Home Medicine Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
Article Open Access

Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes

  • Haijun Guo , Yunqing Zhi , Kaijing Wang , Na Li , Danlei Yu , Zhonghua Ji EMAIL logo and Bo Chen EMAIL logo
Published/Copyright: September 27, 2023

Abstract

Acquired resistance to chemotherapeutic drugs in gallbladder cancer (GBC) results in therapy failure. This study is aimed to establish oxaliplatin (OXA)-resistant GBC cell lines and uncover their gene expression profiles. First, two OXA-resistant GBC cell lines (GBC-SD/OXA and SGC996/OXA) were established by gradually increasing the drug concentration, and the resistance index was 4–5. The two resistant cell lines showed slower proliferation and higher stemness, colony formation, and migration abilities. Epithelial mesenchymal transformation and increased levels of P-glycoprotein were also detected. Next RNA-sequence analysis identified 4,675 dysregulated genes (DGs) in resistant cells, and most of the 12 randomly selected DGs were verified to be consistent with the sequence results. Kyoto Encyclopedia of Genes and Genomes analysis indicated that several DGs were involved in resistance- and phenotype-related pathways, of which the activations of PD-L1 and ERK1/2 were both verified in resistant cell lines. In conclusion, this study is the first to report the gene expression profile of OXA-resistant GBC cells and provides a useful database for target development.

1 Introduction

Gallbladder cancer (GBC) is the most common malignant tumor of the biliary system, accounting for 0.6% of new cancer diagnoses worldwide [1]. Surgical resection is regarded as the most effective treatment for GBC; however, approximately 80% of patients have progressed to the advanced stage at the first diagnosis, thus not having the option of surgery. Therefore, the 5 year survival rate of patients with locally advanced or metastatic GBC is <5% [2]. To date, the combination of gemcitabine and platinum-based anticancer drugs remains the standard treatment for advanced or metastatic GBC [3]; however, the response rate and time are often unsatisfactory. The major reasons for this are the significantly higher molecular heterogeneity of GBC compared to other biliary system cancers, as well as the inevitable acquired resistance to chemotherapeutic drugs [4].

Next-generation sequencing technology is an effective tool for identifying new targetable alterations for precision medicine. A series of oncogenic mutations have been found in patients with GBC, including ERBB2 (HER2) amplification, MEK mutation, and BRAF mutation [5,6], providing new options for the treatment of GBC. However, these attempts at targeted or combination therapies are still less desirable, especially in resistant patients. For instance, a clinical trial indicated that blockage of HER2 was beneficial in some GBC patients with HER2 alteration, whereas no response was observed in others [7]. Dabrafenib (a BRAF inhibitor) combined with trametinib (an MEK inhibitor) has a 51% objective response rate in biliary system cancers [8]; however, trametinib has no activity in advanced GBC resistant to gemcitabine-based chemotherapy [9]. The limited effect of these targeted therapies indicates that other compensatory pathways must be activated in cancer, and the existing potential targets are insufficient for the effective treatment of advanced or resistant GBC.

Compared to other cancers, the underlying mechanisms for GBC resistance have been less investigated, and the major reasons are the rarity of clinical cases/samples as well as the lack of resistant cell lines. Most clinical trials related to GBC are included in the studies of biliary system cancers [7,8,9], and trials focusing only on GBC are numbered. Therefore, the establishment of resistant cell lines is of great significance for identifying more potential targets. Oxaliplatin (OXA) is one of the most commonly used platinum compounds in GBC [10,11], and acquired resistance to OXA is often neglected compared to more widely used gemcitabine. The present study is aimed to establish two OXA-resistant GBC cell lines and detect phenotypic alterations in the resistant cells. RNA-sequence (RNA-seq) and bioinformatics analyses were performed to identify dysregulated genes (DGs) in resistant cells and classify the biological roles of DGs. Several DGs and pathways were selected for verification. We aimed to establish the gene expression profile of OXA-resistant cells, thereby providing a solid foundation for the combined targeted therapy of GBC.

2 Materials and methods

2.1 Cells and cell culture

The human GBC cell line GBC-SD was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and SGC996 was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). The two sensitive cell lines were cultured in Dulbecco’s modified eagle’s medium (DMEM; BBI Life Science, Shanghai, China) supplemented with 10% fetal bovine serum (FBS; BI, Israel) and 1% penicillin/streptomycin (BBI Life Science). Cells were maintained in an incubator with 5% CO2 at 37℃.

2.2 Establishment of OXA-resistant GBC-SD and SGC996 cell lines

The sensitive cell lines GBC-SD and SGC996 were seeded in six-well plates, and resistant cells were induced by gradually increasing the drug concentration. The process can be divided into four stages. Stage I: The initial concentration of OXA (Selleck, Shanghai, China) was 0.05 μM and the passage cycle was controlled at 2–3 days at a seeding density of 2 × 105 cells/well. This stage lasted for 2–3 weeks until the cells were fully adapted to the initial dose. Stage II: The dose was gradually increased until the cells could survive and proliferate in medium containing 5 μM OXA, and this stage lasted for 10–12 weeks. The passage cycle was controlled for 4–5 days at a seeding density of 3 × 105 cells/well. Stage III: The achieved cells were preserved in liquid nitrogen for a month and then recovered and cultured with 5 μM OXA in every passage for an additional month. The passage cycle and seeding density were similar to those of stage II. In stage III, cells underwent an additional cycle of cryopreservation and normal growth with 5 μM OXA to obtain stable OXA-resistant cell lines, referred to as GBC-SD/OXA and SGC996/OXA. Stage IV: OXA (1 μM) was used as the common dose in long-term cryopreservation and passage culture. Cell morphology was observed and photographed using a microscope. Only the resistant cells at stage IV were used for the following assays, including RNA-seq analysis.

