Home Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
Article Open Access

Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks

  • Jingqi Yang , Ming Yang EMAIL logo and Guotai Sheng
Published/Copyright: March 8, 2023

Abstract

Long noncoding RNAs (lncRNAs) mediate important epigenetic regulation in a wide range of biological processes. However, the effect of all dysregulated lncRNAs in myocardial infarction (MI) is not clear. Whole transcriptome sequencing analysis was used to characterize the dynamic changes in lncRNA and mRNA expression. A gene network was constructed, and genes were classified into different modules using WGCNA. In addition, for all dysregulated lncRNAs, gene ontology analysis and cis-regulatory analysis were applied. The results demonstrated that a large number of the differentially co-expressed genes were primarily linked to the immune system process, inflammatory response, and innate immune response. The functional pathway analysis of the MEblue module included immune system process and apoptosis, and MEbrown included the T-cell receptor signal pathway by WGCNA. In addition, through cis-acting analysis of lncRNA regulation, the cis-regulated mRNAs were mainly enriched in immune system processes, innate immune responses, and VEGF signal pathways. We found that lncRNA regulation of mRNAs plays an important role in immune and inflammatory pathways. Our study provides a foundation to further understand the role and potential mechanism of dysregulated lncRNAs in the regulation of MI, in which many of them could be potential targets for MI.

1 Introduction

Long noncoding RNAs (lncRNAs) are noncoding RNAs whose transcript length exceeds 200 nt [1]. Many lncRNAs have 5′capping, alternative splicing, and polyadenylation, similar to mRNAs [2]. Despite their similarity, lncRNAs are regulated in different ways and have a wide range of functions in many physiological and pathological contexts [3]. Most lncRNAs are poorly conserved, and their expression levels are significantly lower than those of mRNAs [4]. The expression patterns are tissue and stage specific, especially for cellular differentiation and development [5,6].

Myocardial infarction (MI) is a disease caused by coronary artery plaque rupture, thrombus blocking blood vessels, and finally causing acute myocardial ischemic injury, which has become one of the main reasons that seriously threatens human health [7]. At present, the treatment for MI mainly includes percutaneous coronary intervention combined with antiplatelet and/or anticoagulation therapy to complete revascularization and lipid regulation to stabilize plaque [8], but the morbidity and mortality of MI are still high. Therefore, further research on the pathogenesis of MI is of great significance to find new molecular targets for diagnosis and treatment.

After MI, myocardial cell necrosis triggers an inflammatory response, which not only participates in the repair of the infarcted myocardium but also participates in the enlargement of the infarct and the aggravation of fibrosis, thereby causing adverse ventricular remodeling [9]. Endothelial cells are a major source of proinflammatory chemokines after MI [10]. Natriuretic release from infarcted cardiomyocytes activates the endothelial inflammatory phenotype and mediates the adhesion of circulating leukocytes to promote leukocyte recruitment. Under the induction of chemokines, complement and interleukins, a large number of leukocytes, especially neutrophils, infiltrate the infarcted myocardium [11]. It has been reported that neutrophils may exert cytotoxic effects on living cardiomyocytes damaged by ischemia in the infarct marginal zone [12]. In addition, after MI, necrotic cells trigger innate immune pathways and activate a range of inflammatory mediators, including inflammatory cytokines, chemokines, and cell adhesion molecules. Therefore, immune and inflammatory responses have an important impact on MI.

In recent years, with the deepening of the study of lncRNAs, circulating plasma or serum lncRNAs, as new biomarkers, have played an important role in disease diagnosis, prognosis, or treatment. In addition, several lncRNAs have been shown to be directly related to MI. For instance, Li et al. [13] used a gene chip to explore the difference in the expression of lncRNAs between MI cells and normal cells and found that 323 lncRNAs were differentially expressed, of which 168 were upregulated and 155 were downregulated. By analyzing the function of lncRNAs with dysfunctional expression, it is predicted that these lncRNAs may promote the occurrence and development of MI. It was found that the expression of lncRNA AZIN2-sv was upregulated in cardiomyocytes and can induce cardiomyocyte apoptosis and reduce cardiomyocyte proliferation, thus inhibiting angiogenesis [14]. Further experiments showed that silencing AZIN2-sv expression can promote myocardial capillary formation after MI, help to increase the left ventricular ejection fraction and left ventricular shortening fraction, and effectively improve the prognosis of MI in rats. Many studies have been conducted on the function of lncRNAs in MI, but most of them focus on a particular lncRNA, and the functions of some lncRNAs are still unclear [15,16,17]. To date, our study is the first to investigate the function of dysregulated lncRNAs in MI by transcriptome sequencing. This article mainly analyzed the gene expression network in the process of lncRNAs regulating the occurrence and development of MI to analyze the overall differentially expressed lncRNAs in MI and their functions.

2 Materials and methods

2.1 Retrieval and processing of public data

The RNA-seq data of GSE114695 from the GEO database in the present study were obtained. GSE114695 included the mouse left ventricle at 1 day (1 D) and 1 week (1 W) after MI or sham operation. MI was induced by permanent ligation of the left anterior descending coronary artery in 8-week-old male mice. A total of four sets of data were used in our study, including 1 D and 1 W after MI and then 1 D and 1 W after sham operation, and each set had three samples. The proportion of mapping of each sample was more than 80%, and the correlation in the group was better with no group outliers.

SRA Run files were converted to fastq format using NCBI SRA Tool fastq-dump. The raw reads were trimmed of low-quality bases, and clean reads were evaluated using FASTX-Toolkit (v.0.0.13; http://hannonlab.cshl.edu/fastx_toolkit/) and FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc).

