukemia: A case report and review of the literature
  187. Diverse electrophysiological demyelinating features in a late-onset glycogen storage disease type IIIa case
  188. Giant right atrial hemangioma presenting with ascites: A case report
  189. Laser excision of a large granular cell tumor of the vocal cord with subglottic extension: A case report
  190. EsoFLIP-assisted dilation for dysphagia in systemic sclerosis: Highlighting the role of multimodal esophageal evaluation
  191. Molecular hydrogen-rhodiola as an adjuvant therapy for ischemic stroke in internal carotid artery occlusion: A case report
  192. Coronary artery anomalies: A case of the “malignant” left coronary artery and its surgical management
  193. Rapid Communication
  194. Biological properties of valve materials using RGD and EC
  195. A single oral administration of flavanols enhances short-term memory in mice along with increased brain-derived neurotrophic factor
  196. Letter to the Editor
  197. Role of enhanced external counterpulsation in long COVID
  198. Expression of Concern
  199. Expression of concern “A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma”
  200. Expression of concern “Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway”
  201. Expression of concern “circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8”
  202. Corrigendum
  203. Corrigendum to “Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism”
  204. Corrigendum to “Comparing the therapeutic efficacy of endoscopic minimally invasive surgery and traditional surgery for early-stage breast cancer: A meta-analysis”
  205. Corrigendum to “The progress of autoimmune hepatitis research and future challenges”
  206. Retraction
  207. Retraction of “miR-654-5p promotes gastric cancer progression via the GPRIN1/NF-κB pathway”
  208. Retraction of: “LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through downregulating SP-A by sponging to miR-424”
  209. Retraction of: “SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways”
  210. Special Issue Advancements in oncology: bridging clinical and experimental research - Part II
  211. Unveiling novel biomarkers for platinum chemoresistance in ovarian cancer
  212. Lathyrol affects the expression of AR and PSA and inhibits the malignant behavior of RCC cells
  213. The era of increasing cancer survivorship: Trends in fertility preservation, medico-legal implications, and ethical challenges
  214. Bone scintigraphy and positron emission tomography in the early diagnosis of MRONJ
  215. Meta-analysis of clinical efficacy and safety of immunotherapy combined with chemotherapy in non-small cell lung cancer
  216. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part IV
  217. Exploration of mRNA-modifying METTL3 oncogene as momentous prognostic biomarker responsible for colorectal cancer development
  218. Special Issue The evolving saga of RNAs from bench to bedside - Part III
  219. Interaction and verification of ferroptosis-related RNAs Rela and Stat3 in promoting sepsis-associated acute kidney injury
  220. The mRNA MOXD1: Link to oxidative stress and prognostic significance in gastric cancer
  221. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part II
  222. Dynamic changes in lactate-related genes in microglia and their role in immune cell interactions after ischemic stroke
  223. A prognostic model correlated with fatty acid metabolism in Ewing’s sarcoma based on bioinformatics analysis
  224. Red cell distribution width predicts early kidney injury: A NHANES cross-sectional study
  225. Special Issue Diabetes mellitus: pathophysiology, complications & treatment
  226. Nutritional risk assessment and nutritional support in children with congenital diabetes during surgery
  227. Correlation of the differential expressions of RANK, RANKL, and OPG with obesity in the elderly population in Xinjiang
  228. A discussion on the application of fluorescence micro-optical sectioning tomography in the research of cognitive dysfunction in diabetes
  229. A review of brain research on T2DM-related cognitive dysfunction
  230. Metformin and estrogen modulation in LABC with T2DM: A 36-month randomized trial
  231. Special Issue Innovative Biomarker Discovery and Precision Medicine in Cancer Diagnostics
  232. CircASH1L-mediated tumor progression in triple-negative breast cancer: PI3K/AKT pathway mechanisms
Heruntergeladen am 10.12.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2025-1206/html?lang=de
Button zum nach oben scrollen