2.3 Drug-sensitivity assay

Two sensitive and two resistant cell lines were seeded at 5 × 103 cells/well in 96-well plates, and different concentrations of OXA (0, 0.01, 0.1, 1, 10, and 100 µM) were added to the wells. Each concentration was used in four replicate wells. After 72 h of culture, the absorbance of each well was measured at 490 nm using an 2,5-diphenyl-2H-tetrazolium bromide (MTT) kit (CT01; Millipore), following the manufacturer’s protocols. The survival rate (%) was calculated according to the following equation: Cell viability (%) = OD of the experimental group/OD of the control group × 100. The drug concentration–viability curve and half-inhibitory concentration (IC50) were calculated using GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA, USA). The drug resistance index (RI) was calculated according to the following equation: RI = IC50 of resistant cell line/IC50 of sensitive cell line.

2.4 Proliferation assay

The four cell lines were seeded at a density of 3 × 103 cells/well in 96-well plates. The viability of the cells was measured using the MTT kit daily from days 1–7. Four replicate wells were used for each experiment. The proliferation rate was calculated using the equation: Proliferation rate (%) = OD of day n/OD of day 1, (n = 1–7).

2.5 Migration assay

The cells were collected and washed twice with FBS-free DMEM. An 8 μm pore polycarbonate membrane Boyden chamber insert in a Transwell apparatus (Millipore, MA, USA) was used to detect cell motility. In brief, 4 × 104 cells resuspended in 0.2 mL FBS-free DMEM were seeded in the upper chamber, and 0.6 mL of the complete DMEM was added to the lower chamber. After incubation for 24 h, the cells on the upper surface were removed and the migrated cells on the lower surface were stained with 0.1% crystal violet for 10 min. Finally, the number of migrated cells was determined by counting the stained cells in three randomly selected fields using a microscope. The assay for each cell line was performed in triplicates.

2.6 Western blot

Total protein from the four cell lines was lysed using RIPA buffer (Beyotime, Shanghai, China) and quantified using a Bradford protein assay kit (MultiSciences, Hangzhou, China), following the manufacturer’s instructions. Next 10% sodium dodecyl-sulfate polyacrylamide gel electrophoresis was performed, and 10 μg of protein was added to the lanes. After electrophoresis was completed, separated proteins distributed in the gels were transferred into the 0.22 μm PVDF membranes. Subsequently, the membranes were incubated with 5% non-fat milk for 2 h and washed thrice with Tris-buffered saline with 0.1% Tween® 20 (TBST). The membranes were then cut into several pieces following the molecular weight of the target proteins, and incubated with the corresponding primary antibody overnight at 4℃, followed by the incubation with the secondary antibody at room temperature for an additional 2 h. Finally, the bands were incubated with the enhancement buffer following the steps of the ECL kit (Beyotime), and the signals were captured using an imaging system. The primary antibodies, E-cadherin, vimentin, N-cadherin, P-glycoprotein (P-gp), ERK1/2, p-ERK1/2, PD-L1, and the control, GAPDH, were purchased from ABclonal Biotech (Wuhan, China) and diluted 1,000-fold before incubation. The secondary antibody (1:2,000) was purchased from Cell Signaling Technology (Danvers, MA, USA). The gray values of the bands were analyzed using ImageJ software (National Institutes of Health, MD, USA).

2.7 Colony formation assay

For each cell line, 2 mL of complete medium containing 400 cells was added to a six-well plate. After 3 days of culture, 1 μM OXA was added to each well and the cells were cultured with OXA for an additional 11 days. The medium was changed every 4 days. Finally, the supernatant was removed and the cells were stained with 0.1% crystal violet for 20 min. Colonies containing >30 cells were counted and the assay was repeated thrice.

2.8 Soft agar colony formation assay

First, 1.5 and 0.8% agarose solutions were prepared in phosphate-buffered saline and subjected to high-pressure sterilization. Next a 1.5% agarose solution was mixed with an equal volume of medium and pre-coated in a 6-well plate. After the agarose solution solidified, 0.8% agarose solution mixed with an equal volume of medium containing 1,200 cells was seeded into each well. Colony formation lasted for 14 days, and 200 μL of medium was added to each well every 2 days.

2.9 RNA-seq analysis

Total RNA was collected from the four cell lines using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and extracted using an RNeasy mini kit (Qiagen, Germany). RNA quality and concentration were determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Montchanin, DE, USA) and assessed using 1% gel electrophoresis. Next the four qualified RNA samples were sent to Sinotech Genomics Co., Ltd (Shanghai, China), for cDNA library construction and RNA sequencing. Gene abundance was expressed as fragments per kilobase of exon per million reads mapped (FPKM). StringTie software was used to count the fragments within each gene, and the TMM algorithm was used for normalization. The DGs between the sensitive and resistant groups were screened under the threshold of |log2 (fold change [FC])| > 1.

2.10 Quantitative polymerase chain reaction (qPCR)

Total RNAs were extracted from the four cell lines using a Universal RNA Extraction Kit (TAKARA, Dalian, China), following the manufacturer’s protocol, and then quantified using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies). Next 1 μg of RNA was reverse-transcribed into cDNA using a PrimeScript RT reagent Kit (TaKaRa), according to the manufacturer’s instructions. For quantification of the target genes, the reaction system (20 μL) containing 2 μL of template, 10 μL of TaqMan Universal PCR Master Mix (Applied Biosystems), 1 μL of forward and reverse primers, and 7 μL of water was prepared and subjected to a Bio-Rad CFX96 Thermal Cycler (Bio-Rad, Hercules, USA). The thermal cycling conditions were as follows: 95℃ for 5 min, followed by 40 cycles at 95℃ for 15 s, and 60℃ for 60 s. Relative expression levels of mRNAs were calculated using the 2−ΔΔCT method, and GAPDH was used as the internal control. The sequences of the primers listed in Table 1 were synthesized by Sangon Biotech (Shanghai, China).

