Home Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
Article Open Access

Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells

  • Xiaolin Wang , Deshang Chen , Guoying Han , Xiaomin Wang , Xuebao Liu , Binbin Xu , Weiwei Liu , Hui Li , Mingjie Zhang , Shiyin Ma and Yuefeng Han EMAIL logo
Published/Copyright: March 15, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Most of advanced hypopharyngeal squamous cell carcinoma (HSCC) are resistant to chemotherapy, and there is still lack of effective treatment for HSCC now. The present study aimed to investigate whether downregulation of RNA-binding motif protein 17 (RBM17) could enhance cisplatin sensitivity and inhibit cell invasion in HSCC and the underlying mechanism. We observed that RBM17 was upregulated in tumor tissues and associated with poor progression. Treatment of FaDu cells with cisplatin increased RBM17 expression in mRNA levels. Downregulation of RBM17 enhanced cisplatin-mediated inhibition of FaDu cells. In addition, downregulation of RBM17 effectively suppressed tumor cell migration and invasion through the reversion of epithelial–mesenchymal transition. Moreover, downregulation of RBM17 could significantly slow tumor growth in FaDu xenograft tumor model. Liquid chromatography–mass spectrometry/mass spectrometry detection and independent PRM analysis showed that 21 differentially expressed proteins were associated with the downregulation of RBM17. Taken together, our study implied that downregulation of RBM17 could serve as a novel approach to enhance cisplatin sensitivity in HSCC.

Keywords: hypopharyngeal squamous cell carcinoma; RNA-binding motif protein 17; epithelial–mesenchymal transition; cisplatin

1 Introduction

Hypopharyngeal squamous cell carcinoma (HSCC) is the poorest prognosis tumor of head and neck squamous cell carcinoma (HNSCC), which arise from the mucosa of the hypopharynx and account for about 5% of all head and neck cancers [1]. Due to there is no obvious symptoms in early stages, most of patients with HSCC were diagnosed as at stage III or IV. Although huge progress had been made for treating HSCC, which contains primary surgery with pre- or postoperative radiotherapy and primary radiotherapy with chemotherapy, the 5-year overall survival (OS) with advanced HSCC is lower than 40% [2]. Cisplatin-based chemotherapy plays important role in the treatment of HNSCC. Disappointedly, HSCC is resistant to chemotherapy [3]. Therefore, it is urgently need to elucidate the mechanism of chemoresistance and the development of new therapeutic approaches.

Previous studies revealed that alternative pre-mRNA splicing is a vital molecular mechanism for promoting proteomics diversity, which plays a crucial role in tumor progress [4]. Both cis-regulatory elements, i.e., short RNA sequence motifs, and trans-acting factors, i.e., RNA-binding proteins, play essential role in the regulation of alternative splicing [5,6,7]. RNA-binding motif protein 17 (RBM17), also named splicing factor 45, was first identified as a member of the spliceosome [8]. RBM17 harbors an unstructured N-terminal domain, an a-helical G-patch motif involved in protein–protein and protein–nucleic acid interactions and a C-terminal RRM domain required for mRNA splicing [9]. In terms of tumor research, RBM17 can promote the proliferation of tumor cells in liver cancer cells and is associated with poor prognosis, so it can be used as a potential therapeutic target for liver cancer [10]. RBM17 binds to tiRNA-Gly and induces alternative splicing of thyroid carcinoma to promote cell proliferation and migration [11]. In addition, it is reported that overexpression of RBM17 can induce multidrug resistance to anticancer drugs. In our previous studies, it has been demonstrated that knockdown of RBM17 can inhibit the proliferation of FaDu cells in hypopharyngeal cancer [12]. However, no study has reported the effects of RBM17 on drug resistance, cell migration, and invasion in hypopharyngeal cancer.

Therefore, RBM17 in hypopharyngeal carcinoma was selected as the research object in this study. Through targeted proteomics, FaDu xenograft model, and other experimental methods, the aim is to explore the effect and molecular mechanism of downregulation of RBM17 to improve cisplatin sensitivity and inhibit hypopharyngeal cancer, so as to provide a basis for elucidating the mechanism of cisplatin resistance in hypopharyngeal cancer and discovering new potential therapeutic targets.

2 Materials and methods

2.1 Patient samples and cell line

HSCC tissues and adjacent normal tissues were collected from six patients, who were hospitalized in The First Affiliated Hospital of Bengbu Medical College from 2021 to 2022. FaDu cells were purchased from BeNa Culture Collection Incorporation Co., Ltd., and maintained at 37°C in a humidified 5% CO2 atmosphere in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin, and 100 µg/ml streptomycin (Hyclone, GE).

  1. Ethics approval and consent to participate: The present human and animal studies were approved by the Ethics Committee of The First Affiliated Hospital of Bengbu Medical College, and patients provided written informed consent.

  2. Informed consent: Informed consent has been obtained from all individuals included in this study.

2.2 Lentiviral construction for shRNA treatment

RBM17-targeted shRNA (5′-ACTTAAGTGTCCTACTAAA-3′, GenBank NM_032905) and the scramble negative control sequence (5′-AATTCTCCGAACGTGTCACGT-3′) were cloned into the pGV115-green fluorescent protein lentiviral vector (Shanghai Genechem Co., Ltd., Shanghai, China).

