Home miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
Article Open Access

miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells

  • Heng Chu , XingLi Fan , Zhe Zhang ORCID logo EMAIL logo and Lin Han ORCID logo EMAIL logo
Published/Copyright: August 31, 2023

Abstract

Calcific aortic valve disease (CAVD) is an important cause of disease burden among aging populations. Excessive active endoplasmic reticulum stress (ERS) was demonstrated to promote CAVD. The expression level of miR-199a-5p in patients with CAVD was reported to be downregulated. In this article, we aimed to investigate the function and mechanism of miR-199a-5p in CAVD. The expression level of miR-199a-5p and ERS markers was identified in calcific aortic valve samples and osteogenic induction by real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemistry, and western blotting (WB). Alizarin red staining, RT-qPCR, and WB were used for the verification of the function of miR-199a-5p. The dual luciferase reporter assay and rescue experiment were conducted to illuminate the mechanism of miR-199a-5p. In our study, the expression level of miR-199a-5p was significantly decreased in calcified aortic valves and valve interstitial cells’ (VICs) osteogenic induction model, accompanying with the upregulation of ERS markers. Overexpression of miR-199a-5p suppressed the osteogenic differentiation of VICs, while downregulation of miR-199a-5p promoted this function. 78 kDa glucose-regulated protein (GRP78) and activating transcription factor 6 (ATF6), both of which were pivotal modulators in ERS, were potential targets of miR-199a-5p. miR-199a-5p directly targeted GRP78 and ATF6 to modulate osteoblastic differentiation of VICs. miR-199a-5p inhibits osteogenic differentiation of VICs by regulating ERS via targeting GRP78 and ATF6.

1 Introduction

Calcific aortic valve disease (CAVD) is an important cause of disease burden in the elderly throughout the world and is characterized by the irreversible calcification of valve leaflets. With the disease progression, severe aortic valve stenosis and cardiac failure eventually lead to death. Unfortunately, no medical therapies, especially drug treatments, have been proven to be effective in preventing, delaying, or even reversing disease progression [1,2]. It follows that the prognosis of symptomatic patients is poor. Therefore, aortic valve replacement assisted with extracorporeal circulation or transcatheter aortic valve implantation is available treatment method. CAVD is an active disease regulated by lipoprotein deposition, oxidation, inflammation, and osteoblastic differentiation of valve interstitial cells (VICs). Improving the understanding of the underlying mechanisms of CAVD is beneficial to the development of future treatments.

Endoplasmic reticulum stress (ERS) is a cellular response resulting from those unfolded or misfolded proteins abnormally accumulating in its lumen, which may lead to apoptosis and autophagy. Endoplasmic reticulum proteostasis is regulated by the unfolded protein response (UPR), which includes three downstream signal transduction pathways: PERK, IRE1/Xbp1s, and activating transcription factor 6 (ATF6). The 78 kDa glucose-regulated protein (GRP78), an essential endoplasmic reticulum resident protein chaperone, interacts with the luminal domains of the three transmembrane sensors and anchors them to the surface of the endoplasmic reticulum membrane. ERS activation or depression plays an essential role in many pathophysiological conditions, including obesity, atherosclerosis, tumors, myocardial infarction, and diabetes mellitus. Evidence illustrated that ERS activation serves as a good model in the development of CAVD via reducing histone deacetylase 6 [3]. Another study showed that tauroursodeoxycholic acid – a sort of ERS inhibitor – attenuates aortic valve calcification in the hypercholesterolemic rabbit and mouse models [4]. Recently, a study revealed that in the absence of ERS, downstream effector leads to the protection and prevention of aortic valve calcification [5]. Obviously, overactive ERS has been demonstrated to promote CAVD.

microRNA is a non-coding RNA with post-transcriptional regulatory function, and its length is about 18–24 bp. miR-199a/214 cluster is essential for embryonic development and is very common in vertebrates, as described previously [6]. Previous studies have highlighted that miR-214 is a central regulator of valvular calcification [7]. For instance, it has been reported that the overexpressed miR-214 was verified as an inhibitor suppressing valvular calcification in VICs [8]. Likewise, miR-214 related to the excessive inflammatory reaction was an essential link in the calcification process in CAVD [9]. Additionally, compared with those in patients with rheumatic valvular heart disease, miR-199a-5p was evidently reduced in CAVD people, suggesting that a decreased expression of miR-199a-5p may be related to the progression of CAVD [10]. However, the potential mechanism of how miR-199a-5p affects CAVD is not clear. Thus, in the present study, the purpose was to determine the function and regulatory mechanism of miR-199a-5p in CAVD.

2 Materials and methods

2.1 Samples

During heart valve replacement surgery, the calcific aortic valve leaflets were obtained from 21 patients diagnosed with aortic valve stenosis. Patients under 65 years of age were excluded. The valve leaflets obtained from 14 heart transplantation recipients suffering from dilated cardiomyopathy served as the control group (Table A1). All human valve samples were instantly resected in surgeries and stored in a −80°C freezer.