Table 1

Primer sequences used for qPCR

Genes Sequences (5′−3′)
CCL20 Forward TGCTGTACCAAGAGTTTGCTC
Reverse CGCACACAGACAACTTTTTCTTT
S1PR1 Forward TCTGCTGGCAAATTCAAGCGA
Reverse GTTGTCCCCTTCGTCTTTCTG
CSF2 Forward TCCTGAACCTGAGTAGAGACAC
Reverse TGCTGCTTGTAGTGGCTGG
TFF3 Forward CCAAGCAAACAATCCAGAGCA
Reverse GCTCAGGACTCGCTTCATGG
FOXS1 Forward AGTGGCATCTACCGCTACATC
Reverse CACCTTGACAAAGCACTCGT
FGG Forward AGACACGGTGCAAATCCATGA
Reverse GCCCGCTCTGTTTAGCTCC
CACNA1C Forward GAAGCGGCAGCAATATGGGA
Reverse TTGGTGGCGTTGGAATCATCT
EVI2A Forward CCCACGGACATGGAACACA
Reverse CACAGACGGGTATAGTTTGCTT
DLX1 Forward TGCCAGAAAGTCTCAACAGCC
Reverse CGAGTGTAAACAGTGCATGGA
GNG4 Forward GAGGGCATGTCTAATAACAGCAC
Reverse AGACCTTGACCCTGTCCATAC
MED29 Forward ACGCAGTCGTAACGCACTT
Reverse AGCCGAACTAGGACCCGATAC
CXCL8 Forward TTTTGCCAAGGAGTGCTAAAGA
Reverse AACCCTCTGCACCCAGTTTTC
GAPDH Forward GGAGCGAGATCCCTCCAAAAT
Reverse GGCTGTTGTCATACTTCTCATGG

2.11 Bioinformatical analysis

Gene Ontology (GO) analysis for biological processes, cellular components, and molecular function and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (http://www.genome.ad.jp/kegg) were performed to clarify the potential biological roles of DGs using the enrich R package. Enrichment analysis was conducted to list the top 30 GO terms and KEGG pathways.

2.12 Statistical analysis

Statistical analysis was performed using SPSS software (version 20.0; Chicago, IL, USA), and GraphPad Prism 5.0 (La Jolla, CA, USA) was used for data presentation. Statistical significance was tested using the Student’s t-test. p < 0.05 was considered statistically significant.

3 Results

3.1 Drug-sensitivity detection of OXA-resistant cell lines

The morphology of GBC-SD and GBC-SD/OXA was fusiform, and the resistant cells were larger than the parental cells (Figure 1a). Sensitive SGC996 cells were small and polygonal, whereas the resistant cells became significant spindles, and some of them had several pseudopodia (Figure 1a). In addition, the two sensitive cell lines tended to aggregate, whereas the resistant cells were both more dispersed (Figure 1a), which may be related to the alteration of motility.

Figure 1 
                  Drug-sensitivity detection of OXA-resistant cell lines. (a) Morphological character of resistant cell lines. Scale bar: 100 μM, magnification: 200×. (b) Cells were incubated with different concentrations of OXA and the MTT assay was used to detect drug-sensitivity.
Figure 1

Drug-sensitivity detection of OXA-resistant cell lines. (a) Morphological character of resistant cell lines. Scale bar: 100 μM, magnification: 200×. (b) Cells were incubated with different concentrations of OXA and the MTT assay was used to detect drug-sensitivity.

An MTT assay was used to detect the drug sensitivity of the four cell lines. As shown in Figure 1b, GBC-SD and GBC-SD/OXA cells were similar in response to low and medium doses of OXA (0.01–10 μM), and GBC-SD/OXA showed a significantly higher resistance to 100 μM OXA. The IC50 values of GBC-SD and GBC-SD/OXA were 28.49 and 141.10 μM, respectively, and the RI value was 4.95. SGC996 cells were more sensitive to OXA than SGC996/OXA at in the dose of 1–100 μM. The IC50 value of SGC996/OXA cells was 29.02 μM, which was approximately 4-folds that of the sensitive cells (7.08 μM). These results confirm that the OXA-resistant cell lines GBC-SD/OXA and SGC996/OXA were successfully established.

3.2 Phenotype alterations of OXA-resistant cells

As shown in Figure 2a, the proliferation rates of GBC-SD and its resistant cells were similar in the first 3 days of the study, and GBC-SD/OXA exhibited a slower growth rate than the sensitive cells in the last 3 days. Similar proliferation characteristics were observed in the SGC996/OXA cells (Figure 2a). Clone formation assay results indicated that resistant cells showed a stronger cloning potency than sensitive cells (Figure 2b) in the presence of 1 μM OXA, suggesting better tolerance of the resistant cells. Furthermore, soft agar colony formation assay results also indicated a higher three-dimensional cell sphere formation ability of the two resistant cell lines (Figure 2d), which indicated better stemness after cells were resistant to OXA. In addition, the migration abilities of the two resistant cell lines were significantly enhanced by the Transwell assay (Figure 2d). Western blotting results showed that vimentin and N-cadherin protein expression was both significantly increased after cells were resistant to OXA (Figure 2e). There was no significant change in E-cadherin expression in GBC-SD/OXA and GBC-SD cells, whereas its level was decreased in SGC996/OXA compared to that in the sensitive cells (Figure 2e). Overall, the resistant cells underwent epithelial mesenchymal transformation (EMT), consistent with their enhanced migration ability. One of the classic drug-resistant proteins, P-gp, was also detected, and the results showed a significant increase in the protein levels in the resistant cells (Figure 2e).

Figure 2 
                  Phenotype detection of OXA-resistant cells. (a) Cells were cultured for 1–7 days, and the MTT assay was used to detect the proliferation rate daily. (b) Cells were cultured for 3 days and incubated for an additional 11 days in the presence of 1 μM OXA to evaluate colony formation ability. (c) The soft agar colony formation assay was performed to detect cell sphere formation ability. Scale bar: 100 μM. (d) Transwell assays were performed to detect the migration ability. Scale bar: 100 μM. (e) Western blotting was used to analyze EMT and P-glycoprotein markers.
Figure 2

Phenotype detection of OXA-resistant cells. (a) Cells were cultured for 1–7 days, and the MTT assay was used to detect the proliferation rate daily. (b) Cells were cultured for 3 days and incubated for an additional 11 days in the presence of 1 μM OXA to evaluate colony formation ability. (c) The soft agar colony formation assay was performed to detect cell sphere formation ability. Scale bar: 100 μM. (d) Transwell assays were performed to detect the migration ability. Scale bar: 100 μM. (e) Western blotting was used to analyze EMT and P-glycoprotein markers.