2.3 Cell proliferation assays

Cell proliferation was evaluated by cell counting kit-8 (CCK-8) assay. In brief, FaDu cells were seeded in a 96-well plate at 5,000 cells per well and cultured in 37°C incubator for 24 h. After treatment with different concentrations of cisplatin for 24 h, 100 μl of CCK-8 solution was added to each well. Two hours later, absorbance was measured at a wavelength of 450 nm with a plate reader.

2.4 Wound healing assays

Twelve-well plate was seeded with LV-scramble or LV-shRBM17-infected FaDu cells at a density of 100,000 cells/well. The monolayer cells were scratched by a sterile pipette tip and washed three times by phosphate-buffered saline (PBS). Photographic images were taken at 0, 24, and 48 h.

2.5 Cell migration and invasion assays

The migration and invasion abilities of FaDu cells were investigated by using a 24-well Transwell chamber (diameter 6.5 mm, 8 μm pore size; Corning, Corning, NY, USA). Briefly, the infected FaDu cells were resuspended in serum-free medium and seeded in the upper chamber at a density of 3 × 104 cells/well. The medium with 10% FBS was added to the bottom chamber. For invasion assays, the upper chamber was pre-treated with Matrigel (50 μl; BD Biosciences). After incubation in a 5% CO2 humidified incubator at 37°C for 24 h, the non-migrating cells were scraped with cotton swabs and the migrated and invaded cells were fixed with 4% paraformaldehyde and then stained with 5% crystal violet. Cells were quantified in three random fields using an optical inverted microscope at a magnification of 200×.

2.6 Liquid chromatography–mass spectrometry (LC–MS)

The tryptic peptides were dissolved in 0.1% formic acid (solvent A), and then separated using the EASY-nLC 1000 ultra-high performance liquid system. The peptides are separated by the ultra-high-performance liquid system and injected into the NSI ion source for ionization and then analyzed by a Q Exactive mass spectrometer (Thermo Fisher Scientific). The mass spectrometer was operated in a positive ion mode. Mass spectrometry (MS) data were acquired using a data-dependent top 10 method dynamically choosing the most abundant precursor ions from the survey scan (350–1,800 m/z) for HCD fragmentation. Survey scans were acquired at a resolution of 70,000 at m/z 200 with an AGC target of 3e6 and a maxIT of 50 ms. MS2 scans were acquired at a resolution of 17,500 for HCD spectra at m/z 200 with an AGC target of 2e5 and a maxIT of 45 ms, and isolation width was 2 m/z. Only ions with a charge state between 2 and 6 and a minimum intensity of 2e3 were selected for fragmentation. Dynamic exclusion for selected ions was 30 s. Normalized collision energy was 30 eV. MS/MS raw files were processed using MASCOT engine (Matrix Science, London, UK; version 2.6) embedded into Proteome Discoverer 2.2 and searched against the Uniprot_HomoSapiens_20367_20200226 database. Except for TMT labels, carbamidomethyl (C) was set as a fixed modification. Variable modifications were oxidation (M) and acetyl (protein N-term). A peptide and protein false discovery rate of 1% were enforced using a reverse database search strategy. Proteins with fold change >1.2 and P value (Student’s t test) <0.05 were considered to be differentially expressed proteins [13,14].

2.7 qRT-PCR

Total RNA was extracted from tissue and FaDu cells using the TRIzol reagent (Invitrogen). Complementary DNA (cDNA) was reverse transcribed by the PrimeScriptÔ 1st Strand cDNA Synthesis Kit (Takara, Kusatsu, Japan) according to the manufacturer’s instructions. The SYBRR Premix Ex TaqÔ (TaKaRa) was used for qRT-PCR. The2−ΔΔCt method was adopted and applied to calculate the relative expression. mRNA was normalized using GADPH, which were reported in our previous study [15]. The list of primers is shown in Table 1.

Table 1

Primer sequences used for qRT-PCR

Gene Primer sequence (5′-3′)
E-cadherin F: GAAGTGTCCGAGGACTTTGG
R: CAGTGTCTCTCCAAATCCGATA
Vimentin F: TGTCCAAATCGATGTGGATGTTTC
R: TTGTACCATTCTTCTGCCTCCTG
ZEB1 F: GCACAACCAAGTGCAGAAGA
R: GCCTGGTTCAGGAGAAGATG
RBM17 F: AGTGGAGACCAGTGACTCAAA
R: CTGGGGCGAGGACTGTACT
GAPDH F: CAGCCTCAAGATCATCAGCA
R: TGTGGTCATGAGTCCTTCCA

2.8 Western blot analysis

FaDu cells and tissue were collected and resuspended in cell lysis buffer for western blot on ice. BCA protein quantification kit was used to detect the protein concentration. Protein from each sample was loaded onto an SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Millipore, Temecula, CA, USA). Membranes were blocked with 5% skim milk in phosphate-buffered saline containing 0.1% Tween-20 (PBS-T). To detect the target proteins, membranes were incubated with primary antibodies Vimentin (1:2000, Proteintech Group), E-cadherin (1:5000, Proteintech Group), GAPDH (1:3000, Proteintech Group), ZEB1 (1:500, Proteintech Group), ARHGDIB (1:5,000; Abcam), UHRF1 (1:500; Abcam), CCN1 (1:1,000; Abcam) and β-actin (1:2,000; Abcam) overnight at 4°C. Membranes were then washed for 10 min with PBS-T for three times and incubated with secondary antibody (1:2,000; Abcam) for 2 h at room temperature. The membranes were washed and developed using chemiluminescence reagents (Millipore) and visualized with gel imaging equipment (Bio-Rad, USA).