2.2 Read alignment and differentially expressed gene (DEG) analysis

The obtained high-quality sequence data were aligned with the mouse reference genome (GRCm38) using HISTA2, and the counts of each gene were counted by the feature Counts (1.5.0-p3) tool in Subread software [18]. The expression levels of genes were evaluated using per kilobase of exon per million fragments mapped (RPKM). The DEGs were counted by DESeq2 (3.18.1) [19] with log2 fold change >1 (upregulated) or ≤−1 (downregulated) and false discovery rate ≤0.01.

2.3 lncRNA prediction and direction identification

To systematically analyze the lncRNA expression pattern and methods, we used a previously reported lncRNA identification method based on cufflink software [20,21]. All steps of the analytical methods are shown in Figure 1a. We calculated the coding potential score to filter the coding potential transcripts. When filtering the single-exon lncRNAs, we set the threshold to 1,000 nt for filtering the single-exon lncRNAs and 200 nt for filtering the multiexon lncRNAs.

Figure 1 
                  Genome-wide profiling of MI-associated lncRNAs. (a) Illustration of the experimental design and bioinformatics analysis pipeline for the identification and functional annotation of lncRNAs expressed in MI and sham samples. (b) The number of differentially expressed lncRNAs (DE lncRNAs) among the 1-day (1 D) and 1-week (1 W) groups. The number of upregulated and downregulated DE lncRNAs is shown in the bar plot. (c) PCA of MI and sham samples based on the normalized expression level. The samples were grouped by disease state, and the ellipse for each group is the confidence ellipse. (d) Expression heatmap of DE lncRNAs among MI and sham samples. (e and f) Venn diagram of DE lncRNAs in MI and sham samples at 1 day (1 D) and 1 week (1 W).
Figure 1

Genome-wide profiling of MI-associated lncRNAs. (a) Illustration of the experimental design and bioinformatics analysis pipeline for the identification and functional annotation of lncRNAs expressed in MI and sham samples. (b) The number of differentially expressed lncRNAs (DE lncRNAs) among the 1-day (1 D) and 1-week (1 W) groups. The number of upregulated and downregulated DE lncRNAs is shown in the bar plot. (c) PCA of MI and sham samples based on the normalized expression level. The samples were grouped by disease state, and the ellipse for each group is the confidence ellipse. (d) Expression heatmap of DE lncRNAs among MI and sham samples. (e and f) Venn diagram of DE lncRNAs in MI and sham samples at 1 day (1 D) and 1 week (1 W).

2.4 WGCNA and coexpression analysis

To comprehensively understand the gene expression patterns, weighted gene coexpression network analysis (WGCNA) [22] was used to cluster genes with similar expression patterns and default parameters. All expressed genes in the RNA-Seq data were used as input data. To analyze the regulatory mode between lncRNAs and mRNAs, we calculated the Pearson correlation coefficients and divided their relationship into three categories according to the Pearson correlation coefficient value: positive correlation, negative correlation, and noncorrelation.

2.5 Functional enrichment analysis

To analyze the functional classes of DEGs, the KOBAS 2.0 server was used to perform Gene Ontology (GO) terms and KEGG pathways [23]. In addition, the sets of selected genes were identified using Reactome (http://reactome.org) pathway profiling [24].

2.6 Cis acting

Correlation coefficients and P values between mRNA-lncRNAs were obtained based on the expression of each mRNA and the differentially expressed lncRNAs. Then, we filtered through a threshold with an absolute correlation coefficient of not less than 0.6 and a P-value of less than 0.05 to form an expression network. For each differentially expressed lncRNA, we obtained the expressed genes within 10,000 bases from its upstream and downstream regions that overlapped with coexpressed genes to obtain lncRNA targets.

2.7 Other statistical analyses

Principal component analysis (PCA) was carried out by factoextra (http://www.sthda.com/english/rpkgs/factoextra) in the R package to show the clustering between each sample using RPKM of all DE lncRNAs. After the readings of each gene in the sample were normalized by TPM (Tags Per Million), the internal script was used for the visualization of next-generation sequence data and genome annotations. The pheatmap package (https://cran.r-project.org/web/packages/pheatmap/index.html) in R was used to perform clustering based on Euclidean distance. Student’s t-test was used for comparisons between two groups.

2.8 Identification of differentially expressed coexpression-related genes

The GSE59867 dataset, based on the GPL6244 platform, was published by Maciejak et al. [25] and was used as the independent external validation set, including 111 patients with AMI at admission and 46 patients with stable coronary artery disease. The “limma” package was used to normalize the gene expression profiles [26].

Whole blood samples were collected from five AMI patients and five normal patients for real-time quantitative polymerase chain reaction (qPCR) to confirm the results. The study was approved by the Ethics Committee of Jiangxi Provincial People’s Hospital, and all patients signed informed consent forms. All patient samples were processed to isolate peripheral blood mononuclear cells immediately after collection and stored at −80°C before RNA extraction. After the samples were pretreated, RNA was extracted using TRIzol reagent (Invitrogen), and qPCR was performed. Total RNA was reverse transcribed into complementary DNA by a qPCR real-time kit (Invitrogen) following the manufacturer’s instructions. Relative gene expression was analyzed by the 2−ΔΔCT method with normalization to ACTB (internal reference gene). All primers used in this study are shown in Table 1. Data are presented as the mean ± standard deviation. GraphPad Prism 8 software (GraphPad Software, CA) and R software were used for statistical analyses. Analysis of variance or a t test was used for statistical comparisons. P < 0.05 was considered significant.