3.3 RNA-seq analysis of gene expression profile of OXA-resistant cell lines

A total of 4,675 DGs were screened under the threshold of |log2[fold change (FC)]| > 1, including 2,060 upregulated and 2,615 downregulated genes (Figure 3a). The heatmap summarizes the gene expression of all DGs in the four samples, and the colors in each line indicate the FPKM values varying from +∞ to −∞ of the gene in each sample (Figure 3b). The gene expression files of the two different sensitive cells varied significantly, and several of them showed opposite FPKM values (positive and negative numbers). This was one major reason for the p-value not being considered in the screening of DGs. Interestingly, there was a significant difference in the FPKM values between the sensitive and resistant cell lines. The calculation of the final FC value was based on the mean FPKM value of the two sensitive/resistant samples in the same group; thus, thousands of genes were screened although there was no significant alteration in some genes (for example, similar watchet blue of FPKM values) between each pair of the sensitive and resistant cell lines. The DGs identified using RNA-seq provided several candidates for the study of resistance mechanisms, which also required further validation. The FC values of all DGs are listed in Table A1.

Figure 3 
                  RNA-seq analysis of gene expression profile of OXA-resistant cell lines. (a) Scatter plot of DGs in the resistant groups. G2: resistant group, G1: sensitive group. (b) Heat map summarizing the expression of the DGs in each cell line. The color (red-blue) indicates that the FPKM values vary from +∞ to −∞. Each line represents a gene and each column represents a sample or cell line.
Figure 3

RNA-seq analysis of gene expression profile of OXA-resistant cell lines. (a) Scatter plot of DGs in the resistant groups. G2: resistant group, G1: sensitive group. (b) Heat map summarizing the expression of the DGs in each cell line. The color (red-blue) indicates that the FPKM values vary from +∞ to −∞. Each line represents a gene and each column represents a sample or cell line.

3.4 Validation of the DGs by qPCR

Because the alteration trend of FPKM values of some DGs in each pair of cell lines was inconsistent, 12 genes were randomly selected from the top 300 DGs used for qPCR validation. The FPKM and FC values are presented in Table 2. 50% of the FPKM values in SGC996 cells and its resistant cells were 0, and the calculated log2FC value was predominantly contributed by GBC-SD and its resistant cells. The qPCR validation results indicated that the expression levels of most of the selected DGs were significantly changed in each resistant cell line (Figure 4). Among the 12 randomly selected genes, the expression changes of the 9 genes, accounting for 75%, in GBC-SD/OXA were consistent with the RNA-seq results. For SGC996/OXA, the alteration trends of five genes (CSF2, S1PR1, DLX1, MED29, and CXCL8) were conforming to the final log2FC values of RNA-seq (Figure 4, Table 2). In addition, the mRNA levels of above five genes were also both significantly enhanced in the two resistant cell lines (Figure 4). Overall, the RNA-seq results were reliable and satisfactory through the validation of random DGs, although some FPKM values were zero.

Table 2

Fold changes of 12 randomly selected genes among top 300

Gene ID Gene name FPKM FPKM (mean value) log2FC log2FC abs FC abs
GBC-SD/OXA SGC996/OXA GBC-SD SGC996 G2 G1
1 ENSG00000115009 CCL20 21.866 0.000 0.626 0.069 10.933 0.347 4.98 4.98 31.48
2 ENSG00000164400 CSF2 3.819 0.000 0.256 0.000 1.910 0.128 3.90 3.90 14.90
3 ENSG00000170989 S1PR1 0.000 0.110 0.000 0.005 0.055 0.003 4.38 4.38 20.89
4 ENSG00000160180 TFF3 0.032 0.000 1.490 0.000 0.016 0.745 −5.53 5.53 46.21
5 ENSG00000179772 FOXS1 0.054 0.000 2.121 0.000 0.027 1.061 −5.30 5.30 39.47
6 ENSG00000171557 FGG 0.074 0.000 5.745 0.000 0.037 2.872 −6.28 6.28 77.71
7 ENSG00000151067 CACNA1C 0.095 0.022 1.491 0.000 0.058 0.746 −3.68 3.68 12.79
8 ENSG00000126860 EVI2A 0.015 0.000 0.158 0.000 0.007 0.079 −3.40 3.40 10.59
9 ENSG00000144355 DLX1 0.044 0.251 0.021 0.008 0.148 0.014 3.35 3.35 10.21
10 ENSG00000168243 GNG4 0.000 0.058 0.000 0.006 0.029 0.003 3.25 3.25 9.50
11 ENSG00000063322 MED29 7.026 6.690 1.018 0.540 6.858 0.779 3.14 3.14 8.81
12 ENSG00000169429 CXCL8 471.258 5.653 55.490 3.152 238.456 29.321 3.02 3.02 8.13

G2: resistant group; G1: sensitive group; FC: fold change.

Figure 4 
                  qPCR validation of the mRNA levels of 12 DGs in resistant cell lines.
Figure 4

qPCR validation of the mRNA levels of 12 DGs in resistant cell lines.

3.5 Bioinformatical analyses of DGs and western blot validation of some pathways

GO enrichment analysis indicated that DGs were enriched in several receptor/transporter activity-related molecular functions, including calcitonin gene-related peptide receptors, kainate selective glutamate receptors, and water transmembrane transporters (Figure A1). Some biological processes were also included in the top 30 GO terms, such as AV node cell-to-bundle of His cell signaling and SA node cell-to-atrial cardiac muscle cell communication (Figure A1). These results show that DGs are involved in the regulation of the activity of some receptors/transporters or cell signaling transduction, which may be related to chemical tolerance. KEGG classification results shown in Figure 5 indicate that >100 DGs were classified into pathways of cancer: overview, signal transduction, and immune system. Approximately 50 DGs were found to be directly involved in various cellular processes (Figure 5). Enrichment analysis indicated that the DGs were enriched in the metabolism of some molecules, including retinol, phenylalanine, and ketone bodies (Figure A2).