2.9 In vivo tumorigenesis

The experiments were performed with the approval of Animal Care and Committee of Bengbu Medical College. Six-week-old BALB/c female nude mice were purchased from Beijing Vital River Animal Company. A number of 1 × 107 logarithmically growing FaDu cells (LV-scramble and LV-shRBM17) were subcutaneously inoculated into the left flank of mice. The diameters of the tumors were measured every 2 days, and the tumor volumes were calculated.

2.10 Bioinformatic analysis

The “Expression analysis-Box Plots” module was used to get box plots of the expression difference between these tumor tissues and the corresponding normal tissues of the GTEx (Genotype-Tissue Expression) database and “Survival Analysis” module was applied to obtain OS and disease-free survival (DFS) data with 50% cutoff by online tool of Gene Expression Profiling Interactive Analysis (GEPIA) (http://gepia.cancer-pku.cn) database [16]. We used the UALCAN portal to analyze cancer omics data and conduct protein expression analysis of the clinical proteomic tumor analysis consortium (CPTAC) dataset [17].

2.11 Statistical analysis

Data were analyzed using GraphPad Prism 8.0 software (GraphPad Software Inc., CA) and were expressed as mean ± standard error of mean. Difference among the groups was determined using analysis of variance or unpaired t test. All experiments were repeated at least three times. P < 0.05 was considered to be statistically significant.

3 Results

3.1 Gene expression profiling of RBM17 in normal human versus tumor tissues

First, we applied the TCGA and GTEx datasets to evaluate the expression of RBM17 in tumor tissues and normal tissues by the GEPIA. As shown in Figure 1a, compared to normal tissues, RBM17 transcript levels were significantly increased in tumor tissues. In addition, the CPTAC dataset displayed increasing level of RBM17 protein in the primary tumor tissues (Figure 1b). In addition, qRT-PCR and western blot results confirmed that RBM17 expression was upregulated in HSCC tissues compared with adjacent normal tissues (Figure 1c and d). Kaplan–Meier survival curves from the GEPIA database demonstrated that high expression of RBM17 was significantly associated with shorter OS time and DFS time (P = 0.017; P = 0.012) (Figure 1e and f).

Figure 1 RBM17 is upregulated and associated with a poorer prognosis in HNSCC. (a) The expression of RBM17 in the TCGA database was compared with the expression of the corresponding normal tissues in the GTEx database, which was analyzed by GEPIA. (b) The protein level of RBM17 in primary tumor tissues and normal tissues from CPTAC database. (c and d) Expression level of RBM17 was confirmed by qRT-PCR and western blot in HSCC tissues and normal tissues. (e and f) Kaplan–Meier survival curve analysis of RBM17 for the OS and DFS in HNSCC from GEPIA database. **P < 0.01, ***P < 0.001.
Figure 1

RBM17 is upregulated and associated with a poorer prognosis in HNSCC. (a) The expression of RBM17 in the TCGA database was compared with the expression of the corresponding normal tissues in the GTEx database, which was analyzed by GEPIA. (b) The protein level of RBM17 in primary tumor tissues and normal tissues from CPTAC database. (c and d) Expression level of RBM17 was confirmed by qRT-PCR and western blot in HSCC tissues and normal tissues. (e and f) Kaplan–Meier survival curve analysis of RBM17 for the OS and DFS in HNSCC from GEPIA database. **P < 0.01, ***P < 0.001.

3.2 Downregulation of RBM17 inhibits HSCC proliferation and sensitizes HSCC to cisplatin

To investigate the effect of cisplatin on the growth and proliferation of HSCC, FaDu cells were treated with gradient concentration of cisplatin. Cisplatin significantly decreases the proliferation of FaDu cells; the IC50 value is about 3.26 μg/ml (Figure 2a). Furthermore, we examined whether cisplatin can regulate the expression of RBM17. Interestingly, real-time PCR result indicated that cisplatin can increase the RBM17 mRNA level (Figure 2b). The effect of RBM17 knockdown on the sensitivity of FaDu cells to cisplatin was then evaluated by CCK-8 assays. The results showed that downregulation of RBM17 by lentiviral vector significantly decreases cell viability of cisplatin-treated FaDu cells (Figure 2c).