  1. Ethics approval and consent to participate: The present study was approved by the Ethic Committee of Changhai Hospital, Naval Medical University (No. CH20180630). Patients whose valve leaflets were collected provided written informed consent.

  2. Patient consent for the use of valve leaflets: All patients provided written informed consent for the scientific use of valve leaflets.

2.2 Isolation and culture of primary VICs

The aortic valve leaflets in the control group collected from the heart transplantation recipients were soaked into phosphate-buffered solution (PBS). The valvular endothelial cells (VECs) on the sample surface were eliminated by 0.2% collagenase II on a shaker for 15 min at 37°C. The tissue was cut into small pieces, and then, digestion with the aforementioned collagenase II was performed for 2 h. Primary VICs were cultured in a mixed medium including Dulbecco’s modified Eagle’s medium, 1% penicillin and streptomycin, and 10% fetal bovine serum. The third to fifth passages of VICs were used for further experiments.

2.3 Differentiation of VICs into osteoblasts

VICs were induced to differentiate into osteoblasts by osteogenesis medium, which is a complete medium containing sodium dihydrogen phosphate dihydrate (2 mmol/L), ascorbic acid (50 μg/mL), and insulin (10−7 mol/L). The osteogenesis medium was replaced every 2 days.

2.4 Transfection

The downregulation and upregulation of miR-199a-5p in VICs were produced by transfecting with 100 pmol miR-199a-5p agomiR or antagomiR (GenePharma, China) individually by lipofectamine 2000 (Thermo, USA) in accordance with protocol. To knockdown GRP78 or ATF6 in VICs, cells were transfected with GRP78 or ATF6 siRNA (Obio Technology, China). 8 h ahead of transfection, the medium was changed with osteogenic differentiation medium.

2.5 Real-time quantitative polymerase chain reaction (RT-qPCR)

The miRNAs, mRNAs, and total RNA were extracted by TRIzol (Invitrogen, USA) under the guidance of protocol. The PrimeScript RT reagent Kit (TaKaRa, Japan) was applied to the synthesis of cDNA. miRNA First-Strand Synthesis Kit (TaKaRa, Japan) was used for reverse-transcribed microRNAs. TB Green RT-PCR Kit and Light Cycler 480 System were employed for quantitative real-time PCR assay. The amplification protocol was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s. The cycle value was set as 40. At last, the expressions of mRNA and microRNA were normalized to the reference gene GAPDH and U6, respectively. Results were analyzed using the 2−△△Ct method. All primers are summarized in Table 1.

Table 1

Primer sequence

Gene Primer sequence
hsa-Runx2-Forward CTGTGGTTACTGTCATGGCG
hsa-Runx2-Reverse AGGTAGCTACTTGGGGAGGA
hsa-GRP78-Forward CTATTGGGGTGTTTCGCGAG
hsa-GRP78-Reverse GAGAGCTTCATCTTGCCAGC
hsa-ATF6-Forward CTGTTACCAGCTACCACCCA
hsa-atf6-Reverse GGGAGCCAAAGAAGGTGTTG
hsa-ATF4-Forward CACCGCAACATGACCGAAAT
hsa-ATF4-Reverse TACCCAACAGGGCATCCAAG
hsa-GAPDH-Forward GCTCAACGTGTGGTCATCTC
hsa-GAPDH-Reverse ACCCTTCCACGATCCCAAAT
hsa-miR-199a-5p-Forward CCCAGTGTTCAGACTACCTGTTC

2.6 Alizarin red staining

Alizarin red staining was conducted to the identification of calcium deposition after the osteogenic differentiation procedure in a period of 7 days. In brief, after being washed twice with PBS, VICs were fixed by 75% ethyl alcohol for 15 min, and then, VICs were washed twice again. Finally, the Alizarin red solution (Servicebio, China) stained VICs for 10 min. For the removal of non-specific staining, cells were further washed with 95% ethanol. The positive stain photos were evaluated and taken by the digital microscope. The quantification of the Alizarin red stain was carried out by measuring the absorbance of the supernatant.

2.7 Dual-luciferase reporter assay

The wild type (WT) of GRP78 and ATF6 3′-UTR which contained the predicted binding site of miR-199a-5p was inserted into the psiCHECK-2 vector (Sangon Biotech, China) individually. Cotransfection of HEK293T cells with luciferase reporter plasmid and miR-199a-5p agomiR or agomiR-NC was performed by Lipofectamine 2000 (Thermo, USA). The firefly and renilla luciferase activities were determined by a Dual-luciferase reporter assay system (Promega, USA).

2.8 Western blotting (WB)

The cellular protein was extracted with SDS buffer. Cell lysates were separated by 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes. After the blocking procedure, the membrane was stained with several primary antibodies followed by corresponding secondary antibodies (Jackson Immuno Research; 1:5,000 dilution). Protein bands on membranes were detected by an ECL kit (Thermo). The relevant primary antibodies applied above were GAPDH (Protein tech; 60004-1-Ig; 1:5,000 dilution), Runx2 (CST; # 12556; 1:500 dilution), GRP78 (Proteintech; 11587-1-AP; 1:800 dilution), ATF6 (Abcam; ab203119; 1:800 dilution), ATF4 (Santa Cruz; sc-390063; 1:50 dilution), and XBP1 (Abcam; ab37152; 1:800 dilution).