Figure 5 
                  KEGG classification analysis of distribution of DGs in biological pathways.
Figure 5

KEGG classification analysis of distribution of DGs in biological pathways.

Resistant cells showed decreased proliferation and increased migration potency. Several relevant pathways were extracted from the KEGG classification results and are listed in Table 3. In the antineoplastic pathway of drug resistance, two sub-pathways were included: platinum drug resistance and EGFR tyrosine kinase inhibitor (TKI) resistance. Twelve DGs are involved in PD-L1 expression and the PD-1 checkpoint pathway in cancer, including CD247, also known as PD-L1. Notably, 27 DGs were classified into the transcriptional misregulation pathway in cancer. Some of them encode histones (H3C3, H3-4, H3C1, and H3C7) and some are inflammatory molecules (IL6 and CXCL8). These DGs are able to regulate transcription activity in various ways, which may be closely associated with the phenotypic alteration of the resistant cells. Some growth-related sub-pathways were also included, including the p53 pathway, the cell cycle, and oocyte meiosis. CDKN2A and CDKN1A are important regulators of cell cycle progression, and may be involved in slower proliferation. Three signaling pathways were randomly selected, and the MAPK pathway had the highest number of DGs (Table 3). To verify the relationship between the pathways and resistant cells, two pathways (MAPK and PD-L1) were selected for western blot analysis. The results in Figure 6 show that the expression of PD-L1 was significantly increased in resistant cells. The expression of p-ERK1/2 in SGC996/OXA was also significantly enhanced, whereas its level did not change in GBC-SD/OXA cells. Interestingly, the expression level of ERK1/2 in GBC-SD/OXA was significantly increased; therefore, the actual level of p-ERK1/2, but not the relative level, was significantly higher than that of the sensitive cells. The increased level of PD-L1 and activated ERK pathway may be potential mechanisms for acquired resistance.

Table 3

Several KEGG pathways and relevant DGs

Pathway_3 Pathway_3_num All_diff_gene_list Pathway_2 Pathway_2_num Pathway_1 Pathway_1_num
Platinum drug resistance 5 CDKN2A, ATM, AKT3, CDKN1A, GSTA4 Drug resistance: antineoplastic 24 Human Diseases 389
EGFR TKI resistance 7 IL6, GAS6, PRKCG, AKT3, GRB2, PDGFRA, JAK2
PD-L1 expression and PD-1 checkpoint pathway in cancer 12 TICAM2, IFNGR1, BATF2, MAP2K6, JUN, PRKCQ, CD247, LAT, AKT3, JAK2, RASGRP1, NFATC2 Cancer: overview 138 389
Transcriptional misregulation in cancer 27 LMO2, WNT16, GZMB, CEBPE, H3C3, IL6, NFKBIZ, MLLT3, MAF, H3-4, H3C1, CSF2, ATM, PROM1, SPI1, H3C7, MEF2C, MMP3, CXCL8, BCL2A1, CSF1R, CDKN1A, ITGB7, BCL11B, CEBPA, PLAT, PAX3
Regulation of actin cytoskeleton 29 FGFR1, INSRR, CHRM3, ARHGEF6, ITGA10, FGFR4, ITGA11, BDKRB2, FGF9, KNG1, FGF3, CHRM5, ITGB6, SCIN, ITGB3, MYLK, MYH11, PAK3, MYLK3, FGF18, MYH10, ITGAX, PDGFRA, ITGAD, ITGB7, MYL9, MYLK2, FGF17, CHRM1 Cell motility 29 Cellular Processes 158
p53 signaling pathway 9 SESN3, CDKN2A, SERPINB5, SESN2, ATM, MDM4, CDKN1A, SERPINE1, ADGRB1 Cell growth and death 43
Cell cycle 4 CDKN2A, ATM, CDKN1A, WEE2
Oocyte meiosis 4 CAMK2B, PRKACA, ADCY5, SPDYE16
Signaling pathways regulating pluripotency of stem cells 16 WNT16, FGFR1, TCF7, ONECUT1, WNT4, FGFR4, WNT10A, WNT2B, WNT9A, NODAL, AKT3, GRB2, ACVR1C, JAK2, ESRRB, ISL1 Cellular community – eukaryotes 73
JAK-STAT signaling pathway 19 IFNGR1, IL6, IL4R, CSF3, CSF2, IL2RG, IL20RB, IL23A, GFAP, IL3RA, AKT3, CNTFR, GRB2, PDGFRA, CDKN1A, JAK2, MPL, IL13RA2, FHL1 Signal transduction 231 Environmental information processing 327
MAPK signaling pathway 39 BDNF, EFNA2, FGFR1, CACNB2, ANGPT1, MAP2K6, FGFR4, PTPRR, RASGRP2, CACNA1C, KIT, JUN, EREG, FGF9, FGF3, IL1B, VEGFD, CACNA2D1, MEF2C, PRKCG, AKT3, GRB2, PRKACA, FGF18, CSF1R, PDGFRA, MAPK10, IL1A, PGF, RASGRP1, CACNB4, IGF2, CACNA1E, CACNA1G, HSPA6, CACNA1B, CACNA1D, FGF17, NGF
FoxO signaling pathway 16 SLC2A4, IL6, TPTEP2-CSNK1E, PLK2, AGAP2, ATM, RAG2, SOD2, PCK2, PRKAG2, AKT3, GRB2, S1PR1, CDKN1A, MAPK10, PCK1

Num: number.

Figure 6 
                  Western blot detection of the expression of PD-L1 and ERK1/2 pathways.
Figure 6

Western blot detection of the expression of PD-L1 and ERK1/2 pathways.