Table 1

Primer sequences

Forward primer (5′–3′) Reverse primer (5′–3′)
Isg20 TCTACGACACGTCCACTGACA CTGTTCTGGATGCTCTTGTGC
Myd88 GGCTGCTCTCAACATGCGA CTGTGTCCGCACGTTCAAGA
Ecm1 AGCACCCCAATGAACAGAAGG CTGCATTCCAGGACTCAGGTT
Irf7 CCCACGCTATACCATCTACCT GATGTCGTCATAGAGGCTGTTG
Ecsit AACCTCTACTACCCGATGCAG CAGCCACTCCTCACATACTCC
C3 GGGGAGTCCCATGTACTCTATC GGAAGTCGTGGACAGTAACAG

3 Results

3.1 Workflow

We downloaded the RNA-seq sample (GSE114695) of the MI mouse model. The cDNA library was constructed by using the mouse left ventricle at 1 day (1 D) and 1 week (1 W) after MI. The transcriptome data of 12 mRNAs in two different stages of MI (1 D and 1 W) were generated and differentially expressed lncRNA analysis and lncRNA‒mRNA network analysis were carried out. The analysis process is shown in Figure 1a.

3.2 lncRNAs were differentially expressed in MI

To identify possible lncRNAs participating in MI, the differentially expressed lncRNAs at 1 day and 1 week after MI were analyzed by RNA-seq. The results showed that compared with the sham-operated group, 1,210 lncRNAs were significantly differentially expressed in the first week, of which 434 were upregulated and 776 were downregulated, and on the first day, 1,144 lncRNAs were significantly differentially expressed, including 498 upregulated and 646 downregulated lncRNAs, which were visualized with a bar plot (Figure 1b). For 1 day and 1 week after MI, through PCA, it was found that the quality of this dataset was good, and the differentially expressed lncRNAs could clearly distinguish the samples of the MI group from the sham operation group (Figure 1c). The differentially expressed lncRNAs between the MI group and the normal group were visualized by heatmap at 1 day and 1 week after MI (Figure 1d). Through the Venn diagram, it was found that 170 lncRNAs were upregulated at both 1 day and 1 week, and 476 lncRNAs were downregulated at both 1 day and 1 week (Figure 1e and f).

3.3 Characteristics of lncRNAs detected in MI and Sham samples

At present, the functions of many known lncRNAs have been gradually clarified, and some novel discovered lncRNAs are still unclear. To explore the overall function of lncRNAs, we detected known and novel lncRNAs in MI and sham samples after 1 day and 1 week (Figure 2a and b). Most of the novel lncRNAs had only 1 exon, and the gene length of lncRNAs was also shorter than that of mRNAs. The characteristics of lncRNAs are shown in Figure 2c and d.

Figure 2 
                  Characteristics of lncRNAs detected in MI and sham samples. Venn diagram of detected known lncRNAs (a) and novel lncRNAs (b) in MI and sham samples. lncRNAs that were detected (RPKM ≥ 0.2) in at least two samples were considered to be detected in the group. (c) Distribution of exon counts of known lncRNAs, novel lncRNAs, and protein-coding RNAs. (d) Density of the length distribution of known lncRNAs, novel lncRNAs, and protein-coding RNAs. The length density distribution was generated by the density function in R.
Figure 2

Characteristics of lncRNAs detected in MI and sham samples. Venn diagram of detected known lncRNAs (a) and novel lncRNAs (b) in MI and sham samples. lncRNAs that were detected (RPKM ≥ 0.2) in at least two samples were considered to be detected in the group. (c) Distribution of exon counts of known lncRNAs, novel lncRNAs, and protein-coding RNAs. (d) Density of the length distribution of known lncRNAs, novel lncRNAs, and protein-coding RNAs. The length density distribution was generated by the density function in R.

3.4 Construction of the lncRNA‒mRNA coexpression network

Enrichment analysis of differentially expressed mRNAs coexpressed by differentially expressed lncRNAs showed that the mRNAs were highly enriched in immune and inflammatory pathways, which was consistent with the pathogenesis of MI (Figure 3a and b). It is suggested that differentially expressed lncRNAs may interact with immune-related mRNAs and play an important role in MI.

Figure 3 
                  Coexpression network illustration between DE lncRNAs and DE mRNAs. (a) Venn diagram of DE lncRNAs and DE mRNAs in MI and sham samples; (b) The top 10 enriched GO biological process pathways by DE lncRNAs coexpressed with DE mRNAs of MI compared with sham samples. (c) The coexpression network between DE lncRNAs and DE mRNAs involved in the top 3 immune-related terms shown in (b). lncRNAs are on the left, coexpressed mRNAs are in the center, and the mRNA-enriched GO terms are on the right. (d and e) Boxplots showing the expression of six DE lncRNAs and six DE mRNAs in MI and sham samples.
Figure 3

Coexpression network illustration between DE lncRNAs and DE mRNAs. (a) Venn diagram of DE lncRNAs and DE mRNAs in MI and sham samples; (b) The top 10 enriched GO biological process pathways by DE lncRNAs coexpressed with DE mRNAs of MI compared with sham samples. (c) The coexpression network between DE lncRNAs and DE mRNAs involved in the top 3 immune-related terms shown in (b). lncRNAs are on the left, coexpressed mRNAs are in the center, and the mRNA-enriched GO terms are on the right. (d and e) Boxplots showing the expression of six DE lncRNAs and six DE mRNAs in MI and sham samples.

To demonstrate which lncRNAs and mRNAs are involved in the immune pathway, the interactions among the lncRNAs and coexpressed mRNAs were first analyzed using Spearman correlation based on the RNA sequencing data. Annotation analysis of biological process pathways was conducted by differentially expressed lncRNAs expressed with differentially expressed mRNAs of MI compared with sham samples. According to the results, we found that a large number of the differentially coexpressed genes were primarily linked to the immune system process, inflammatory response and innate immune response (Figure 3c). Finally, 6 lncRNAs and 6 mRNAs of interest were selected to validate the reliability of the RNA-seq data (Figure 3d and e).

In addition, we used a scatter plot to show differentially expressed lncRNAs by MI compared with sham samples and the number of coexpressed differentially expressed mRNAs (Figure 4a and b). Then, the enriched GO biological process pathways were found to be mainly enriched in the immune and inflammatory pathways, as well as the very important oxidation‒reduction process in MI (Figure 4c and d).