Figure 2 Downregulation of RBM17 enhances cisplatin sensitivity in vitro. (a) Inhibition of cisplatin on FaDu cells was in a concentration-dependent manner (b) FaDu cells were treated with 3.26 μg/ml cisplatin for 24 h, and the mRNA level of RBM17 was detected by real-time PCR. (c) LV-shRBM17- or LV-scramble-infected cells were incubated with different concentrations of cisplatin for 24 h, and the cell viability was determined by CCK-8 assays. **P < 0.01.
Figure 2

Downregulation of RBM17 enhances cisplatin sensitivity in vitro. (a) Inhibition of cisplatin on FaDu cells was in a concentration-dependent manner (b) FaDu cells were treated with 3.26 μg/ml cisplatin for 24 h, and the mRNA level of RBM17 was detected by real-time PCR. (c) LV-shRBM17- or LV-scramble-infected cells were incubated with different concentrations of cisplatin for 24 h, and the cell viability was determined by CCK-8 assays. **P < 0.01.

3.3 Downregulation of RBM17 inhibits the invasion, migration, and epithelial–mesenchymal transition (EMT) processes of FaDu cells

Our previous study demonstrated that the acquisition of cisplatin resistance is related with a more aggressive and invasive phenotype in nasopharyngeal carcinoma [15]. To assess whether knockdown RBM17 can affect the migration and invasion ability of FaDu cells, we performed wound-healing and Transwell assays. We found that cell migration and invasion were remarkably decreased in LV-shRBM17 cells compared with LV-scramble cells (Figure 3a and b). In these results, we deduced that the RBM17 pathway may induce EMT in HSCC. We detected mRNA and protein expression of EMT-related genes. Protein and mRNA levels of EMT markers Vimentin and transcript factor ZEB1 were significantly decreased, but the expression level of epithelial marker E-cadherin was remarkably increased in LV-shRBM17 cells, compared with LV-scramble cells (Figure 3c and d).

Figure 3 Knockdown of RBM17 affects FaDu cell invasion, migration, and EMT. (a) Cell migration ability was examined by the wound-healing assay. Images were taken using a 4× objective lens. (b) The cell invasion ability was investigated using a Transwell assay. (c and d) ZEB1, Vimentin, and E-cadherin expressions in LV-shRBM17 and LV-scramble cells were detected by qRT-PCR and western blot. *P < 0.05, **P < 0.01.
Figure 3

Knockdown of RBM17 affects FaDu cell invasion, migration, and EMT. (a) Cell migration ability was examined by the wound-healing assay. Images were taken using a 4× objective lens. (b) The cell invasion ability was investigated using a Transwell assay. (c and d) ZEB1, Vimentin, and E-cadherin expressions in LV-shRBM17 and LV-scramble cells were detected by qRT-PCR and western blot. *P < 0.05, **P < 0.01.

3.4 Downregulation of RBM17 decreases tumor growth in an animal model

We evaluated the effect of RMB17 downregulation on the HSCC growth in a xenograft mice model. Flank tumors were established in nude mice inoculated with FaDu cells stably expressing shRNA directed against the RBM17. Downregulation of RBM17 significantly inhibited tumor growth (Figure 4a) and reduced tumor burden (Figure 4b and c), relative to the control mice.

Figure 4 Knockdown RBM17 inhibits FaDu HSCC tumor growth in vivo. (a) Tumor volume was measured every 2 days from day 7 to day 21. (b) Tumor weight was calculated at day 21. (c) Representative images of FaDu HSCC xenograft tissues in different groups. *P < 0.05, ***P < 0.001.
Figure 4

Knockdown RBM17 inhibits FaDu HSCC tumor growth in vivo. (a) Tumor volume was measured every 2 days from day 7 to day 21. (b) Tumor weight was calculated at day 21. (c) Representative images of FaDu HSCC xenograft tissues in different groups. *P < 0.05, ***P < 0.001.

3.5 Analysis of differentially expressed proteins of RBM17-downregulated cells vs control cells

LC–MS analysis was performed to explore RBM17-regulated proteins. Expression alterations in the proteomes were analyzed on RBM17 downregulation in FaDu cells (Figure 5a). Comparative proteome analysis was administrated on three samples per group, and these differentially expressed proteins were identified with ＞1.2-fold changes and P-values ＜0.05. There were 62 differentially expressed proteins, 21 upregulated and 41 downregulated. To understand the significant biological function and pathways associated with RBM17, GO enrichment analysis was carried out for biological process, molecular function, and cellular components (Figure 5b). Biological process category analysis showed that these proteins with enhanced localization in the cell surface were associated with cell cycle regulation. Molecular function category analysis demonstrated that these differential proteins of cell membrane were involved in kinase activity and signaling receptor binding. The cellular component category indicated that these differential proteins of cell surface were enriched in the negative regulation of apoptotic process.

Figure 5 Comparative profiling of the proteomes after downregulation of RBM17. (a) Volcano plots of the proteomes in LV-shRBM17 vs LV-scramble. (b) Bubble chart displaying GO terms for biological process and cellular components. GO terms were functionally grouped depending on Kappa scores and only the most significant GO terms were displayed. The significance of each GO term was displayed as −log10 (P-value).
Figure 5

Comparative profiling of the proteomes after downregulation of RBM17. (a) Volcano plots of the proteomes in LV-shRBM17 vs LV-scramble. (b) Bubble chart displaying GO terms for biological process and cellular components. GO terms were functionally grouped depending on Kappa scores and only the most significant GO terms were displayed. The significance of each GO term was displayed as −log10 (P-value).