2.9 Immunohistochemistry

These aortic valve specimens were made into paraffin slides. After that, deparaffination and hydration were performed before the blocking procedure. Subsequently, these slides were incubated with primary antibodies separately, including ATF4 (Affinity; DF6008; 1:100 dilution), CHOP (Affinity; DF6025; 1:100 dilution), GRP78 (Proteintech; 11587-1-AP; 1:200 dilution), Runx2 (Abcam; ab23981; 1:200 dilution), ATF6 (Abcam; ab203119; 1:200 dilution), and XBP1 (Abcam; ab37152; 1:200 dilution). Nuclei were counterstained with hematoxylin. In the next stage, the positive staining was detected by an UltraSensitive SP IHC Kit and a DAB Kit (Maixin Biotech; KIT-9710; China).

2.10 Immunofluorescence

The fixations of VICs were carried out with 4% paraformaldehyde. Triton X-100 (0.5%) was used for permeabilization. Primary antibodies from Vimentin (Santa Cruz; 1:1,000 dilution), α-SMA (Affinity; 1:1,000 dilution), to CD31 (Abcam; 1:50 dilution) were incubated overnight at 4°C on a shaker. Next, relevant secondary antibodies labeled with Cy3 (Servicebio; 1:500 dilution) were incubated for 1 h at RT. The nuclei were stained with 4′,6-diamidino-2-phenylindole (Servicebio; 1:500 dilution). Fluorescent images were captured using an inverse fluorescent microscopy.

2.11 Statistical analysis

The statistical analyses were carried out by IBM SPSS v. 21.0 and GraphPad Prism software. Mean values and standard deviation were described for continuous variables. Shapiro–Wilk test was used for normality analysis. Student’s t-test and one-way analysis of variance were used for analysis between two groups and multiple comparisons separately. p values <0.05 were considered statistically significant for all tests.

3 Results

3.1 Downregulation of miR-199a-5p in calcified aortic valve and VICs’ osteogenic induction model

To investigate whether miR-199a-5p was associated with the pathological process of CAVD, we first analyzed the expression level of miR-199a-5p in calcified aortic valves. Our results demonstrated that the miR-199a-5p expression in calcified aortic valves was significantly lower than that of normal valves (Figure 1a). The normal aortic valve is composed of VICs colonizing in the interstitial substance, VECs cover the surface of the valve leaflets and the extracellular matrix. The results of immunofluorescence staining were a combination of vimentin-positive staining and CD31-negative staining, demonstrating that these cells isolated and cultured from the normal aortic valves were pure VICs, rather than compounds containing VECs (Figure 1b). Then, the VICs were stimulated by the osteogenic induction medium containing inorganic phosphate.

Figure 1 
                  Downregulation of miR-199a-5p in calcified aortic valve and valve interstitial cells (VICs) osteogenic induction model. (a) RT-qPCR analysis of miR-199a-5p in the calcific aortic valve. The miR-199a-5p level dramatically decreased among the CAVD samples. (b) The expression of Vimentin and CD31 in VICs. Scale bar, 100 μm. (c) RT-qPCR results of miR-199a-5p in VICs after osteogenic induction. The miR-199a-5p level dramatically decreased on day 1. *p < 0.05, **p < 0.01.
Figure 1

Downregulation of miR-199a-5p in calcified aortic valve and valve interstitial cells (VICs) osteogenic induction model. (a) RT-qPCR analysis of miR-199a-5p in the calcific aortic valve. The miR-199a-5p level dramatically decreased among the CAVD samples. (b) The expression of Vimentin and CD31 in VICs. Scale bar, 100 μm. (c) RT-qPCR results of miR-199a-5p in VICs after osteogenic induction. The miR-199a-5p level dramatically decreased on day 1. *p < 0.05, **p < 0.01.

We then used the VICs’ osteogenic induction model to identify the effect of miR-199a-5p in the osteogenic differentiation of VICs. miR-199a-5p expression was dramatically reduced to a low level from day 1 to day 7 (Figure 1c). These results, taken together, enable us to support our hypothesis that miR-199a-5p deficiency plays a prominent role in CAVD progression.

3.2 ERS was upregulated in VICs’ osteogenic induction model and calcified aortic valve

The RT-qPCR results indicated that, on the third day after osteogenic induction, the mRNA levels of ERS-related proteins from GRP78, ATF6 to ATF4 were remarkably increased (Figure 2a–c), suggesting that the activated ERS may be involved in the process of osteogenic differentiation of VICs. The Runx2 and XBP1 were also increased on the third day after osteogenic induction (Figure 2d and e). An identical tendency was observed by WB (Figure 2f). The protein expression levels of GRP78, ATF6, ATF4, XBP1, and Runx2 were upregulated on the third day.