4 Discussion

Gemcitabine combined with platinum-based chemotherapeutics is still the gold standard treatment for advanced GBC [3]. Several clinical trials of targeted therapy have been conducted [7,8] with the aim of enhancing overall survival. However, high molecular heterogeneity and acquired resistance are inevitable, often resulting in treatment failure. Therefore, identification of more potential targets in resistant cells is an effective strategy to combat these challenges, especially in cancer with a significantly lower incidence.

A gradual increase in drug concentration is a widely used method to establish resistant cells. Generally, the drug concentration at the site of cell death (20%) is helpful for primary induction; thus, 0.05 μM OXA, which induces 10–20% of cell death, was selected as the initial dose. After 5 months of induction, the two OXA-resistant GBC cells were completely adapted to 5 μM OXA. The parental GBC cell lines were slightly resistant to OXA, and the IC50 values were approximately 29 μM and 7 μM, which were much higher than those of other cancer cells [12,13]. This may be due to the intrinsic resistance of the cell line, which is consistent with the clinical results that advanced GBC is resistant to most chemotherapeutic agents [14].

The resistant cell lines showed decreased proliferation potency, similar to that shown in previous studies [13,15], and increased clone formation ability with the addition of 1 μM OXA. This indicated a strong tolerance to OXA, as well as a significantly higher stemness of the resistant cells, which was then verified using a soft agar colony formation assay. In addition, enhanced migration ability and the occurrence of EMT were also detected, although the reduction in E-cadherin was not significant in GBC-SD/OXA cells. Upregulation of certain transporters has been identified as an important mechanism for resistance to chemotherapeutic agents [16]. In addition to P-gp, other multidrug resistance-associated proteins (MRPs), such as MRP1 and MPR3, were also detected; however, their expression alterations were not consistent in the two resistant cell lines. Therefore, only the results of P-gp increased in the two cell lines were considered. The difference in the expression of the MRPs also reflected the heterogeneity of the two parental cells in the process of acquired resistance.

RNA-seq analysis indicated that the expression profiles of the two parental cell lines varied significantly. It has been reported that the genomic alterations of GBC are different from those of other biliary system cancers and also depend on ethnicity [17]. We found that the individual differences were also significant, although the parental cell lines were both isolated from Chinese patients of the same age. This may also explain why the responses varied significantly after patients with similar HER2 amplifications received the same targeting therapy. Under the threshold of |log2FC| > 1, a total of 4,675 DGs were screened in the two resistant cell lines. We also attempted to screen the DGs combined with the p-value (<0.05); however, only 23 genes were obtained under the filters |log2FC| > 1 and p < 0.05. Therefore, only the FC value was used as a screening condition. qPCR validation indicated that five genes (CSF2, S1PR1, DLX1, MED29, and CXCL8) were increased in the two resistant cell lines, accounting for 41.67% of the 12 randomly selected DGs. Therefore, nearly 1,948 DGs were verified and require further study.

The protein encoded by CSF2, also known as granulocyte macrophage colony-stimulating factor (GM-CSF), functions as a cytokine that stimulates the growth and differentiation of stem cells [18]. It has been reported that CSF2 is closely associated with the poor prognosis of some cancers [19,20] and is also an important signaling molecule in the regulation of cancer cell stemness [21]. Stem cells can also secrete CSF2 in response to various injuries [22]. Similarly, higher levels of S1PR1 were also found to be related to shorter overall survival, and overexpression of S1PR1 significantly promotes EMT, invasion, and stemness of cancer cells [23]. These insights indicate that the enhanced colony formation ability of resistant cells may be attributed to the upregulations of CSF2 and S1PR1, and additional assays are required to confirm this.

KEGG classification analysis is a useful tool for the rapid identification of the biological roles of DGs. The decreased proliferation potency, increased migration, and clone formation abilities of resistant cells were all traceable following DGs classification in relevant pathways. Other resistance-related pathways also provided new insights for re-examining chemoresistance. Targeting EGFR is one of the most common strategies in clinical oncology, and TKI combined with doublet chemotherapy result in a higher response rate; however, progression-free survival is not enhanced [24]. This may be due to activation of the EGFR TKI resistance pathway. Growth-arrest specific 6 (GAS6), a member of this pathway, is one of the major ligands of the AXL receptor. Increased levels of GAS6 can protect AXL from proteasome-mediated degradation, thereby resulting in resistance to EGFR inhibition [25]. As there is currently no inhibitor of GAS6, targeting AXL with its inhibitors brings a new chance to overcome TKI resistance. This is also helpful in enhancing the clinical effects of TKI combined with chemotherapy.

The upregulation of PD-L1 and p-ERK1/2 reflects the activation of these two pathways. PD-L1, expressed in the majority of tumor cells, is the ligand of PD-1 expressed in immune cells, and the activation of PD-1/PD-L1 results in the blockage of T-cell activation, thereby aiding tumor cells in evading immune surveillance [26,27]. ERK activation plays an important role in the development and progression of cancers [28]. To date, blocking the two targets with inhibitors such as JTX-4014 (anti-PD-L1) and MK-8353 (anti-p-ERK1/2) has shown some benefits in patients with advanced or refractory solid tumors [29,30], which may also be useful in advanced or resistant GBC patients. Generally, the activation of the ERK pathway leads to the enhanced proliferation of cancer cells; however, the proliferation of OXA-resistant cells was actually decreased compared to that of sensitive cells. The proliferation of cells is not only regulated by the ERK pathway; other pathways, such as the JAK/STAT3 and FoxO signaling pathways, in which many genes were dysregulated in OXA-resistant cells, also play important regulatory roles in cell proliferation [31,32]. Therefore, the detected slowed proliferation is a final neutralizing result of different activated/inactivated levels of various pathways.

One limitation of this study is that only two pathways were detected, and more drug-resistance-relevant pathways require detection and verification. Another limitation is that the role of inhibiting the verified pathways was not investigated, which would help reverse OXA-resistance.