To further verify the abundance of proteins of interest, parallel reaction monitoring (PRM) was utilized for label-free quantification by an MS. Due to the limitation of proteins’ characteristics and their expression abundance, 28 potential proteins were further independently validated by PRM analysis. More than two unique peptides were used for quantifying most protein; however, some proteins were identified only by one peptide because of sensitivity and other reasons. As shown in Figure 6a, 12 proteins (GABARAPL2, HMGCS1, ARHGDIB, CCN1, SCD, SQLE, CNN3, CKS2, RAB5A, MCM2, MORF4L1, and UHRF1) were enriched in RBM17-dowregutated cells, and 9 proteins (HMBS, FERMT2, VCL, SDC4, ATP1B1, ARCN1, SOD2, IL1A, ICAM1) were reduced in RBM17-downregulated cells.

Figure 6 PRM analysis of the differentially expressed proteins. (a) PRM analysis of the differentially expressed proteins after downregulation of RBM17 compared to LV-scramble groups. (b) Selected differentially expressed proteins were confirmed by western blot.
Figure 6

PRM analysis of the differentially expressed proteins. (a) PRM analysis of the differentially expressed proteins after downregulation of RBM17 compared to LV-scramble groups. (b) Selected differentially expressed proteins were confirmed by western blot.

We further confirmed the expression results of three representative proteins by western blot (Figure 6b). Compared with lv-scramble cells, the expressions of ARHGDIB, UHRF1 and CCN1 in LV-shRBM17 cells were increased, which was consistent with the results of PRM.

4 Discussion

The pathogenesis and drug resistance of HSCC have complex mechanisms, which are not fully understood at present, and abnormal gene expression may be an important factor. In our previous studies, we found that knockdown of RBM17 can inhibit the proliferation of cancer cells by inducing FaDu cell cycle arrest and apoptosis using flow cytometry [12]. On this basis, this study revealed for the first time the functional role of RBM17 in the regulation of cisplatin sensitivity, migration, invasion, and EMT of hypopharyngeal cancer cells and its downstream-related molecular mechanisms.

We first analyzed the difference of RBM17 expression between tumor and normal tissues using GEPIA and CPTAC databases. The results showed that the expression of RBM17 was significantly increased in HNSCC tumor tissues, and the prognosis of HNSCC patients with high expression of RBM17 was poor. The expression of RBM17 in hypopharyngeal cancer tissues was verified by qRT-PCR and western blot, and it was found that RBM17 was highly expressed in hypopharyngeal cancer tissues. Studies have shown that high expression of RBM17 in hematological tumors can promote the progression of leukemia and may be related to drug resistance of leukemia [18]. Therefore, we speculate that RBM17 may play an important role in chemotherapy resistance of HSCC. It was found that FaDu cells treated with IC50 concentration of cisplatin could effectively improve the expression level of RBM17 in mRNA, and knockdown of RBM17 in FaDu cells could enhance the sensitivity of cancer cells to cisplatin. Consistent with our findings, Perry et al. found that RBM17 promotes multidrug resistance in ovarian cancer cells [19]. Through a series of phenotypic experiments, we found that knockdown of RBM17 inhibited the migration and invasion of cancer cells. Li et al. and Lu et al. found that RBM17 had a cancer-promoting effect in liver cancer cells and glioma cells, which was similar to our findings [4,10]. However, different from this study, they mainly studied the regulation of RBM17 on cancer cell cycle and apoptosis and did not involve in the migration and invasion of cancer cells. Our study made up for the deficiency in this aspect.

EMT is a process of epithelial marker loss and mesenchymal phenotype acquisition, and more and more studies have shown that EMT is a key factor leading to tumor cell invasion and metastasis [20]. For example, Liu et al. found that RBM24 could regulate the EMT process of FaDu cells, thus affecting the migration and invasion of hypopharyngeal cancer [21]. In addition, previous studies have shown that EMT plays an important role in tumor cisplatin resistance [22,23,24,25,26]. Our previous studies have shown that RBM17 can affect the migration, invasion ability, and cisplatin sensitivity of hypopharyngeal cancer cells. However, whether the EMT process of hypopharyngeal cancer cells is related to RBM17 has not been reported in the previous literature. To further investigate the effect of RBM17 on FaDu cells, we detected EMT-related markers by qRT-PCR and western blot. Compared with the control group, the expression levels of Vimentin and ZEB1 in LV-shRBM17 cells were significantly decreased. However, the expression level of E-cadherin, an epithelial cell marker, was significantly increased. This suggests that knockdown of RBM17 can inhibit EMT progression in hypopharyngeal cancer. In the present study, we also assessed whether downregulation of RBM17 can effectively inhibit tumor growth in FaDu HSCC xenograft mouse models. We found that knockdown of RBM17 significantly slows tumor growth compared with control mice.

