Home Life Sciences Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
Article Open Access

Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration

  • Lei Huang , Zhuorun Song , Jiayi Wang , Mengxuan Bian , Jiapeng Zou , Yanpei Zou , Jun Ge EMAIL logo and Shunyi Lu EMAIL logo
Published/Copyright: April 16, 2024

Abstract

Large segmental bone defects are commonly operated with autologous bone grafting, which has limited bone sources and poses additional surgical risks. In this study, we fabricated poly(lactide-co-glycolic acid) (PLGA)/β-tricalcium phosphate (β-TCP) composite membranes by electrostatic spinning and further promoted osteogenesis by regulating the release of β-TCP in the hope of replacing autologous bone grafts in the clinical practice. The addition of β-TCP improved the mechanical strength of PLGA by 2.55 times. Moreover, β-TCP could accelerate the degradation of PLGA and neutralize the negative effects of acidification of the microenvironment caused by PLGA degradation. In vitro experiments revealed that PLGA/TCP10 membranes are biocompatible and the released β-TCP can modulate the activity of osteoblasts by enhancing the calcium ions concentration in the damaged area and regulating the pH of the local microenvironment. Simultaneously, an increase in β-TCP can moderate the lactate content of the local microenvironment, synergistically enhancing osteogenesis by promoting the tube-forming effect of human umbilical vein endothelial cells. Therefore, it is potential to utilize PLGA/TCP bioactive membranes to modulate the microenvironment at the site of bone defects to promote bone regeneration.

1 Introduction

Although natural bone tissue has the ability to self-repair small defects, severe bone defects due to trauma, tumor resection, and congenital malformations mostly require clinical intervention [1,2]. Autologous bone grafting is a common surgical procedure used in practice, but has obvious limitations due to deficiencies in donor resources and the risk of secondary injuries [3,4]. Previous studies have explored various methods to prepare bone repair membranes, with reports showing fibrous membranes made using electrostatic spinning being popular in the biomedical field due to their high porosity, drug loading properties, and biomimetic topology [5,6]. In the recent decades, bone repair membranes are commonly prepared by 3D printing, Hot-Press compression molding, and electrostatic spinning [79]. Fibrous membranes prepared though electrostatic spinning was reported to have high porosity, drug-loading properties and biomimetic topology, and is widely studied in the biomedical field [10,11]. Bioactive bone membranes are supposed to have several criteria including biocompatibility, osteoinductive activity, and space maintenance capacity, further promoting bone regeneration and rebuilding bone microenvironment [12,13]. Additionally, bioactivity can be considered a desirable feature of bone regeneration membrane in order to initiate and enhance bone formation [14]. Hence, artificial bone graft substitute is considered as an alternative to autologous/allograft. It is of great significance to develop a biocompatible and osteoinductive activity bone membrane for the clinical treatment of bone defects.

Poly(lactide-co-glycolic acid) (PLGA) has been approved by Food and Drug Administration (FDA) for clinical therapeutic use as a copolymer with controlled biodegradability and good biocompatibility [15]. It has been widely used for drug delivery due to the slow-releasing properties of the structure [16]. Jadidi et al. [17] showed encapsulating vancomycin into a PLGA coating for slow release significantly improved the cellular activity of the scaffold. Meanwhile, the lactic acid released from PLGA degradation can be metabolized by the body and promotes angiogenesis [18]. Study has indicated that PLGA microspheres are beneficial to implant in situ pore formation and bone ingrowth in bone defect areas [15]. β-tricalcium phosphate (β-TCP) is an absorbable calcium-phosphate salt that is susceptible to new bone replacement and is widely applied in bone repair because of its good osteoconductive capacity. Due to its similarity to bone minerals in terms of crystallinity and chemical composition, β-TCP has been favored by researchers for its excellent biocompatibility and biodegradability [19]. Incidentally, studies also demonstrated that PLGA can combine well with β-TCP to prepare various complexes to facilitate bone regeneration [20,21].

In this study, we intended to prepare PLGA/β-TCP composite membranes by electrostatic spinning to control the release of β-TCP. The mechanical and thermal properties as well as the in vitro osteogenic and angiogenic abilities of the composite membranes were then evaluated. The pore formation with the addition of PLGA in β-TCP promoted the growth of new bone and vascularization property. Our results reveal that PLGA/β-TCP composite membranes can be the next generation of bone regenerative material.