Figure 2 
                  ERS was upregulated in VICs’ osteogenic induction model and calcified aortic valve. (a–e) RT-qPCR analysis of GRP78, ATF6,ATF4, XBP1, and Runx2 of VICs after osteogenic induction. The mRNA level significantly increased on the third day. (f) WB of GRP78, ATF6, ATF4, XBP1, and Runx2 of VICs. The protein level significantly increased on the third day. Representative immunohistochemical staining of ERS-related proteins (g) GRP78, (h) ATF6, (i) ATF4, and (j) XBP1 in the aortic valve. (k) Representative immunohistochemical staining of CHOP. The expression of CHOP was hardly detected in the two groups. (l) Representative immunohistochemical staining of Runx2. The Runx2 level was upregulated in the CAVD sample. Scale bars, 50 μm. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure 2

ERS was upregulated in VICs’ osteogenic induction model and calcified aortic valve. (a–e) RT-qPCR analysis of GRP78, ATF6,ATF4, XBP1, and Runx2 of VICs after osteogenic induction. The mRNA level significantly increased on the third day. (f) WB of GRP78, ATF6, ATF4, XBP1, and Runx2 of VICs. The protein level significantly increased on the third day. Representative immunohistochemical staining of ERS-related proteins (g) GRP78, (h) ATF6, (i) ATF4, and (j) XBP1 in the aortic valve. (k) Representative immunohistochemical staining of CHOP. The expression of CHOP was hardly detected in the two groups. (l) Representative immunohistochemical staining of Runx2. The Runx2 level was upregulated in the CAVD sample. Scale bars, 50 μm. *p < 0.05, **p < 0.01, ***p < 0.001.

The previous studies have confirmed that overactive ERS participated in aortic valve calcification. Immunohistochemistry staining showed that compared to those in the control group, the expression of GRP78, ATF6, ATF4, and XBP1 in the CAVD group was significantly upregulated (Figure 2g–j). However, CHOP expression was hardly detected in both the CAVD and control groups (Figure 2k). Additionally, the expression level of Runx2, which was a pivotal osteogenic-related protein, was also significantly upregulated (Figure 2l). These results demonstrated that the activated ERS may be related to the pathological process of CAVD.

3.3 miR-199a-5p suppressed osteoblastic differentiation of VICs

For the verification of the inhibition effect of miR-199a-5p in the osteogenic differentiation of VICs, the miR-199a-5p in VICs was overexpressed and knocked down by transfecting agomiR-199a-5p and antagomiR-199a-5p, separately. The RT-qPCR analyses revealed that the mRNA levels of GRP78 and ATF6 did not change significantly (Figure 3a and b). Moreover, the mRNA levels of Runx2 and ATF4 were decreased with agomiR-199a-5p transfection. Conversely, silencing miR-199a-5p promoted the expression level of Runx2 (Figure 3c and d). Besides, the WB analysis showed that the protein expressions of GRP78, ATF6, ATF4, and Runx2 were inhibited by agomiR-199a-5p transfection. In contrast, they were increased by antagomiR-199a-5p transfection (Figure 3e). Similarly, the mineralization deposition was suppressed by transfecting agomiR-199a-5p while accelerated by transfecting antagomiR-199a-5p as evidenced by Alizarin red staining (Figure 3f). Taken together, miR-199a-5p attenuated osteogenic differentiation of VICs in vitro.

Figure 3 
                  miR-199a-5p attenuates osteoblastic differentiation of VICs in vitro. (a–d) RT-qPCR analysis of GRP78, ATF6, ATF4, and Runx2 of VICs after transfection of agomiR-199a-5p and antagomiR-199a-5p. (e) The protein levels of GRP78, ATF6, ATF4, and Runx2. (f) Representative Alizarin red staining of calcium deposition. Scale bars, 2 mm. *p < 0.05.
Figure 3

miR-199a-5p attenuates osteoblastic differentiation of VICs in vitro. (a–d) RT-qPCR analysis of GRP78, ATF6, ATF4, and Runx2 of VICs after transfection of agomiR-199a-5p and antagomiR-199a-5p. (e) The protein levels of GRP78, ATF6, ATF4, and Runx2. (f) Representative Alizarin red staining of calcium deposition. Scale bars, 2 mm. *p < 0.05.

3.4 miR-199a-5p directly targeted at ATF6 and GRP78

The potential molecular mechanism of miR-199a-5p in regulating the osteogenic differentiation of VICs was further analyzed. ATF6 and GRP78 were selected for further analysis (Figure 4a). At first, the luciferase reporter plasmid vector, which contained ATF6, GRP78 3′-UTR, and corresponding mutation vector, was constructed. Second, miR-199a-5p overexpression evidently reduced the luciferase activity of WT-ATF6 3′-UTR and WT-GRP78 3′-UTR (Figure 4b and c). However, the vector that contained relevant mutant sequence eliminated this inhibitory effect, indicating that miR-199a-5p specifically targeted ATF6 and GRP78.