In summary, the present study is the first to establish two OXA-resistant cell lines and determine the gene expression profile of the resistant cell lines. The validated genes, CSF2 and S1PR1, as well as the pathways of PD-L1 and ERK1/2, provide a foundation for the study of resistance mechanisms and the development of new targets. The invalidated genes in the expression profile also provide several potential targets, which are of great importance for the precise treatment of advanced or refractory GBC with extensive molecular heterogeneity.


# Authors (Haijun Guo and Yunqing Zhi) contributed equally to this paper.


  1. Funding information: This study was supported by Talent Introduction Scientific Research Funds of East Hospital Affiliated to Tongji University (DFRC2021008).

  2. Author contributions: H.G., Z.J., and B.C. conceived and designed the experiments. H.G., Y.Z., and K.W. performed the experiments, N.L. and D.Y. acquired the data, K.W. and N.L. analyzed and interpreted the data. H.G. and Y.Z. wrote the article. Z.J. and B.C. reviewed and revised the article.

  3. Conflict of interest: The authors declare no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Appendix

Figure A1 Top 30 terms in GO enrichment analysis.
Figure A1

Top 30 terms in GO enrichment analysis.

Figure A2 Top 30 pathways in KEGG enrichment analysis.
Figure A2

Top 30 pathways in KEGG enrichment analysis.

References

[1] Erratum: Global cancer statistics. GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;2020(70):313. 10.3322/caac.21609.Search in Google Scholar PubMed

[2] Hundal R, Shaffer EA. Gallbladder cancer: epidemiology and outcome. Clin Epidemiol. 2014;6:99–109. 10.2147/CLEP.S37357.Search in Google Scholar PubMed PubMed Central

[3] Sasaki T, Takeda T, Okamoto T, Ozaka M, Sasahira N. Chemotherapy for biliary tract cancer in 2021. J Clin Med. 2021;10:3108. 10.3390/jcm10143108.Search in Google Scholar PubMed PubMed Central

[4] Abdel-Rahman O, Elsayed Z, Elhalawani H. Gemcitabine-based chemotherapy for advanced biliary tract carcinomas. Cochrane Database Syst Rev. 2018;4:CD011746. 10.1002/14651858.CD011746.pub2.Search in Google Scholar PubMed PubMed Central

[5] Zhang W, Zhou H, Wang Y, Zhang Z, Cao G, Song T, et al. Systemic treatment of advanced or recurrent biliary tract cancer. Biosci Trends. 2020;14:328–41. 10.5582/bst.2020.03240.Search in Google Scholar PubMed

[6] Rizzo A, Federico AD, Ricci AD, Frega G, Palloni A, Pagani R, et al. Targeting BRAF-Mutant Biliary Tract Cancer: Recent Advances and Future Challenges. Cancer Control. 2020;27:1073274820983013. 10.1177/1073274820983013.Search in Google Scholar PubMed PubMed Central

[7] Javle M, Borad MJ, Azad NS, Kurzrock R, Abou-Alfa GK, George B, et al. Pertuzumab and trastuzumab for HER2-positive, metastatic biliary tract cancer (MyPathway): a multicentre, open-label, phase 2a, multiple basket study. Lancet Oncol. 2021;22:1290–300. 10.1016/S1470-2045(21)00336-3.Search in Google Scholar PubMed

[8] Subbiah V, Lassen U, Elez E, Italiano A, Curigliano G, Javle M, et al. Dabrafenib plus trametinib in patients with BRAF(V600E)-mutated biliary tract cancer (ROAR): a phase 2, open-label, single-arm, multicentre basket trial. Lancet Oncol. 2020;21:1234–43. 10.1016/S1470-2045(20)30321-1.Search in Google Scholar PubMed

[9] Ikeda M, Ioka T, Fukutomi A, Morizane C, Kasuga A, Takahashi H, et al. Efficacy and safety of trametinib in Japanese patients with advanced biliary tract cancers refractory to gemcitabine. Cancer Sci. 2018;109:215–24. 10.1111/cas.13438.Search in Google Scholar PubMed PubMed Central

[10] Choi IS, Kim KH, Lee JH, Suh KJ, Kim JW, Park JH, et al. A randomised phase II study of oxaliplatin/5-FU (mFOLFOX) versus irinotecan/5-FU (mFOLFIRI) chemotherapy in locally advanced or metastatic biliary tract cancer refractory to first-line gemcitabine/cisplatin chemotherapy. Eur J Cancer. 2021;154:288–95. 10.1016/j.ejca.2021.06.019.Search in Google Scholar PubMed

[11] Lagenfelt H, Blomstrand H, Elander NO. Real-world evidence on palliative gemcitabine and oxaliplatin (GemOx) combination chemotherapy in advanced biliary tract cancer. Cancers (Basel). 2021;13:3507. 10.3390/cancers13143507.Search in Google Scholar PubMed PubMed Central

[12] Hirano K, Okumura T, Shimada Y, Watanabe T, Yamaguchi T, Nagata T, et al. Establishment and characterization of two novel human pancreatic carcinoma cell lines. Anticancer Res. 2015;35:3821–8.Search in Google Scholar

[13] Jensen NF, Stenvang J, Beck MK, Hanakova B, Belling KC, Do KN, et al. Establishment and characterization of models of chemotherapy resistance in colorectal cancer: Towards a predictive signature of chemoresistance. Mol Oncol. 2015;9:1169–85. 10.1016/j.molonc.2015.02.008.Search in Google Scholar PubMed PubMed Central

[14] Valle J, Wasan H, Palmer DH, Cunningham D, Anthoney A, Maraveyas A, et al. Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N Engl J Med. 2010;362:1273–81. 10.1056/NEJMoa0908721.Search in Google Scholar PubMed

[15] Wang H, Zhu Y, Hao C, Fan J, Liu Y, Wang Y. Establishment of a drug-resistant human cervical cancer cell line and research on its drug-resistance. J Cancer Res Ther. 2019;15:1221–5. 10.4103/0973-1482.204900.Search in Google Scholar PubMed