2 Materials and methods

2.1 Preparation of PLGA/β-TCP bioactive membrane

600 mg PLGA (lactic acid, LA:glycolic acid, GA = 70:30, M w = 105, DaiGang, China) was added to 4 mL of tetrahydrofuran/N,N-dimethylformamide (v/v = 3:1) mixed solution and stirred magnetically at room temperature for 24 h. Then, 6, 30, and 60 mg β-TCP (Sigma, USA) were added to the PLGA solution and stirred for another 3 h before sonication for 1 h. The solution was sonicated at an operating voltage of 22 kV, operating distance of 15 cm, and a feed rate of 1 mL/h. Samples were named PLGA, PLGA/TCP1, PLGA/TCP5, PLGA/TCP10 according to different β-TCP concentrations.

2.2 Membrane characterization

2.2.1 Surface morphology

Scanning electron microscopy (SEM, S-4800, Hitachi, Japan) was used to analyze the surface morphological characteristics of the membrane specimens. Elemental analysis was conducted by energy dispersive spectroscopy, and mapping of both calcium and phosphorus. β-TCP particles were analyzed by transmission electron microscopy (TEM, Hitachi, H-800, Japan).

2.2.2 Chemical phase composition

The bioactive membrane specimens were investigated by X-ray diffraction (XRD, Rigaku D/Max2550, Cu Karadiation, Japan).

2.2.3 Differential scanning calorimetry analysis

The thermal properties of the samples were analyzed by differential scanning calorimetry (DSC2910, USA). The test conditions were: 3–5 mg samples were heated from 25 to 200°C at 10°C/min to eliminate thermal history, held at 200°C for 2 min, then cooled to 0°C at 10°C/min held at 0°C for 2 min, then heated to 220°C at 10°C/min.

2.2.4 Thermogravimetric analysis

The thermal stability of the specimens was tested by a thermogravimetric analyzer (TG209F1-GC 7820A, China), where 3–5 mg of specimens would be heated from 30 to 600°C in nitrogen at a rate of 10°C/min.

2.2.5 Degradation characteristics

The degradation characteristics of the samples were performed in phosphate buffered saline (PBS). For each group of three parallel samples (30 mm × 10 mm × 1 mm), they were submersed in 10 mL of PBS and placed in a shaker (37°C, 80 rpm). The pH of the soaking solution was measured with a pH meter (Mettler Toledo, China) for the corresponding days and change in mass was measured.

2.2.6 Ion release

The pH changes and ion release of the samples were performed in PBS. For each group of three parallel samples (30 mm × 10 mm × 1 mm), they were soaked in 10 mL of PBS and placed in a shaker (37°C, 80 rpm). The collected soaking solution was measured with an inductively coupled plasma atomic emission spectrometer (ICP-AES, PerkinElmer Optima 2000, USA) for Ca2+ concentration.

2.2.7 Mechanical properties

The mechanical properties of the composite film were determined by a universal mechanical testing machine (SANS CMT 2503, USA), which was tested in room temperature at a stretching speed of 10 mm/min.

2.3 In vitro osteogenesis assay

2.3.1 Cell culture

Protocol of animal experimentation in the study was approved by the Animal Care and Use Committee of Suzhou University (Suzhou, China). Four-week-old Sprague-Dawley rats (SD rats) were purchased from Shanghai JASJ Laboratory Animal Co. Primary bone marrow mesenchymal stem cells (BMSCs) were derived from the femur and tibia of the SD rats in accordance with the published methodology [15]. BMSCs were cultivated in α-MEM medium (Gibco, USA) containing 10% fetal bovine serum, (BI, USA) and 1% penicillin and streptomycin (Sigma, USA). Cells of the second to fourth generation were used for subsequent experiments. All material samples were sterilized by ethylene oxide and isolated samples (10 mm × 3 mm) were immersed in α-MEM at 37°C for 24 h to retrieve the material extracts following ISO 10993.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals, and has been approved by the Animal Care and Use Committee of Suzhou University.

2.3.2 Cell proliferation and adhesion

To perform live/dead staining assays, BMSCs were processed with material extract for 1/3/5/7 days and then exchanged for a Calcein-AM/PI double staining kit (Beyotime, China) for 30 min according to the instruction manual. Observation and photography were carried out with an inverted fluorescent microscope (Olympus, IX71, Japan).