Figure 4 
                  Coexpression network illustration between DE lncRNAs and DE mRNAs. (a and b) Scatter plot shows DE lncRNAs by MI compared with sham samples and the number of coexpressed DE mRNAs. Red points denote upregulated lncRNAs involved in coexpression pairs, and blue points denote downregulated lncRNAs. Cutoffs of P-value <0.01 and Pearson coefficient >0.99 were applied to identify the coexpression pairs; (c and d) top 10 most enriched GO biological process pathways by DE lncRNAs coexpressed with DE mRNAs of MI compared with Sham samples.
Figure 4

Coexpression network illustration between DE lncRNAs and DE mRNAs. (a and b) Scatter plot shows DE lncRNAs by MI compared with sham samples and the number of coexpressed DE mRNAs. Red points denote upregulated lncRNAs involved in coexpression pairs, and blue points denote downregulated lncRNAs. Cutoffs of P-value <0.01 and Pearson coefficient >0.99 were applied to identify the coexpression pairs; (c and d) top 10 most enriched GO biological process pathways by DE lncRNAs coexpressed with DE mRNAs of MI compared with Sham samples.

3.5 Validation of the coexpression-related mRNA by qPCR

To validate the reliable expression changes of coexpression-related mRNAs in AMI, the GSE59867 dataset was used as an additional independent external validation set. Except for Isg20, the other five genes were differentially expressed in the two groups (Figure 5a), which also indicated that the coexpression-related mRNA may be consistent in mice and humans. Furthermore, blood samples from five normal and five AMI patients were collected, and the six highly coexpressed DEmRNAs in the coexpression network were further selected for qPCR validation. Compared with normal samples, the expression levels of Isg20, Myd88, Ecm1, Irf7, and C3 were increased, whereas those of Ecsit were decreased in AMI samples (Figure 5b). It was reported that Myd88, Ecm1, Irf7, Ecsit, and C3 were associated with MI, while Isg20, Irf7, and Ecsit were not directly related to MI but were related to inflammation. This suggests that differentially expressed lncRNAs may interact with immune-related mRNAs in MI.

Figure 5 
                  Expression of six highly coexpressed DE mRNAs was analysed. (a) The expression of the six coexpressed mRNAs in the GSE59867 dataset. (b) qPCR validation of the six coexpressed mRNAs between AMI and normal controls (∗∗∗
                     P < 0.001, ∗∗∗∗
                     P < 0.0001).
Figure 5

Expression of six highly coexpressed DE mRNAs was analysed. (a) The expression of the six coexpressed mRNAs in the GSE59867 dataset. (b) qPCR validation of the six coexpressed mRNAs between AMI and normal controls (∗∗∗ P < 0.001, ∗∗∗∗ P < 0.0001).

3.6 WGCNA analysis of lncRNA‒mRNA coexpression modules

Through the gene expression module analysis of WGCNA, we found that two expression modules were highly associated with MI: MEblue and brown MEbrown (Figure 6a and b). Through GO biological process and KEGG pathway analysis, it was found that the functional pathway analysis of the MEblue module included immune system process, tumor necrosis factor signal pathway, and apoptosis (Figure 6c), while the functional pathway analysis of the MEbrown module included the T-cell receptor signal pathway (Figure 6d). The pathways involved in the two modules are also closely related to immunity.

Figure 6 
                  WGCNA of all expressed lncRNAs and mRNAs. (a) Signed association of module eigengenes with diagnosis of MI and Sham. Positive values indicate modules with increased expression in samples. Negative values indicate modules with decreased expression in samples. Dashed lines signify associated modules. (b) Boxplot showing expression fold change of mRNAs and lncRNAs from the four associated modules. The top 10 GO biological process and KEGG pathway enrichment of the modules MEblue (c) and MEbrown (d).
Figure 6

WGCNA of all expressed lncRNAs and mRNAs. (a) Signed association of module eigengenes with diagnosis of MI and Sham. Positive values indicate modules with increased expression in samples. Negative values indicate modules with decreased expression in samples. Dashed lines signify associated modules. (b) Boxplot showing expression fold change of mRNAs and lncRNAs from the four associated modules. The top 10 GO biological process and KEGG pathway enrichment of the modules MEblue (c) and MEbrown (d).

3.7 Cis-acting analysis of lncRNA regulation

We analyzed the differentially expressed lncRNAs that may target the regulated differentially expressed mRNAs in MI. The results showed that cis-acting differentially expressed lncRNAs and mRNAs mainly showed a positive phase regulation relationship, which was visualized with a heatmap (Figure 7a and b). These differentially expressed mRNA-enriched functional pathways included immune system processes, innate immune responses, and the VEGF signaling pathway (Figure 7c).

Figure 7 
                  
                     Cis-regulatory genes of DE lncRNAs. (a) Scatter plot shows log2 FC of DE lncRNAs by MI compared with Sham samples and its cis-regulatory genes. (b) Heatmap shows expression pattern of DE lncRNAs and its cis-regulatory genes. (c) Top 10 most enriched GO biological process pathways of cis-regulatory genes.
Figure 7

Cis-regulatory genes of DE lncRNAs. (a) Scatter plot shows log2 FC of DE lncRNAs by MI compared with Sham samples and its cis-regulatory genes. (b) Heatmap shows expression pattern of DE lncRNAs and its cis-regulatory genes. (c) Top 10 most enriched GO biological process pathways of cis-regulatory genes.