Figure 4 
                  miR-199a-5p directly target ATF6 and GRP78. (a) Schematic illustration of the putative binding site (highlighted in red) of miR-199a-5p. The luciferase activity of WT-GRP78-3′-UTR (b) and WT- ATF6-3′-UTR (c) was remarkably suppressed by the transfection of agomiR-199a-5p. (d) Downregulation of GRP78 significantly suppressed the calcium deposition of VICs. (e) Downregulation of ATF6 dramatically alleviated the calcium deposition of VICs. WT, wild type. *p < 0.05, **p < 0.01.
Figure 4

miR-199a-5p directly target ATF6 and GRP78. (a) Schematic illustration of the putative binding site (highlighted in red) of miR-199a-5p. The luciferase activity of WT-GRP78-3′-UTR (b) and WT- ATF6-3′-UTR (c) was remarkably suppressed by the transfection of agomiR-199a-5p. (d) Downregulation of GRP78 significantly suppressed the calcium deposition of VICs. (e) Downregulation of ATF6 dramatically alleviated the calcium deposition of VICs. WT, wild type. *p < 0.05, **p < 0.01.

At last, to investigate whether ATF6 and GRP78 were essential for miR-199a-5p to suppress the osteogenic differentiation of VICs, the rescue experiments were performed. The results of rescue experiments presented that the calcium deposition was obviously weakened after si-GRP78 transfection. In contrast, the mineralization deposition was aggravated by antagonmiR-199a-5p transfection. Co-transfection with si-GRP78 eliminated the aggravating mineralization deposition induced by antagomiR-199a-5p (Figure 4d). Similarly, co-transfection with si-ATF6 also alleviated the effect of the aggravating mineralization deposition induced by antagomiR-199a-5p (Figure 4e). To sum up, we confirmed that GRP78 and ATF6 were the functional targets of miR-199a-5p in VICs’ osteogenic differentiation.

4 Discussion

CAVD is one of the most common cardiovascular diseases among the elderly. However, no effective methods were found to prevent and treat it until present times. Our research offers a new insight into the prevention and treatment of CAVD in the future. In this study, we found a novel role of miR-199a-5p in modulating osteoblastic differentiation of VICs. It functions by regulating ERS via targeting GRP78 and ATF6.

The imbalance of miR-199a-5p has been proved to be related to many diseases. For example, Savary et al. proved that miR-199a-5p produced by DNM3OS was able to prevent pulmonary fibrosis [11]. Another study displayed that miR-199a-5p in liver cancer cells might exert inhibiting function on cell proliferation and tumorigenesis by interfering with HK2 expression [12]. Additionally, evidence showed that a high level of miR-199a-5p indicated poor survival as well as a high recurrence rate in prostate cancer patients [13]. A previous report revealed that miR-199a-5p negatively regulated macrophage-mediated inflammation, demonstrating its crucial role in diabetes mellitus [14]. On top of them, the protection effect of miR-199a-5p in ischemia/reperfusion of myocardium and cardiac remodeling has also been clarified as follows. Several studies suggested that the absence of miR-199a-5p facilitated lots of downstream target genes, then alleviating cytotoxicity in hypoxic cardiomyocytes [15,16]. Furthermore, miR-199a-5p was documented to exert its function in mediating cardiomyocyte apoptosis via targeting JunB [17]. A recent study revealed that knockdown of miR-199a-5p in cyanotic congenital heart disease was conducive to cardiomyocytes against hypoxia-induced ERS [18]. Nevertheless, the function and mechanism of miR-199a-5p in valvular heart disease need to be further elucidated. Asulin et al. demonstrated that miR-199a-5p in the CAVD group decreased via analyzing the microRNA expression profile in either calcific or rheumatic valve samples [10]. In the current study, the RT-qPCR analyses verified the miR-199a-5p deficiency in calcific valve specimens. Silencing of miR-199a-5p facilitated osteogenic differentiation of VICs in vitro, illustrating that miR-199a-5p may participate in the CAVD process.

UPR includes three classic signaling pathways: PERK, IRE1/XBP1, and ATF6. GRP78, an ER-resident protein chaperone, binds to the above three proteins and anchors them on the ER lumen membrane to maintain the quiescent state of UPR. Our immunohistochemistry studies showed that the expression levels of GRP78 and ATF6 in the CAVD group were strikingly upregulated, indicating that excessive active ERS may be related to the pathological process of CAVD.

The expression of GRP78 induced by ischemia/reperfusion in cardiomyocytes could stimulate Akt signaling and protect cells from oxidative damage and apoptosis [19,20]. Meanwhile, Wang et al. found that the embryos that a lack of GRP78 specifically in cardiomyocytes exhibited cardiovascular malformations, and GRP78 is essential for maintaining cardiac contractility and function [21,22]. ATF6, another crucial transcriptional regulator of ER proteostasis, was also reported to facilitate myocardial ischemia/reperfusion injury [23,24]. Jin et al. verified that ATF6 overexpression mitigated the reactive oxygen species and necrotic cell death in cardiomyocytes. Both were caused by silencing ATF6 [25]. On the other hand, ATF6 was demonstrated to suppress the activation of cardiac fibroblasts induced by transforming growth factor β, which leads to reducing cardiac fibrosis [26]. Additionally, our results of RT-qPCR and WB analyses displayed that GRP78 and ATF6 were dramatically increased on the third day after osteogenic induction, promoting this assumption that the activated ERS may be involved in the process of osteogenic differentiation of VICs.