Cell counting kit-8 (CCK-8) assay of BMSCs was conducted with the density of 5 × 104 cells/well seeded in a 24-well culture plate. After 1, 3, and 5 days of incubation with material extract, the medium was substituted with α-MEM medium containing 10% CCK-8 solution (Beyotime, China). The plates were then cultured at 37°C and 5% CO2 for 30 min, and the absorbance on the plates was recorded at 450 nm using a microplate reader (Epoch, BioTek Instruments, Inc.).

2.3.3 Osteogenic differentiation

To study osteogenic differentiation, osteogenic induction medium (OIM) was made of α-MEM containing 0.05 mM vitamin C (Sigma, USA), 10 mM β-glycerophosphate (Sigma, USA), and 10 nM dexamethasone (Sigma, USA). BMSCs were prepared in 12-well plates along with extracts in a cell culture incubator at 1 × 105 cells/well. The medium was substituted with OIM upon reaching cell density confluency of 70–80%. BMSCs culture were exchanged for OIM every 3 days to evaluate osteogenic differentiation with alkaline phosphatase (ALP) staining, ALP activity was recorded after 14 days of culture and Alizarin Red S (ARS) staining after 21 days.

A BCIP/NBT solution (Beyotime, China) was utilized to determine ALP expression. After 14 days of incubation, BMSCs were washed three times with PBS and then processed with 10% neutral formalin for 15 min. Samples were stained according to the protocol and washed with PBS before observation with an optical microscope (Olympus, IX71, Japan). After 14 days of incubation, ALP activity was examined using an ALP assay kit (Beyotime, China). BMSCs were lysed with RIPA lysis buffer (Beyotime, China) and then centrifuged for 20 min at 3,000 rpm to detect ALP activity. Total cell protein was quantified in parallel with the BCA protein assay kit (Beyotime, China). Activity of ALP was identified after absorbance measurements at 405 nm on a microplate reader (Epoch, BioTek Instruments, Inc.)

ARS staining assay was performed to assess mineralization (Beyotime, China). Following 21 days of culture, calcium deposition was assessed with 0.5% Alizarin Red workup and observed by optical microscopy according to the instruction manual (Olympus, IX71, Japan).

2.4 In vitro angiogenesis assay

2.4.1 Cell culture

Human umbilical vein endothelial cells (HUVECs) were acquired from the Shanghai Institutes for Biological Sciences cell bank and were utilized to estimate the influence of β-TCP on angiogenesis in vitro.

2.4.2 Tube formation assay

Twenty-four-well plates were pre-treated initially with polymerized Matrigel (BD Biosciences, San Jose, CA). Cells were then seeded onto the Matrigel surface at a density of 1 × 105 cells/well and incubated in the extract for 12 h. Microscopic images were taken at random and ImageJ with the Angiogenesis Analyzer plug-in (NIH, Bethesda, MD) was used to quantify the tubular network (number of primary nodes and total segment length).

2.4.3 Transwell assay

The invasion capacity of HUVECs was assayed by the transwell assay. HUVECs were placed on the top layer of a transwell cell culture chamber (Costar, Cambridge, MA, USA). After the transwell chamber was capped with 50 μL of Matrigel (BD, Biosciences, USA), the membrane extract was placed underneath the cell permeable membrane for 12 h of incubation. The upper chamber was then washed twice with HUVECs to exclude non-invasive cells. HUVECs that had migrated through the membrane were fixed with 4% paraformaldehyde (Beyotime, China) for 15 min and then colored with 0.4% crystal violet stain (Amresco, USA) for 20 min. Several microscopic areas were randomly selected for analysis.

2.4.4 Angiogenesis-related gene levels

After 3 days in culture, HUVECs were harvested and reverse transcribed to cDNA and RT-PCR was performed to check the gene expression levels of Willebrand Factor (vWF), vascular endothelial growth factor (VEGF), CD31, and β-actin as a control reference. Sequence information used in the study is presented in Table 1.