4 Discussion

In the present study, we found the potential inflammatory role of lncRNAs in MI, which may help to further elucidate the mechanism of MI and provide potential targets for the diagnosis and treatment of acute MI. MI is a complex degenerative cardiovascular disease of concern due to its high morbidity and mortality [27]. In this study, the C57BL/6J mouse strain, one of the most widely used models for cardiovascular disease research, was selected as the MI animal model for RNA-seq analysis. First, lncRNA and mRNA expression profiles were determined using the hearts of 1-day-old and 1-week-old C57BL/6J mice. Then, many differentially expressed lncRNAs and mRNAs in MI were analyzed by RNA-seq. Cells and biological pathways in MI were then determined by GO, KEGG, and Pathnet analyses. Furthermore, coexpression networks revealed interactions between lncRNAs and mRNAs, and ceRNA networks were employed to show interactions between lncRNAs and miRNAs. Finally, the possible cis-regulated targets of differentially expressed mRNAs by differentially expressed lncRNAs in MI were explored.

We found that at 1 day or 1 week after MI, there was significant differential expression of lncRNAs after MI, and lncRNA PCA clustering found that the lncRNA expression profile could clearly distinguish between MI and non-MI samples. These lncRNAs can be used as potential diagnostic markers of MI. In fact, lncRNAs can stably exist in plasma, and peripheral blood is easy to obtain and easy to detect, so lncRNAs in circulating blood may become biomarkers for the diagnosis of acute MI (AMI). Li et al. [28] continuously monitored patients with acute ST segment elevation MI (STEMI). The results showed that compared with healthy volunteers, the expression of plasma lncRNA LIPCAR in patients with STEMI increased significantly within 4 h after the onset of STEMI symptoms, peaked at 12 h, and gradually returned to the baseline level on the 7th day. In addition, lncRNA LIPCAR showed the best sensitivity and specificity in the diagnosis of STEMI in the ROC curve, and there was a positive correlation between LIPCAR and Gensini score (coronary artery disease score), indicating that the increased degree of lncRNA LIPCAR reflected the severity of coronary artery stenosis [13]. Although these studies provide many potential new markers of MI, the sensitivity and specificity of these lncRNAs cannot be compared with the clinical markers of myocardial necrosis, and the study of lncRNAs still needs to be further explored.

In recent years, an increasing number of studies have shown that lncRNAs are related to the occurrence and development of MI [29,30,31], but the underlying mechanisms still need to be further elucidated. As regulators, lncRNAs are closely related to cellular inflammation [32,33], excessive reactive oxygen species [34], and apoptosis [35]. In addition, a large number of studies have shown that the immune and inflammatory responses after MI have an important impact on the prognosis of AMI patients [36,37]. In the context of MI, our study found abnormal expression levels of some inflammation- and immune-related genes, which may be potential targets of lncRNAs.

However, it is still unclear which lncRNAs are closely related to the occurrence and development of MI. In addition, the functions of most lncRNAs remain unclear to date. Currently, we predict lncRNA function according to their closely related coding genes. Combining bioinformatics analysis with literature validation, we found that differentially expressed mRNAs coexpressed with differentially expressed lncRNAs were highly enriched in immune and inflammatory pathways, which was consistent with the pathogenesis of MI.

Some studies have suggested that lncRNAs participate in the occurrence and development of MI. High mobility group protein 1 (HMGB1) is a ubiquitous nuclear protein. High mobility group protein 1 is a ubiquitous rich nuclear protein, and the expression of HMGB1 is significantly increased in injured myocardium during ischemia‒reperfusion. HMGB1 can induce the release of the inflammatory cytokines interleukin-6 and tumor necrosis factor-α, resulting in a severe inflammatory response. Shi et al. have shown that lncRNA TUG1 can reduce the expression of inflammatory factors by inhibiting HMGB1, thus reducing the inflammatory response of MI [38]. lncRNA H19, located near the telomere region of the human H19 gene on chromosome 11, is one of the most well-known imprinted genes. Increased expression of H19 can reduce cardiomyocyte apoptosis and inflammation, thereby reducing the dead area of MI, improving cardiac function, and reducing cardiac fibrosis. Previous studies have shown that lysine-specific demethylase 3A (KDM3A) is involved in myocardial ischemia‒reperfusion injury after MI by regulating key signaling pathways such as inflammation, apoptosis, and oxidative stress, and subsequent studies further confirmed that H19 regulates the expression of KDM3A through competitive binding to miR-22-3p, thus improving myocardial injury induced by MI [17].

Although these lncRNAs have been reported to regulate MI development, the roles of other lncRNAs remain to be further explored. We performed GO and KEGG pathway analyses, enriched the functions of differentially expressed lncRNAs and mRNAs by WGCNA, and identified important pathways involved in the occurrence and development of MI. The results revealed that immune and inflammatory pathways play an important role in the regulation of mRNAs by lncRNAs in MI mice. In fact, previous studies have shown that immune and inflammatory pathways are the canonical pathways in the occurrence and development of MI. This demonstrates that WGCNA is a significant pathway to find the mRNA pathway regulated by lncRNA.

Regarding the regulatory function of lncRNAs in immunity and inflammation, we constructed the lncRNA‒mRNA coexpression network and found that six differentially expressed lncRNAs (Gm26809, XLOC_008195, XLOC_000947, Gm12840, C130080G10Rik, XLOC_001747) and six differentially expressed mRNAs (Isg20, Myd88, Ecm1, Irf7, Ecsit, C3) are worthy of attention. Among them, Myd88 [39], Ecm1 [40], and C3 [41] were all reported to be related to MI, which verified previous studies: Isg20 [42], Irf7 [43], and Ecsit [44] were not reported to be directly related to MI but were closely related to immunity or inflammation. The role of these related differences between lncRNAs and mRNAs in MI needs to be further verified by further experiments.