To reveal the potential proteins that were regulated by RBM17 and involved in EMT, herein, the proteomes were comparatively profiled using LC–MS/MS quantitative analysis. Compared with the LV-scramble cells, the experimental group revealed a large number of differential proteins in cell membrane and cytosol. Bioinformatics analysis showed that these differential proteins were significantly enriched during cell cycle regulation and negative regulation of apoptosis and were primarily related to NF-kB signaling and biosynthesis of secondary metabolite pathways. We further screened out 21 differentially expressed proteins by PRM and then selected three representative proteins, ARHGDIB, UHRF1 and CCN1, for western blot verification. Previous study reported that ARHGDIB, also known as RhoGDI2, is a guanosine diphosphate dissociation inhibitor that can decrease cell migration and invasion in bladder cancer [27]. Kim et al. demonstrated that downregulation of UHRF1 contributes to the induction of the EMT in hepatocellular carcinoma cells. UHRF1 deficiency can enhance the migratory and invasive properties of cells via inducing EMT, increasing the tumorigenic capacity of cells and leading to the expansion of cancer stem-like cells [28]. Johnson et al. found that recombinant CCN1 directly inhibited in vitro growth of MM cells, and overexpression of CYR61 in MM cells reduced tumor growth [29]. Chen et al. reported that CCN1 suppresses hepatocarcinogenesis by inhibiting carcinogen-induced compensatory hepatocyte proliferation, thus limiting the expansion of damaged and potentially oncogenic hepatocytes [30]. However, the precise mechanisms how RBM17 regulates cisplatin sensitivity and cell invasion in human HSCC FaDu cells through these screened proteins need to be elucidated in the future. In addition, we reviewed the literature and obtained several biomarkers that may be associated with the prognosis of hypopharyngeal cancer, such as PD-L1, SSR1, S100A4, PCDH20, and α2δ1 [31,32,33,34,35]. These biomarkers were compared with the screened differential proteins to try to find out the association between RBM17 and these biomarkers. Unfortunately, we have not been able to prove the potential association between RBM17 and these biological targets based on the data we have so far. More work and experiments are needed subsequently to further reveal the mechanism of action of RBM17 in hypopharyngeal cancer.

In summary, our findings prove that RBM17 is highly expressed in hypopharyngeal cancer and is associated with poor prognosis. Knockdown of RBM17 inhibits FaDu cells in vitro and in vivo and improves cisplatin sensitivity. More importantly, we observed that downregulation of RBM17 can reverse EMT, and the mechanism may be related to the proteins we screened. Therefore, RBM17 may be a potential therapeutic target for HSCC.

Abbreviations

CPTAC

clinical proteomic tumor analysis consortium

DFS

disease-free survival

EMT

epithelial–mesenchymal transition

GEPIA

Gene Expression Profiling Interactive Analysis

GTEx

Genotype-Tissue Expression

HNSCC

head and neck squamous cell carcinoma

HSCC

hypopharyngeal squamous cell carcinoma

LC–MS

liquid chromatography–mass spectrometry

MS

mass spectrometry

OS

overall survival

PRM

parallel reaction monitoring

RBM17

RNA-binding motif protein 17

TCGA

The Cancer Genome Atlas

# These authors have contributed equally to this work and share first authorship.

Acknowledgements

Not applicable.

  1. Funding information: This work was supported by the Anhui Provincial University Natural Science Key Project (No. KJ2019A0400), the Anhui Provincial University Natural Science Key Project (No. KJ2019A0376) and Science and Technology Development Foundation of Bengbu Medical College (No. BYKF1855).

  2. Author contributions: X.W., D.C. and YH. participated in the design of the study and the data interpretation. X.W., D.C. and YH. performed the experiments with the help from G.H., X.W., X.L., B.X., W.L., H.L., M.Z. and S.M. X.W. and D.C. prepared the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Qian Y, Liu D, Cao S, Tao Y, Wei D, Li W, et al. Upregulation of the long noncoding RNA UCA1 affects the proliferation, invasion, and survival of hypopharyngeal carcinoma. Mol Cancer. 2017;16(1):68. 10.1186/s12943-017-0635-6.Search in Google Scholar PubMed PubMed Central

[2] Jang JY, Kim EH, Cho J, Jung JH, Oh D, Ahn YC, et al. Comparison of oncological and functional outcomes between initial surgical versus non-surgical treatments for hypopharyngeal cancer. Ann Surg Oncol. 2016;23(6):2054–61. 10.1245/s10434-016-5088-4.Search in Google Scholar PubMed

[3] Zhao XG, Sun RJ, Yang XY, Liu DY, Lei DP, Jin T, et al. Chloroquine-enhanced efficacy of cisplatin in the treatment of hypopharyngeal carcinoma in xenograft mice. PLoS One. 2015;10(4):e126147. 10.1371/journal.pone.0126147.Search in Google Scholar PubMed PubMed Central

[4] Lu J, Li Q, Cai L, Zhu Z, Guan J, Wang C, et al. RBM17 controls apoptosis and proliferation to promote Glioma progression. Biochem Biophys Res Commun. 2018;505(1):20–8. 10.1016/j.bbrc.2018.09.056.Search in Google Scholar PubMed

[5] Ray D, Kazan H, Cook KB, Weirauch MT, Najafabadi HS, Li X, et al. A compendium of RNA-binding motifs for decoding gene regulation. Nature. 2013;499(7457):172–7. 10.1038/nature12311.Search in Google Scholar PubMed PubMed Central