Table 1

Primer sequences of each angiogenesis-related gene

Gene Direction Sequence (5′–3′)
VEGF Forward TTCAAGCCATCCTGTGTGCC
Reverse CACCAACGTACACGCTCCAG
vWF Forward CCGATGCAGCCTTTTCGGA
Reverse TCCCCAAGATACACGGAGAGG
CD31 Forward AACAGTGTTGACATGAAGAGCC
Reverse TGTAAAACAGCACGTCATCCTT
β-actin Forward ATGTTCCAGTATGACTCCACTCAC
Reverse GAAGACACCAGTAGACTCCACGAC

2.5 Statistical analysis

At least three independent replicates were used for each experiment and continuous variables were represented as mean value ± standard deviation. One-way analyses of variance (ANOVA) were used to compare different treatment interventions in SPSS 20.0. The level of significant difference was set at p* < 0.05 and p** < 0.01.

3 Results

3.1 Chemical phase and thermal properties of the active membranes

As shown in Figure 1a, all groups of samples exhibited a broad peak at 2θ = 22°. PLGA is an amorphous polymer and the intensity of this peak with concentration of β-TCP content increases, indicating that β-TCP was well dispersed within the PLGA films in this concentration range. Loading of β-TCP in the PLGA membrane is shown in Figure 1b and c. The incorporation of β-TCP caused a decrease in the thermal decomposition temperature and glass transition temperature of PLGA, but the effect on thermal performance was slight. The decrease in thermal stability may be due to the agglomeration of β-TCP particles. The regularity of ion release also remained largely constant in the composite membrane. Concentration of calcium ions released best was in first 24 h and reached a stable value after 2 weeks, depending on the amount of β-TCP (Figure 1d). The addition of β-TCP not only accelerated the degradation of PLGA, but also neutralized the negative side effects of acidification of the microenvironment caused by PLGA degradation (Figure 1e and f).

Figure 1 
                  Chemical phase and thermal properties of the active membranes. (a) XRD of the membrane. (b) DSC. (c) TGA. (d) Ca2+ release concentration. (e) Weight loss and (f) pH vibration of PBS after samples soaking. Data are presented as the mean value ± SD; n = 3.
Figure 1

Chemical phase and thermal properties of the active membranes. (a) XRD of the membrane. (b) DSC. (c) TGA. (d) Ca2+ release concentration. (e) Weight loss and (f) pH vibration of PBS after samples soaking. Data are presented as the mean value ± SD; n = 3.

3.2 Mechanical properties of bioactive membrane

Mechanical properties of the electrospinning membrane increased continuously with the increase in β-TCP content, from the initial 3.05 ± 0.10 MPa (PLGA) to 7.79 ± 0.135 MPa (PLGA/TCP10). The tensile strength of PLGA/TCP5 film increased by 134% compared to the pure PLGA film, but the β-TCP content increased from 5 to 10 wt%, mechanical properties only improved by 9% (Figure 2a and b). The tensile modulus displayed the same trend in Figure 2c.

Figure 2 
                  The mechanical properties of PLGA/β-TCP bioactive membrane. (a) Tensile stress–tensile strain of PLGA/β-TCP bioactive membrane, (b) tensile stress, and (c) tensile modulus. (d) Microscopic morphology of β-TCP. Data are presented as the mean value ± SD; n = 3; *p < 0.05 and **p < 0.01.
Figure 2

The mechanical properties of PLGA/β-TCP bioactive membrane. (a) Tensile stress–tensile strain of PLGA/β-TCP bioactive membrane, (b) tensile stress, and (c) tensile modulus. (d) Microscopic morphology of β-TCP. Data are presented as the mean value ± SD; n = 3; *p < 0.05 and **p < 0.01.

3.3 Microscopic morphology and elemental distribution of the membranes

The microscopic morphology of the composite film can be clearly observed from Figure 3. Meanwhile, the roughly 400 nm of β-TCP was observed by the TEM (Figure 2d). The addition of β-TCP did not have much effect on the diameter of the PLGA fibers, which remained in the range of 1–20 μm. As shown in the elemental distribution diagram, β-TCP is well dispersed in the PLGA fibers. The dense membrane structure has the potential to act as a physical barrier at the wound site [22].

Figure 3 
                  Microscopic morphology and elemental distribution of the membranes. First column: SEM of the membrane; second column: elemental distribution of calcium; third column: elemental distribution of phosphorus; fourth column: elemental distribution on the membrane.
Figure 3

Microscopic morphology and elemental distribution of the membranes. First column: SEM of the membrane; second column: elemental distribution of calcium; third column: elemental distribution of phosphorus; fourth column: elemental distribution on the membrane.