Compared with protein-coding genes, most lncRNAs are less expressed and generally exhibit developmental stage- and tissue-specific expression [45,46,47]. Because of the high specificity and large number of lncRNAs expressed, they may be an important but untapped layer of regulatory information that determines the fate of cells during development [46,48]. The nonrandom location of lncRNAs implies a connection between lncRNA function and the genomic neighborhood [4,49,50]. However, whether lncRNA expression is associated with adjacent or distant protein-coding genes and whether lncRNAs preferentially regulate adjacent genes in cis have been controversial [51]. Several investigators now classify lncRNAs according to their genomic location relative to protein-coding sites and find that different lncRNAs have significant effects on the cis regulation of nearby transcription [49]. Therefore, in this study, through the enrichment analysis of cis-acting mRNAs of differential lncRNAs, the main pathways of enrichment included immune system process, innate immune response, VEGF, and other signal pathways.

Numerous studies have shown that innate immunity is activated after MI. Innate immunity both exacerbates ischemic injury and hinders remodeling after MI. In addition, activation of innate immune pathways in cardiomyocytes produces cytoprotective effects through mitochondrial stabilization, whereas activation that is more prolonged or of greater magnitude and involves immune cells results in more robust inflammatory responses and leukocyte recruitment, which aggravate myocardial injury [52]. However, innate immune activation contributes to myocardial healing and plays a crucial role in stable scar formation and prevention of intraventricular thrombosis after AMI.

Our study also has some limitations. On the one hand, the number of cases in the GSE114695 dataset was relatively small, and the samples were from mice, which may have some impact on the results of clinical MI. On the other hand, the study is descriptive, and further molecular experiments are needed to validate the data. We will further improve and supplement this work in future research.

5 Conclusion

In conclusion, we searched for lncRNA‒mRNA expression profiles in MI by RNA-seq and used bioinformatics analysis to analyze the underlying regulatory mechanisms. In this study, we aimed to reveal the potential inflammatory role of lncRNAs in MI, which may help to further elucidate the mechanism of MI and provide potential targets for the diagnosis and treatment of acute MI. However, our study also suffers from some limitations, such as the lack of experimental validation of the functions of these differentially expressed lncRNAs. More studies are needed to explore the role of these differentially expressed lncRNAs in MI.

Acknowledgments

We acknowledge all patients involved in this study.

  1. Funding information: The authors’ research was supported by Health and Family Planning Commission of Jiangxi Province(Grant Number: 202130053).

  2. Author contributions: Conceptualization, Jingqi Yang; data curation, Ming Yang; formal analysis, Ming Yang; funding acquisition, Jingqi Yang; methodology, Guo-Tai Sheng; software, Guo-Tai Sheng; writing – original draft, Guo-Tai Sheng; writing – review & editing, Ming Yang.

  3. Conflict of interest: The authors declare that they have no conflict of interest.

  4. Data availability statement: The data associated with this article have been deposited in the NCBI-GEO website (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi).

References

[1] Huang Y. The novel regulatory role of lncRNA-miRNA-mRNA axis in cardiovascular diseases. J Cell Mol Med. 2018;22(12):5768–75.10.1111/jcmm.13866Search in Google Scholar PubMed PubMed Central

[2] Rinn JL, Chang HY. Genome regulation by long noncoding RNAs. Annu Rev Biochem. 2012;81:145–66.10.1146/annurev-biochem-051410-092902Search in Google Scholar PubMed PubMed Central

[3] Pollard KS, Salama SR, Lambert N, Lambot MA, Coppens S, Pedersen JS, et al. An RNA gene expressed during cortical development evolved rapidly in humans. Nature. 2006;443(7108):167–72.10.1038/nature05113Search in Google Scholar PubMed

[4] Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H, et al. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. Genome Res. 2012;22(9):1775–89.10.1101/gr.132159.111Search in Google Scholar PubMed PubMed Central

[5] Mercer TR, Dinger ME, Mariani J, Kosik KS, Mehler MF, Mattick JS. Noncoding RNAs in long-term memory formation. Neuroscientist. 2008;14(5):434–45.10.1177/1073858408319187Search in Google Scholar PubMed

[6] Fatica A, Bozzoni I. Long non-coding RNAs: New players in cell differentiation and development. Nat Rev Genet. 2014;15(1):7–21.10.1038/nrg3606Search in Google Scholar PubMed

[7] Lu L, Liu M, Sun R, Zheng Y, Zhang P. Myocardial infarction: Symptoms and treatments. Cell Biochem Biophys. 2015;72(3):865–7.10.1007/s12013-015-0553-4Search in Google Scholar PubMed

[8] Reed GW, Rossi JE, Cannon CP. Acute myocardial infarction. Lancet. 2017;389(10065):197–210.10.1016/S0140-6736(16)30677-8Search in Google Scholar PubMed

[9] Prabhu SD, Frangogiannis NG. The biological basis for cardiac repair after myocardial infarction: From inflammation to fibrosis. Circ Res. 2016;119(1):91–112.10.1161/CIRCRESAHA.116.303577Search in Google Scholar PubMed PubMed Central

[10] Rakic M, Persic V, Kehler T, Bastiancic AL, Rosovic I, Laskarin G, et al. Possible role of circulating endothelial cells in patients after acute myocardial infarction. Med Hypotheses. 2018;117:42–6.10.1016/j.mehy.2018.06.005Search in Google Scholar PubMed

[11] Lindsey ML, Saucerman JJ, DeLeon-Pennell KY. Knowledge gaps to understanding cardiac macrophage polarization following myocardial infarction. Biochim Biophys Acta. 2016;1862(12):2288–92.10.1016/j.bbadis.2016.05.013Search in Google Scholar PubMed PubMed Central

[12] Liu J, Yang C, Liu T, Deng Z, Fang W, Zhang X, et al. Eosinophils improve cardiac function after myocardial infarction. Nat Commun. 2020;11(1):6396.10.1038/s41467-020-19297-5Search in Google Scholar PubMed PubMed Central