[6] Xiong HY, Alipanahi B, Lee LJ, Bretschneider H, Merico D, Yuen RK, et al. RNA splicing. The human splicing code reveals new insights into the genetic determinants of disease. Science. 2015;347(6218):1254806. 10.1126/science.1254806.Search in Google Scholar PubMed PubMed Central

[7] Jagtap PK, Garg D, Kapp TG, Will CL, Demmer O, Luhrmann R, et al. Rational design of cyclic peptide inhibitors of U2AF homology motif (UHM) domains to modulate Pre-mRNA splicing. J Med Chem. 2016;59(22):10190–7. 10.1021/acs.jmedchem.6b01118.Search in Google Scholar PubMed

[8] Neubauer G, King A, Rappsilber J, Calvio C, Watson M, Ajuh P, et al. Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat Genet. 1998;20(1):46–50. 10.1038/1700.Search in Google Scholar PubMed

[9] Liu Y, Conaway L, Rutherford BJ, Al-Ayoubi AM, Thompson BA, Zheng H, et al. Phosphorylation of the alternative mRNA splicing factor 45 (SPF45) by Clk1 regulates its splice site utilization, cell migration and invasion. Nucleic Acids Res. 2013;41(9):4949–62. 10.1093/nar/gkt170.Search in Google Scholar PubMed PubMed Central

[10] Li C, Ge S, Zhou J, Peng J, Chen J, Dong S, et al. Exploration of the effects of the CYCLOPS gene RBM17 in hepatocellular carcinoma. PLoS One. 2020;15(6):e234062. 10.1371/journal.pone.0234062.Search in Google Scholar PubMed PubMed Central

[11] Han L, Lai H, Yang Y, Hu J, Li Z, Ma B, et al. A 5’-tRNA halve, tiRNA-Gly promotes cell proliferation and migration via binding to RBM17 and inducing alternative splicing in papillary thyroid cancer. J Exp Clin Cancer Res. 2021;40(1):222. 10.1186/s13046-021-02024-3.Search in Google Scholar PubMed PubMed Central

[12] Han Y, Zhang M, Chen D, Li H, Wang X, Ma S. Downregulation of RNA binding motif protein 17 expression inhibits proliferation of hypopharyngeal carcinoma FaDu cells. Oncol Lett. 2018;15(4):5680–4. 10.3892/ol.2018.8012.Search in Google Scholar PubMed PubMed Central

[13] Elias JE, Gygi SP. Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry. Nat Methods. 2007;4(3):207–14. 10.1038/nmeth1019.Search in Google Scholar PubMed

[14] Chen J, Hu Y, Teng Y, Yang B. Increased nuclear transporter importin 7 contributes to the tumor growth and correlates with CD8 T cell infiltration in cervical cancer. Front Cell Dev Biol. 2021;9:732786. 10.3389/fcell.2021.732786.Search in Google Scholar PubMed PubMed Central

[15] Shao Q, Zhang P, Ma Y, Lu Z, Meng J, Li H, et al. MicroRNA-139-5p affects cisplatin sensitivity in human nasopharyngeal carcinoma cells by regulating the epithelial-to-mesenchymal transition. Gene. 2018;652:48–58. 10.1016/j.gene.2018.02.003.Search in Google Scholar PubMed

[16] Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017;45(W1):W98–102. 10.1093/nar/gkx247.Search in Google Scholar PubMed PubMed Central

[17] Chen F, Chandrashekar DS, Varambally S, Creighton CJ. Pan-cancer molecular subtypes revealed by mass-spectrometry-based proteomic characterization of more than 500 human cancers. Nat Commun. 2019;10(1):5679. 10.1038/s41467-019-13528-0.Search in Google Scholar PubMed PubMed Central

[18] Liu L, Vujovic A, Deshpande NP, Sathe S, Anande G, Chen H, et al. The splicing factor RBM17 drives leukemic stem cell maintenance by evading nonsense-mediated decay of pro-leukemic factors. Nat Commun. 2022;13(1):3833. 10.1038/s41467-022-31155-0.Search in Google Scholar PubMed PubMed Central

[19] Perry WR, Shepard RL, Sampath J, Yaden B, Chin WW, Iversen PW, et al. Human splicing factor SPF45 (RBM17) confers broad multidrug resistance to anticancer drugs when overexpressed–a phenotype partially reversed by selective estrogen receptor modulators. Cancer Res. 2005;65(15):6593–600. 10.1158/0008-5472.CAN-03-3675.Search in Google Scholar PubMed

[20] De Craene B, Berx G. Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer. 2013;13(2):97–110. 10.1038/nrc3447.Search in Google Scholar PubMed

[21] Liu Y, Pan M, Lu T, Li Y, Yu D, Wang Z, et al. RBM24 Mediates Lymph Node Metastasis and Epithelial–mesenchymal Transition in Human Hypopharyngeal Squamous Cell Carcinoma by Regulating Twist1. J Oncol. 2022;2022:1205353. 10.1155/2022/1205353.Search in Google Scholar PubMed PubMed Central