Non-coding RNA has been widely documented to regulate the valvular remodeling processes in CAVD [7]. Among the variously reported microRNAs, several studies have highlighted miR-214 and miR-204 as pivotal regulators of osteogenic differentiation of VICs. Li et al. testified that miR-214-3p could inhibit CAVD by targeting two core osteogenic transcription factors: Osterix/Sp7 and ATF4 [8]. Additionally, miR-204 deficiency in VICs enhanced valvular osteogenic activity by promoting the expression of Runx2 and Smad4 [2730]. Toshima et al. demonstrated that miR-34a promoted valve calcification by regulating the Notch1–Runx2 axis. [31] The bicuspid aortic valve malformation patients shared higher risks of CAVD when compared to the patients with tricuspid aortic valve leaflets, accompanying the remarkably lower expression level of miR-195. The downregulation of miR-195 was related to valvular calcification by targeting SMAD7, which promoted the remodeling of the extracellular matrix [32].

In the current study, we found that compared with those increased by antagomiR-199a-5p transfection, the protein expressions of GRP78 and ATF6 in VICs were inhibited by agomiR-199a-5p transfection. Similarly, the calcium deposition was accelerated by silencing miR-199a-5p while inhibited by overexpressing miR-199a-5p as evidenced by Alizarin red staining. These further verified that miR-199a-5p attenuated the osteogenic differentiation of VICs in vitro. Finally, our rescue experiments proved that GRP78 and ATF6 were the functional targets of miR-199a-5p. In general, our results above demonstrate that miR-199a-5p inhibits osteogenic differentiation of VICs by suppressing GRP78 and ATF6.


# These authors contributed equally to this work and share first authorship.


Acknowledgments

We show our sincere appreciation for the time and efforts the retired Prof David Taylor spent in polishing the article.

  1. Funding information: This work was supported by National Natural Science Foundation of China (Grant No. 81770383).

  2. Author contributions: H Chu and XL Fan contributed equally to this work; H Chu conceived, designed, and wrote the article that led to the submission; H Chu and XL Fan searched and filtered the literature; XL Fan selected and interpreted the data; Z Zhang and L Han revised the article; Z Zhang and L Han provided financial support for this work; Z Zhang and L Han are co-corresponding authors, and they contributed equally to this work; and all authors read and approved the final article.

  3. Conflict of interest: The authors declare that they have no conflict of interest.

  4. Data availability statement: All data acquired in the article is available if required.

Appendix

Table A1

Patient profiles

Variables CAVD (n = 21) Control (n = 14) p Value
Age, years 70.4 ± 3.9 53.6 ± 11.5 <0.001***
Male, n (%) 16 (76.2) 10 (71.4) 0.752
BMI, kg/m² 23.3 ± 3.6 23.6 ± 3.9 0.834
LVEF, % 52.9 ± 13.4 20.6 ± 7.2 <0.001***
Medical History, n (%)
Hypertension 13 (61.9) 0 (0) <0.001***
Diabetes mellitus 2 (9.5) 1 (4.8) 1
Preoperative medication, n (%)
ACEI 8 (38.1) 9 (64.3) 0.129
BB 7 (33.3) 10 (71.4) 0.027
CCB 2 (9.5) 0 (0) 0.506

CAVD, calcific aortic valve disease; BMI, body mass index; LVEF,left ventricle ejection fraction; ACEI, angiotensin converting enzyme inhibitors; BB, beta-blockers; CCB, calcium-channel blockers.

p < 0.001.

References

[1] Peeters FECM, Meex SJR, Dweck MR, Aikawa E, Crijns HJGM, Schurgers LJ, et al. Calcific aortic valve stenosis: hard disease in the heart: A biomolecular approach towards diagnosis and treatment. Eur Heart J. 2018;39(28):2618–24.10.1093/eurheartj/ehx653Search in Google Scholar PubMed PubMed Central

[2] Yadgir S, Johnson CO, Aboyans V, Adebayo OM, Adedoyin RA, Afarideh M, et al. Global, regional, and national burden of calcific aortic valve and degenerative mitral valve diseases, 1990–2017. Circulation. 2020;141(21):1670–80.10.1161/CIR.0000000000000848Search in Google Scholar PubMed

[3] Fu Z, Li F, Jia L, Su S, Wang Y, Cai Z, et al. Histone deacetylase 6 reduction promotes aortic valve calcification via an endoplasmic reticulum stress-mediated osteogenic pathway. J Thorac Cardiovasc Surg. 2019;158(2):408–17.e402.10.1016/j.jtcvs.2018.10.136Search in Google Scholar PubMed

[4] Cai Z, Li F, Gong W, Liu W, Duan Q, Chen C, et al. Endoplasmic reticulum stress participates in aortic valve calcification in hypercholesterolemic animals. Arterioscler Thromb Vasc Biol. 2013;33(10):2345–54.10.1161/ATVBAHA.112.300226Search in Google Scholar PubMed