[13] Li H, Cheng Z, Tang Y, Feng M, Yin A, Zhang H, et al. Expression profile of long non‑coding RNAs in cardiomyocytes exposed to acute ischemic hypoxia. Mol Med Rep. 2019;19(1):302–8.10.3892/mmr.2018.9658Search in Google Scholar PubMed PubMed Central

[14] Li X, Sun Y, Huang S, Chen Y, Chen X, Li M, et al. Inhibition of AZIN2-sv induces neovascularization and improves prognosis after myocardial infarction by blocking ubiquitin-dependent talin1 degradation and activating the Akt pathway. EBioMedicine. 2019;39:69–82.10.1016/j.ebiom.2018.12.001Search in Google Scholar PubMed PubMed Central

[15] Mao Q, Liang XL, Zhang CL, Pang YH, Lu YX. LncRNA KLF3-AS1 in human mesenchymal stem cell-derived exosomes ameliorates pyroptosis of cardiomyocytes and myocardial infarction through miR-138-5p/Sirt1 axis. Stem Cell Res Ther. 2019;10(1):393.10.1186/s13287-019-1522-4Search in Google Scholar PubMed PubMed Central

[16] Liu CY, Zhang YH, Li RB, Zhou LY, An T, Zhang RC, et al. LncRNA CAIF inhibits autophagy and attenuates myocardial infarction by blocking p53-mediated myocardin transcription. Nat Commun. 2018;9(1):29.10.1038/s41467-017-02280-ySearch in Google Scholar PubMed PubMed Central

[17] Zhang BF, Jiang H, Chen J, Hu Q, Yang S, Liu XP, et al. LncRNA H19 ameliorates myocardial infarction-induced myocardial injury and maladaptive cardiac remodelling by regulating KDM3A. J Cell Mol Med. 2020;24(1):1099–115.10.1111/jcmm.14846Search in Google Scholar PubMed PubMed Central

[18] Liao Y, Smyth GK, Shi W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923–30.10.1093/bioinformatics/btt656Search in Google Scholar PubMed

[19] Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550.10.1186/s13059-014-0550-8Search in Google Scholar PubMed PubMed Central

[20] Liu S, Wang Z, Chen D, Zhang B, Tian RR, Wu J, et al. Annotation and cluster analysis of spatiotemporal- and sex-related lncRNA expression in rhesus macaque brain. Genome Res. 2017;27(9):1608–20.10.1101/gr.217463.116Search in Google Scholar PubMed PubMed Central

[21] Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 2010;28(5):511–5.10.1038/nbt.1621Search in Google Scholar PubMed PubMed Central

[22] Langfelder P, Horvath S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9:559.10.1186/1471-2105-9-559Search in Google Scholar PubMed PubMed Central

[23] Xie C, Mao X, Huang J, Ding Y, Wu J, Dong S, et al. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011;39(Web Server issue):W316–22.10.1093/nar/gkr483Search in Google Scholar PubMed PubMed Central

[24] Fabregat A, Sidiropoulos K, Viteri G, Marin-Garcia P, Ping P, Stein L, et al. Reactome diagram viewer: Data structures and strategies to boost performance. Bioinformatics. 2018;34(7):1208–14.10.1093/bioinformatics/btx752Search in Google Scholar PubMed PubMed Central

[25] Maciejak A, Kiliszek M, Michalak M, Tulacz D, Opolski G, Matlak K, et al. Gene expression profiling reveals potential prognostic biomarkers associated with the progression of heart failure. Genome Med. 2015;7(1):26.10.1186/s13073-015-0149-zSearch in Google Scholar PubMed PubMed Central

[26] Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):e47.10.1093/nar/gkv007Search in Google Scholar PubMed PubMed Central

[27] Anderson JL, Morrow DA. Acute myocardial infarction. N Engl J Med. 2017;376(21):2053–64.10.1056/NEJMra1606915Search in Google Scholar PubMed

[28] Li M, Wang YF, Yang XC, Xu L, Li WM, Xia K, et al. Circulating long noncoding RNA LIPCAR Acts as a novel biomarker in patients with ST-segment elevation myocardial infarction. Med Sci Monit. 2018;24:5064–70.10.12659/MSM.909348Search in Google Scholar PubMed PubMed Central

[29] Zhang M, Liu HY, Han YL, Wang L, Zhai DD, Ma T, et al. Silence of lncRNA XIST represses myocardial cell apoptosis in rats with acute myocardial infarction through regulating miR-449. Eur Rev Med Pharmacol Sci. 2019;23(19):8566–72.Search in Google Scholar

[30] Huang L, Guo B, Liu S, Miao C, Li Y. Inhibition of the LncRNA Gpr19 attenuates ischemia-reperfusion injury after acute myocardial infarction by inhibiting apoptosis and oxidative stress via the miR-324-5p/Mtfr1 axis. IUBMB Life. 2020;72(3):373–83.10.1002/iub.2187Search in Google Scholar PubMed

[31] Zhang J, He JF. LncRNA-MALAT1 influences myocardial infarction by regulating miR-30a/beclin-1 pathway. Eur Rev Med Pharmacol Sci. 2020;24(2):885–92.Search in Google Scholar

[32] Guo FX, Wu Q, Li P, Zheng L, Ye S, Dai XY, et al. The role of the LncRNA-FA2H-2-MLKL pathway in atherosclerosis by regulation of autophagy flux and inflammation through mTOR-dependent signaling. Cell Death Differ. 2019;26(9):1670–87.10.1038/s41418-018-0235-zSearch in Google Scholar PubMed PubMed Central

[33] Xue Z, Zhang Z, Liu H, Li W, Guo X, Zhang Z, et al. lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation. Cell Death Differ. 2019;26(1):130–45.10.1038/s41418-018-0105-8Search in Google Scholar PubMed PubMed Central