[22] Canadas I, Rojo F, Taus A, Arpi O, Arumi-Uria M, Pijuan L, et al. Targeting epithelial-to-mesenchymal transition with Met inhibitors reverts chemoresistance in small cell lung cancer. Clin Cancer Res. 2014;20(4):938–50. 10.1158/1078-0432.CCR-13-1330.Search in Google Scholar PubMed

[23] Han ML, Zhao YF, Tan CH, Xiong YJ, Wang WJ, Wu F, et al. Cathepsin L upregulation-induced EMT phenotype is associated with the acquisition of cisplatin or paclitaxel resistance in A549 cells. Acta Pharmacol Sin. 2016;37(12):1606–22. 10.1038/aps.2016.93.Search in Google Scholar PubMed PubMed Central

[24] An L, Li DD, Chu HX, Zhang Q, Wang CL, Fan YH, et al. Terfenadine combined with epirubicin impedes the chemo-resistant human non-small cell lung cancer both in vitro and in vivo through EMT and Notch reversal. Pharmacol Res. 2017;124:105–15. 10.1016/j.phrs.2017.07.021.Search in Google Scholar PubMed

[25] Brozovic A. The relationship between platinum drug resistance and epithelial–mesenchymal transition. Arch Toxicol. 2017;91(2):605–19. 10.1007/s00204-016-1912-7.Search in Google Scholar PubMed

[26] Qin T, Li B, Feng X, Fan S, Liu L, Liu D, et al. Abnormally elevated USP37 expression in breast cancer stem cells regulates stemness, epithelial–mesenchymal transition and cisplatin sensitivity. J Exp Clin Cancer Res. 2018;37(1):287. 10.1186/s13046-018-0934-9.Search in Google Scholar PubMed PubMed Central

[27] Liu L, Cui J, Zhao Y, Liu X, Chen L, Xia Y, et al. KDM6A-ARHGDIB axis blocks metastasis of bladder cancer by inhibiting Rac1. Mol Cancer. 2021;20(1):77. 10.1186/s12943-021-01369-9.Search in Google Scholar PubMed PubMed Central

[28] Kim JH, Shim JW, Eum DY, Kim SD, Choi SH, Yang K, et al. Downregulation of UHRF1 increases tumor malignancy by activating the CXCR4/AKT-JNK/IL-6/Snail signaling axis in hepatocellular carcinoma cells. Sci Rep. 2017;7(1):2798. 10.1038/s41598-017-02935-2.Search in Google Scholar PubMed PubMed Central

[29] Johnson SK, Stewart JP, Bam R, Qu P, Barlogie B, van Rhee F, et al. CYR61/CCN1 overexpression in the myeloma microenvironment is associated with superior survival and reduced bone disease. Blood. 2014;124(13):2051–60. 10.1182/blood-2014-02-555813.Search in Google Scholar PubMed PubMed Central

[30] Chen CC, Kim KH, Lau LF. The matricellular protein CCN1 suppresses hepatocarcinogenesis by inhibiting compensatory proliferation. Oncogene. 2016;35(10):1314–23. 10.1038/onc.2015.190.Search in Google Scholar PubMed PubMed Central

[31] Gong Z, Hu G. PCDH20 acts as a tumour-suppressor gene through the Wnt/beta-catenin signalling pathway in hypopharyngeal squamous cell carcinoma. Cancer Biomark. 2019;26(2):209–17. 10.3233/CBM-190442.Search in Google Scholar PubMed

[32] Xu J, Gross N, Zang Y, Cao S, Yang F, Yang Z, et al. Overexpression of S100A4 predicts migration, invasion, and poor prognosis of hypopharyngeal squamous cell carcinoma. Mol Diagn Ther. 2019;23(3):407–17. 10.1007/s40291-019-00393-2.Search in Google Scholar PubMed

[33] Cui P, Jing P, Liu X, Xu W. Prognostic significance of PD-L1 expression and its tumor-intrinsic functions in hypopharyngeal squamous cell carcinoma. Cancer Manag Res. 2020;12:5893–902. 10.2147/CMAR.S257299.Search in Google Scholar PubMed PubMed Central

[34] Yan J, Wang ZH, Yan Y, Luo HN, Ren XY, Li N, et al. RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma. Oncol Rep. 2020;44(5):2080–92. 10.3892/or.2020.7762.Search in Google Scholar PubMed PubMed Central

[35] Liu Q, Dong Y, Yuan S, Yu M, Liu L, Zhang Q. Prognostic value of alpha2delta1 in hypopharyngeal carcinoma: A retrospective study. Open Med (Wars). 2021;16(1):1395–402. 10.1515/med-2021-0356.Search in Google Scholar PubMed PubMed Central

Received: 2022-06-27
Revised: 2023-01-10
Accepted: 2023-02-13
Published Online: 2023-03-15

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0669
Keywords for this article
hypopharyngeal squamous cell carcinoma; RNA-binding motif protein 17; epithelial–mesenchymal transition; cisplatin
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 23.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0669/html?lang=en&srsltid=AfmBOorFRUWkckCr7SIWaAQCA41p41T2s-0d65YgfaOWSBY4WMOIog5J
Scroll to top button