3.4 Effect of PLGA/TCP on proliferation and adhesion of BMSCs

Cell viability is a primary parameter for analyzing the biocompatibility of a bio-scaffold as it directly affects both cell proliferation and differentiation directly. We cultivated BMSCs with PLGA/TCP extracts. Live/dead cell staining revealed that the scaffold did not hinder cell proliferation and almost no dead cells were detected during the observation (Figure 4a and b). Cell viability was measured in parallel using the CCK-8 assay to facilitate assessment. As shown in Figure 4c, the OD values increased with incubation time, but there was no statistical difference between the three groups, demonstrating that BMSCs proliferated well in the infiltrates of the material in each group. Additionally, we co-cultured cells with the surface of the material and detected the cytotoxic effect of materials on both BMSCs and HUVECs by using live/dead staining and CCK-8 assays after 1, 4, and 7 days. The results also showed that the bioactive membranes had no cytotoxic effect after co-culturing cells on the surface of the materials (Figures S2 and S3). In summary, PLGA/TCP was non-cytotoxic and promoted cell adhesion and proliferation.

Figure 4 
                  Proliferation and cell adhesion of BMSCs treated with extracts. (a) Live/dead staining results of BMSCs. (b) Cell viability according to the live/dead assays. (c) CCK-8 analysis of BMSCs. Data are presented as mean value ± SD; n = 3; *p < 0.05 and **p < 0.01.
Figure 4

Proliferation and cell adhesion of BMSCs treated with extracts. (a) Live/dead staining results of BMSCs. (b) Cell viability according to the live/dead assays. (c) CCK-8 analysis of BMSCs. Data are presented as mean value ± SD; n = 3; *p < 0.05 and **p < 0.01.

3.5 Effect of PLGA/TCP on osteogenic differentiation capacity of BMSCs

To verify the subsequent effect of PLGA/TCP on osteogenesis in the local microenvironment, we combined the material extract with OIM to culture BMSCs. Figure 5a and b illustrate the outcome of ALP staining and ALP activity of BMSCs after 14 days of culture. ALP staining revealed an increased amount of ALP-positive cells in the PLGA/TCP scaffold group compared to the PLGA group, as well as an increase in positive cells with the increase in β-TCP content, indicating that β-TCP significantly enhance osteogenic differentiation. The PLGA/TCP1 group showed an increase (approximately 1.65-fold) ALP activity compared to the PLGA group as well as PLGA/TCP5 (approximately 2.26-fold), while the PLGA/TCP10 group exhibited the highest increase in ALP activity over 14 days (approximately 2.93-fold), as shown in Figure 5b. Formation and deposition of calcium salt nodules regarded as a marker of osteoblast maturation. We examined calcified nodules with alizarin red staining to identify the long-term effects of β-TCP in promoting bone formation [15]. ARS staining resulting from culturing BMSCs after 21 days is shown in Figure 5c. An increased amounts of calcified nodules was observed in the PLGA/TCP10 group, while the PLGA group had the lowest number of calcified nodules. This shows that PLGA/TCP10 extract accelerated and enhanced the mineralization process in osteoblasts, confirming that PLGA/TCP10 promotes osteogenic differentiation of BMSCs.

Figure 5 
                  Osteogenic effect on BMSCs treated with extracts. (a) Quantification of ALP activity of BMSCs for 7 and 14 days. (b) ALP staining of BMSCs for 14 days. (c) ARS staining of BMSCs for 21 days. Data are presented as mean value ± SD; n = 3; *p < 0.05 and **p < 0.01.
Figure 5

Osteogenic effect on BMSCs treated with extracts. (a) Quantification of ALP activity of BMSCs for 7 and 14 days. (b) ALP staining of BMSCs for 14 days. (c) ARS staining of BMSCs for 21 days. Data are presented as mean value ± SD; n = 3; *p < 0.05 and **p < 0.01.