[5] Cai Z, Liu B, Wei J, Fu Z, Wang Y, Wang Y, et al. Deficiency of CCAAT/enhancer-binding protein homologous protein (CHOP) prevents diet-induced aortic valve calcification in vivo. Aging Cell. 2017;16(6):1334–41.10.1111/acel.12674Search in Google Scholar PubMed PubMed Central

[6] Lee YB, Bantounas I, Lee DY, Phylactou L, Caldwell MA, Uney JB. Twist-1 regulates the miR-199a/214 cluster during development. Nucleic Acids Res. 2009;37(1):123–8.10.1093/nar/gkn920Search in Google Scholar PubMed PubMed Central

[7] Gupta SK, Kumari S, Singh S, Barthwal MK, Singh SK, Thum T. Non-coding RNAs: Regulators of valvular calcification. J Mol Cell Cardiol. 2020;142:14–23.10.1016/j.yjmcc.2020.03.015Search in Google Scholar PubMed

[8] Li N, Bai Y, Zhou G, Ma Y, Tan M, Qiao F, et al. miR-214 attenuates aortic valve calcification by regulating osteogenic differentiation of valvular interstitial cells. Mol Ther Nucleic Acids. 2020;22:971–80.10.1016/j.omtn.2020.10.016Search in Google Scholar PubMed PubMed Central

[9] Zheng D, Zang Y, Xu H, Wang Y, Cao X, Wang T, et al. MicroRNA-214 promotes the calcification of human aortic valve interstitial cells through the acceleration of inflammatory reactions with activated MyD88/NF-kappaB signaling. Clin Res Cardiol. 2019;108(6):691–702.10.1007/s00392-018-1398-9Search in Google Scholar PubMed

[10] Asulin N, Volinsky N, Grosman-Rimon L. Differential microRNAs expression in calcified versus rheumatic aortic valve disease. J Card Surg. 2020;35(7):1508–13.10.1111/jocs.14636Search in Google Scholar PubMed

[11] Savary G, Dewaeles E, Diazzi S, Buscot M, Nottet N, Fassy J, et al. The long noncoding RNA DNM3OS is a reservoir of fibromirs with major functions in lung fibroblast response to TGF-β and pulmonary fibrosis. Am J Respir Crit Care Med. 2019;200(2):184–98.10.1164/rccm.201807-1237OCSearch in Google Scholar PubMed

[12] Guo W, Qiu Z, Wang Z, Wang Q, Tan N, Chen T, et al. MiR-199a-5p is negatively associated with malignancies and regulates glycolysis and lactate production by targeting hexokinase 2 in liver cancer. Hepatology. 2015;62(4):1132–44.10.1002/hep.27929Search in Google Scholar PubMed

[13] Tseng JC, Huang SH, Lin CY, Wang BJ, Huang SF, Shen YY, et al. ROR2 suppresses metastasis of prostate cancer via regulation of miR-199a-5p-PIAS3-AKT2 signaling axis. Cell Death Dis. 2020;11(5):376.10.1038/s41419-020-2587-9Search in Google Scholar PubMed PubMed Central

[14] Yang L, Han X, Zhang C, Sun C, Huang S, Xiao W, et al. Hsa_circ_0060450 negatively regulates type I interferon-induced inflammation by serving as miR-199a-5p sponge in type 1 diabetes mellitus. Front Immunol. 2020;11:576903.10.3389/fimmu.2020.576903Search in Google Scholar PubMed PubMed Central

[15] Liu DW, Zhang YN, Hu HJ, Zhang PQ, Cui W. Downregulation of microRNA‑199a‑5p attenuates hypoxia/reoxygenation‑induced cytotoxicity in cardiomyocytes by targeting the HIF‑1α‑GSK3β‑mPTP axis. Mol Med Rep. 2019;19(6):5335–44.10.3892/mmr.2019.10197Search in Google Scholar PubMed PubMed Central

[16] Zhou Y, Pang B, Xiao Y, Zhou S, He B, Zhang F, et al. The protective microRNA-199a-5p-mediated unfolded protein response in hypoxic cardiomyocytes is regulated by STAT3 pathway. J Physiol Biochem. 2019;75(1):73–81.10.1007/s13105-018-0657-6Search in Google Scholar PubMed

[17] Yan M, Yang S, Meng F, Zhao Z, Tian Z, Yang P. MicroRNA 199a-5p induces apoptosis by targeting JunB. Sci Rep. 2018;8(1):6699.10.1038/s41598-018-24932-9Search in Google Scholar PubMed PubMed Central

[18] Zhou Y, Jia WK, Jian Z, Zhao L, Liu CC, Wang Y, et al. Downregulation of microRNA‑199a‑5p protects cardiomyocytes in cyanotic congenital heart disease by attenuating endoplasmic reticulum stress. Mol Med Rep. 2017;16(3):2992–3000.10.3892/mmr.2017.6934Search in Google Scholar PubMed