[16] Amawi H, Sim HM, Tiwari AK, Ambudkar SV, Shukla S. ABC transporter-mediated multidrug-resistant cancer. Adv Exp Med Biol. 2019;1141:549–80. 10.1007/978-981-13-7647-4_12.Search in Google Scholar PubMed

[17] Yang P, Javle M, Pang F, Zhao W, Abdel-Wahab R, Chen X, et al. Somatic genetic aberrations in gallbladder cancer: comparison between Chinese and US patients. Hepatobiliary Surg Nutr. 2019;8:604–14. 10.21037/hbsn.2019.04.11.Search in Google Scholar PubMed PubMed Central

[18] Huang X, Hu P, Zhang J. Genomic analysis of the prognostic value of colony-stimulating factors (CSFs) and colony-stimulating factor receptors (CSFRs) across 24 solid cancer types. Ann Transl Med. 2020;8:994. 10.21037/atm-20-5363.Search in Google Scholar PubMed PubMed Central

[19] Lee YY, Wu WJ, Huang CN, Li CC, Li WM, Yeh BW, et al. CSF2 overexpression is associated with STAT5 phosphorylation and poor prognosis in patients with urothelial carcinoma. J Cancer. 2016;7:711–21. 10.7150/jca.14281.Search in Google Scholar PubMed PubMed Central

[20] Xu Z, Zhang Y, Xu M, Zheng X, Lin M, Pan J, et al. Demethylation and overexpression of CSF2 are involved in immune response, chemotherapy resistance, and poor prognosis in colorectal cancer. Onco Targets Ther. 2019;12:11255–69. 10.2147/OTT.S216829.Search in Google Scholar PubMed PubMed Central

[21] Li X, Wang J, Wu W, Gao H, Liu N, Zhan G, et al. Myeloid-derived suppressor cells promote epithelial ovarian cancer cell stemness by inducing the CSF2/p-STAT3 signalling pathway. FEBS J. 2020;287:5218–35. 10.1111/febs.15311.Search in Google Scholar PubMed PubMed Central

[22] Park SR, Cho A, Kim JW, Lee HY, Hong IS. A novel endogenous damage signal, CSF-2, activates multiple beneficial functions of adipose tissue-derived mesenchymal stem cells. Mol Ther. 2019;27:1087–100. 10.1016/j.ymthe.2019.03.010.Search in Google Scholar PubMed PubMed Central

[23] Yokota T, Nojima H, Kuboki S, Yoshitomi H, Furukawa K, Takayashiki T, et al. Sphingosine-1-phosphate receptor-1 promotes vascular invasion and EMT in hepatocellular carcinoma. J Surg Res. 2021;259:200–10. 10.1016/j.jss.2020.11.044.Search in Google Scholar PubMed

[24] Lee J, Park SH, Chang HM, Kim JS, Choi HJ, Lee MA, et al. Gemcitabine and oxaliplatin with or without erlotinib in advanced biliary-tract cancer: a multicentre, open-label, randomised, phase 3 study. Lancet Oncol. 2012;13:181–8. 10.1016/S1470-2045(11)70301-1.Search in Google Scholar PubMed

[25] Dong M, Xiao Q, Hu J, Cheng F, Zhang P, Zong W, et al. Targeting LRIG2 overcomes resistance to EGFR inhibitor in glioblastoma by modulating GAS6/AXL/SRC signaling. Cancer Gene Ther. 2020;27:878–97. 10.1038/s41417-020-0163-1.Search in Google Scholar PubMed

[26] Li Z, Sun G, Sun G, Cheng Y, Wu L, Wang Q, et al. Various uses of PD1/PD-L1 inhibitor in oncology: Opportunities and challenges. Front Oncol. 2021;11:771335. 10.3389/fonc.2021.771335.Search in Google Scholar PubMed PubMed Central

[27] Gulley JL, Schlom J, Barcellos-Hoff MH, Wang XJ, Seoane J, Audhuy F, et al. Dual inhibition of TGF-beta and PD-L1: a novel approach to cancer treatment. Mol Oncol. 2021;16:2117–34. 10.1002/1878-0261.13146.Search in Google Scholar PubMed PubMed Central

[28] Marampon F, Ciccarelli C, Zani BM. Biological rationale for targeting MEK/ERK Pathways in anti-cancer therapy and to potentiate tumour responses to radiation. Int J Mol Sci. 2019;20(10):2530. 10.3390/ijms20102530.Search in Google Scholar PubMed PubMed Central

[29] Papadopoulos KP, Lakhani N, Falchook GS, Riley G, Baeck J, Brown KS, et al. Phase I, first-in-human trial of programmed cell death receptor-1 (PD-1) inhibitor, JTX-4014, in adult patients with advanced, refractory, solid tumors. Cancer Immunol Immunother. 2021;70:763–72. 10.1007/s00262-020-02730-5.Search in Google Scholar PubMed PubMed Central

[30] Moschos SJ, Sullivan RJ, Hwu WJ, Ramanathan RK, Adjei AA, Fong PC, et al. Development of MK-8353, an orally administered ERK1/2 inhibitor, in patients with advanced solid tumors. JCI Insight. 2018;3:e92352. 10.1172/jci.insight.92352.Search in Google Scholar PubMed PubMed Central

[31] Huynh J, Etemadi N, Hollande F, Ernst M, Buchert M. The JAK/STAT3 axis: A comprehensive drug target for solid malignancies. Semin Cancer Biol. 2017;45:13–22. 10.1016/j.semcancer.2017.06.001.Search in Google Scholar PubMed

[32] Farhan M, Wang H, Gaur U, Little PJ, Xu J, Zheng W. FOXO signaling pathways as therapeutic targets in cancer. Int J Biol Sci. 2017;13:815–27. 10.7150/ijbs.20052.Search in Google Scholar PubMed PubMed Central

Received: 2022-07-07
Revised: 2023-03-09
Accepted: 2023-03-13
Published Online: 2023-09-27

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Downloaded on 19.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0690/html?lang=en
Scroll to top button