[34] Chen J, Ke S, Zhong L, Wu J, Tseng A, Morpurgo B, et al. Long noncoding RNA MALAT1 regulates generation of reactive oxygen species and the insulin responses in male mice. Biochem Pharmacol. 2018;152:94–103.10.1016/j.bcp.2018.03.019Search in Google Scholar PubMed

[35] Chen L, Yang W, Guo Y, Chen W, Zheng P, Zeng J, et al. Exosomal lncRNA GAS5 regulates the apoptosis of macrophages and vascular endothelial cells in atherosclerosis. PLoS One. 2017;12(9):e0185406.10.1371/journal.pone.0185406Search in Google Scholar PubMed PubMed Central

[36] Ong SB, Hernández-Reséndiz S, Crespo-Avilan GE, Mukhametshina RT, Kwek XY, Cabrera-Fuentes HA, et al. Inflammation following acute myocardial infarction: Multiple players, dynamic roles, and novel therapeutic opportunities. Pharmacol Ther. 2018;186:73–87.10.1016/j.pharmthera.2018.01.001Search in Google Scholar PubMed PubMed Central

[37] Swirski FK, Nahrendorf M. Cardioimmunology: The immune system in cardiac homeostasis and disease. Nat Rev Immunol. 2018;18(12):733–44.10.1038/s41577-018-0065-8Search in Google Scholar PubMed

[38] Shi H, Dong Z, Gao H. LncRNA TUG1 protects against cardiomyocyte ischaemia reperfusion injury by inhibiting HMGB1. Artif Cells Nanomed Biotechnol. 2019;47(1):3511–6.10.1080/21691401.2018.1556214Search in Google Scholar PubMed

[39] Singh MV, Swaminathan PD, Luczak ED, Kutschke W, Weiss RM, Anderson ME. MyD88 mediated inflammatory signaling leads to CaMKII oxidation, cardiac hypertrophy and death after myocardial infarction. J Mol Cell Cardiol. 2012;52(5):1135–44.10.1016/j.yjmcc.2012.01.021Search in Google Scholar PubMed PubMed Central

[40] Hardy SA, Mabotuwana NS, Murtha LA, Coulter B, Sanchez-Bezanilla S, Al-Omary MS, et al. Novel role of extracellular matrix protein 1 (ECM1) in cardiac aging and myocardial infarction. PLoS One. 2019;14(2):e0212230.10.1371/journal.pone.0212230Search in Google Scholar PubMed PubMed Central

[41] Engström G, Hedblad B, Janzon L, Lindgärde F. Complement C3 and C4 in plasma and incidence of myocardial infarction and stroke: A population-based cohort study. Eur J Cardiovasc Prev Rehabil. 2007;14(3):392–7.10.1097/01.hjr.0000244582.30421.b2Search in Google Scholar PubMed

[42] Zheng Z, Wang L, Pan J. Estradiol and proinflammatory cytokines stimulate ISG20 expression in synovial fibroblasts of patients with osteoarthritis. Intractable Rare Dis Res. 2017;6(4):269–73.10.5582/irdr.2017.01062Search in Google Scholar PubMed PubMed Central

[43] Wu M, Skaug B, Bi X, Mills T, Salazar G, Zhou X, et al. Interferon regulatory factor 7 (IRF7) represents a link between inflammation and fibrosis in the pathogenesis of systemic sclerosis. Ann Rheum Dis. 2019;78(11):1583–91.10.1136/annrheumdis-2019-215208Search in Google Scholar PubMed PubMed Central

[44] Milward E, Johnstone D, Trinder D, Ramm G, Olynyk J. The nexus of iron and inflammation in hepcidin regulation: SMADs, STATs, and ECSIT. Hepatology. 2007;45(1):253–6.10.1002/hep.21526Search in Google Scholar PubMed

[45] Morris KV, Mattick JS. The rise of regulatory RNA. Nat Rev Genet. 2014;15(6):423–37.10.1038/nrg3722Search in Google Scholar PubMed PubMed Central

[46] Ponting CP, Oliver PL, Reik W. Evolution and functions of long noncoding RNAs. Cell. 2009;136(4):629–41.10.1016/j.cell.2009.02.006Search in Google Scholar PubMed

[47] Cech TR, Steitz JA. The noncoding RNA revolution-trashing old rules to forge new ones. Cell. 2014;157(1):77–94.10.1016/j.cell.2014.03.008Search in Google Scholar PubMed

[48] Yin Y, Yan P, Lu J, Song G, Zhu Y, Li Z, et al. Opposing roles for the lncRNA haunt and its genomic locus in regulating HOXA gene activation during embryonic stem cell differentiation. Cell Stem Cell. 2015;16(5):504–16.10.1016/j.stem.2015.03.007Search in Google Scholar PubMed

[49] Luo S, Lu JY, Liu L, Yin Y, Chen C, Han X, et al. Divergent lncRNAs regulate gene expression and lineage differentiation in pluripotent cells. Cell Stem Cell. 2016;18(5):637–52.10.1016/j.stem.2016.01.024Search in Google Scholar PubMed

[50] Cabili MN, Trapnell C, Goff L, Koziol M, Tazon-Vega B, Regev A, et al. Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses. Genes Dev. 2011;25(18):1915–27.10.1101/gad.17446611Search in Google Scholar PubMed PubMed Central

[51] Ulitsky I, Bartel DP. lincRNAs: Genomics, evolution, and mechanisms. Cell. 2013;154(1):26–46.10.1016/j.cell.2013.06.020Search in Google Scholar PubMed PubMed Central

[52] Mann DL. Innate immunity and the failing heart: The cytokine hypothesis revisited. Circ Res. 2015;116(7):1254–68.10.1161/CIRCRESAHA.116.302317Search in Google Scholar PubMed PubMed Central

Received: 2022-09-25
Revised: 2023-01-08
Accepted: 2023-02-07
Published Online: 2023-03-08

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Downloaded on 3.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0657/html?licenseType=open-access
Scroll to top button