[19] Bi X, Zhang G, Wang X, Nguyen C, May HI, Li X, et al. Endoplasmic reticulum chaperone GRP78 protects heart from ischemia/reperfusion injury through Akt activation. Circ Res. 2018;122(11):1545–54.10.1161/CIRCRESAHA.117.312641Search in Google Scholar PubMed PubMed Central

[20] Ji H, Xiao F, Li S, Wei R, Yu F, Xu J. GRP78 effectively protect hypoxia/reperfusion-induced myocardial apoptosis via promotion of the Nrf2/HO-1 signaling pathway. J Cell Physiol. 2021;236(2):1228–36.10.1002/jcp.29929Search in Google Scholar PubMed PubMed Central

[21] Wang X, Bi X, Zhang G, Deng Y, Luo X, Xu L, et al. Glucose-regulated protein 78 is essential for cardiac myocyte survival. Cell Death Differ. 2018;25(12):2181–94.10.1038/s41418-018-0109-4Search in Google Scholar PubMed PubMed Central

[22] Zhang G, Wang X, Bi X, Li C, Deng Y, Al-Hashimi AA, et al. GRP78 (Glucose-Regulated Protein of 78 kDa) promotes cardiomyocyte growth through activation of GATA4 (GATA-Binding Protein 4). Hypertension. 2019;73(2):390–8.10.1161/HYPERTENSIONAHA.118.12084Search in Google Scholar PubMed PubMed Central

[23] Blackwood EA, Azizi K, Thuerauf DJ, Paxman RJ, Plate L, Kelly JW, et al. Pharmacologic ATF6 activation confers global protection in widespread disease models by reprograming cellular proteostasis. Nat Commun. 2019;10(1):187.10.1038/s41467-018-08129-2Search in Google Scholar PubMed PubMed Central

[24] Glembotski CC, Rosarda JD, Wiseman RL. Proteostasis and beyond: ATF6 in ischemic disease. Trends Mol Med. 2019;25(6):538–50.10.1016/j.molmed.2019.03.005Search in Google Scholar PubMed PubMed Central

[25] Jin JK, Blackwood EA, Azizi K, Thuerauf DJ, Fahem AG, Hofmann C, et al. ATF6 decreases myocardial ischemia/reperfusion damage and links ER stress and oxidative stress signaling pathways in the heart. Circ Res. 2017;120(5):862–75.10.1161/CIRCRESAHA.116.310266Search in Google Scholar PubMed PubMed Central

[26] Stauffer WT, Blackwood EA, Azizi K, Kaufman RJ, Glembotski CC. The ER unfolded protein response effector, ATF6, reduces cardiac fibrosis and decreases activation of cardiac fibroblasts. Int J Mol Sci. 2020;21(4):1373.10.3390/ijms21041373Search in Google Scholar PubMed PubMed Central

[27] Wang Y, Chen S, Deng C, Li F, Wang Y, Hu X, et al. MicroRNA-204 targets Runx2 to attenuate BMP-2-induced osteoblast differentiation of human aortic valve interstitial cells. J Cardiovasc Pharmacol. 2015;66(1):63–71.10.1097/FJC.0000000000000244Search in Google Scholar PubMed

[28] Song R, Zhai Y, Ao L, Fullerton DA, Meng X. MicroRNA-204 deficiency in human aortic valves elevates valvular osteogenic activity. Int J Mol Sci. 2019;21(1):76. 10.3390/ijms21010076Search in Google Scholar PubMed PubMed Central

[29] Xiao X, Zhou T, Guo S, Guo C, Zhang Q, Dong N, et al. LncRNA MALAT1 sponges miR-204 to promote osteoblast differentiation of human aortic valve interstitial cells through up-regulating Smad4. Int J Cardiol. 2017;243:404–12.10.1016/j.ijcard.2017.05.037Search in Google Scholar PubMed

[30] Yu C, Li L, Xie F, Guo S, Liu F, Dong N, et al. LncRNA TUG1 sponges miR-204-5p to promote osteoblast differentiation through upregulating Runx2 in aortic valve calcification. Cardiovasc Res. 2018;114(1):168–79.10.1093/cvr/cvx180Search in Google Scholar PubMed

[31] Toshima T, Watanabe T, Narumi T, Otaki Y, Shishido T, Aono T, et al. Therapeutic inhibition of microRNA-34a ameliorates aortic valve calcification via modulation of Notch1-Runx2 signalling. Cardiovasc Res. 2020;116(5):983–94.10.1093/cvr/cvz210Search in Google Scholar PubMed

[32] Du J, Zheng R, Xiao F, Zhang S, He K, Zhang J, et al. Downregulated MicroRNA-195 in the bicuspid aortic valve promotes calcification of valve interstitial cells via targeting SMAD7. Cell Physiol Biochem. 2017;44(3):884–96.10.1159/000485356Search in Google Scholar PubMed

Received: 2023-03-13
Revised: 2023-06-25
Accepted: 2023-07-31
Published Online: 2023-08-31

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Downloaded on 3.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0777/html?licenseType=open-access
Scroll to top button