3.6 Effect of PLGA/TCP on angiogenic capacity of HUVECs

As shown in Figure 6a, our results displayed that HUVECs in the PLGA/TCP10 group had the best angiogenic capacity. The angiogenic capacity of HUVECs was assessed by ImageJ, by quantifying the number of grids and primary nodes in the tube formation test and thus reflecting the angiogenic capacity of HUVECs, with more primary nodes and total segment length detected in the PLGA/TCP10 group (Figure 6b). Transwell assay was also used to evaluate the effect of PLGA/TCP on the migratory capacity of HUVECs. Results revealed that the crystal violet stain of migrating cells was significantly higher in the PLGA/TCP10 group compared to the other groups (Figure 6c and d). We performed qRT-PCR analysis to validate the angiogenic effect at the gene expression level after 3 days of incubation in the extracts. Compared to cells in the PLGA group, HUVECs in the PLGA/TCP10 group exhibited approximately 3.31-fold vWF expression, 2.96-fold VEGF expression and 3.08-fold CD31 expression (Figure 6e). These results suggest that PLGA/TCP has a positive effect on the angiogenic capacity of HUVECs.

Figure 6 
                  Angiogenic effect of HUVECs treated with extracts. (a) Tube formation assay of HUVECs cells. (b) Number of master junction and total segment length calculated with ImageJ. (c) Quantitative analysis of the Transwell assay. (d) Transwell assay of HUVECs cells. (e) Angiogenesis related gene expression of HUVECs cultured in extracts for 3 days. Data are presented as mean value ± SD; n = 3; *p < 0.05 and **p < 0.01.
Figure 6

Angiogenic effect of HUVECs treated with extracts. (a) Tube formation assay of HUVECs cells. (b) Number of master junction and total segment length calculated with ImageJ. (c) Quantitative analysis of the Transwell assay. (d) Transwell assay of HUVECs cells. (e) Angiogenesis related gene expression of HUVECs cultured in extracts for 3 days. Data are presented as mean value ± SD; n = 3; *p < 0.05 and **p < 0.01.

4 Discussion

Due to population aging, traffic accident, or sports injury, bone defects and comminuted fracture remain as common clinical challenges [23,24]. The clinical gold standard for the reconstruction of bone defects is autologous bone grafting. However, its application is restricted by the low availability of bone grafts and donor-site morbidity [1,15,23]. Therefore, there is an increasing clinical demand for biomaterials for the treatment of bone defects. β-TCP is favored by researchers because of its excellent biocompatibility, good osteogenic activity, and can be combined with other materials to improve its biomechanical properties and osteogenic capacity [25]. Although the mechanical strength of β-TCP is slightly lower, its biodegradation rate is faster, which facilitates the growth of new bone around the implanted β-TCP base scaffold, and thus, β-TCP can be combined with other materials to improve its biomechanical properties and osteogenic ability [26]. However, the biomedical application of β-TCP is limited due to its inherent brittleness, non-degradability, and non-plastic ability [25,27]. PLGA, authorized by the US FDA, is frequently used to regulate the degradation rate of implants to meet clinical needs [28]. It was reported that the strength of calcium phosphate cement could be enhanced by adding PLGA medical sutures to form connected pores after polymer fiber degradation [29]. Studies also revealed that PLGA nanofibers can greatly improve the toughness and accelerate the degradation of calcium phosphate by using high aspect ratio and controllable degradation of PLGA [15]. PLGA degradation produces GA and LA, which could be metabolized and absorbed by the human body [15]. Previous studies have showed that the acidic products due to PLGA degradation lower the pH of the local environment, producing a local inflammatory response [30]. Simultaneously, the release of β-TCP is able to neutralize the local production of acid to some extent, overcoming the potential negative effects caused by excessive acidity and regulating the microenvironment for osteogenic repair [31]. Moreover, a high level of LA can make the local microenvironment become weakly acidic, which can facilitate the degradation of β-TCP [32,33]. In this study, we found that the viscosity of the bioactive membrane will be too large and the particles are easy to agglomerate when the TCP concentration exceeds 10%. It is difficult to prepare the electrospinning so that we prepared bioactive membrane with three concentrations of PLGA/TCP1, PLGA/TCP5, and PLGA/TCP10 for subsequent experiments in this study. Our results also showed that Ca2+ release was greater in the PLGA/TCP10 group than in the other groups, which led to an osteogenic environment during material degradation, thus greatly improving osseointegration and the growth of new bone towards the defect area.

As good biocompatibility is the prerequisite for the application of biomaterials in tissue repair [1], in this study, CCK-8 and live/dead staining assay were applied to evaluated cell viability. In addition, after cells were co-cultured with the surface of the material, it was still observed that both BMSCs and HUVECs could proliferate well and cell viability was not inhibited. Cell survival rate of live/dead assay and CCK-8 analysis showed that BMSCs proliferated well in all groups, demonstrating that PLGA/TCP membranes were non-cytotoxic for cell viability and proliferation. For osteogenic capacity, ALP staining and ALP activity assay were performed to measure the osteogenic capacity of BMSCs after osteogenic induction. ALP is a primary marker reflecting osteoblast differentiation and early bone mineral formation on biomaterials in vitro [34]. The results of ALP activity on the days 7 and 14 showed that osteogenic differentiation capacity of BMSCs was significantly increased after adding various membranes’ extracts, and PLGA/TCP10 group had the best osteogenic differentiation capacity in BMSCs. Moreover, the results of ALP staining on the day 14 and ARS staining on the day 21 also showed that the mineralization deposition gradually increased and PLGA/TCP10 group had the most mineralized nodules, suggesting that PLGA/TCP10 had the best effect of osteogenic differentiation capacity on BMSCs.

Bone tissue is a vascularized connective tissue, which primarily deliver oxygen, nutrients, hormones, neurotransmitters, and growth factors to bone cells and such neovascularization is indispensable for proper bone regeneration and remodeling [3537]. Furthermore, it is reported that LA promotes vascular growth, which is also important for bone regeneration [38]. A recent study has revealed that the vascularization of bone defects is conducive to the recruitment of more BMSCs. Hence, the establishment of a vascular network at the bone defect area is favorable for bone formation [39]. Currently, the influence of PLGA/TCP on the angiogenic capability of HUVECs was also investigated by tube formation tests. The degradation of PLGA releases lactic acid, leading to localized accumulation of lactic acid in the osteogenic region. Moderate levels of lactic acid promote the angiogenic effect of HUVECs, but an overly acidic microenvironment impedes angiogenesis [40]. Regulation of the microenvironmental pH by β-TCP allows for a relatively neutral osteogenic zone, promoting angiogenesis in vitro. In the present study, the invasion and angiogenesis ability of HUVECs were assessed by tube formation and Transwell assay. As shown in the results, PLGA/TCP10 membrane had the best angiogenic capacity effect on HUVECs. The number of master junctions and total segment length were used to quantify the tube formation capacity by Image J, and the results also confirmed this tendency. Similar trends were also observed in the transwell assay, where the PLGA/TCP10 had the best invasive capacity of HUVECs. qRT-PCR results also revealed that the PLGA/TCP10 group had the best positive effect on angiogenic capacity in HUVECs. As angiogenesis is closely associated with osteogenesis, taken together, the results of this study demonstrated that PLGA/TCP10 membrane could improve the angiogenesis ability of HUVECs and synergistically promote bone regeneration.

5 Conclusion

In this study, we developed a PLGA/β-TCP compound membrane through electrostatic spinning aiming to control the release of β-TCP, to modulate the activity of osteoblasts and vascular endothelial cells. This biodegradable bioactive repair membrane possesses good mechanical and thermochemical properties, offering certain biological functions and is capable of facilitating osteogenesis and angiogenesis in vitro. Our results show that PLGA/β-TCP composite membranes further support the potential of PLGA and β-TCP as biomaterials.


# These authors contributed equally to this paper.


  1. Funding information: This work was supported by the Natural Science Foundation BoXi Cultivation Program Project of the First Affiliated Hospital of Soochow University (BXQN2023013).

  2. Author contributions: Lei Huang and Zhuorun Song designed the study, performed the experiments, and wrote the manuscript. Jiayi Wang, Mengxuan Bian, and Jiapeng Zou analyzed the data. Jun Ge and Shunyi Lu made the final version of figures and prepared the manuscript for publication. All authors have read and agreed to the published version of the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Hu Z, Lu J, Zhang T, Liang H, Yuan H, Su D, et al. Piezoresistive MXene/Silk fibroin nanocomposite hydrogel for accelerating bone regeneration by re-establishing electrical microenvironment. Bioact Mater. 2023;22:1–17.Search in Google Scholar

[2] Iantomasi T, Romagnoli C, Palmini G, Donati S, Falsetti I, Miglietta F, et al. Oxidative stress and inflammation in osteoporosis: molecular mechanisms involved and the relationship with microRNAs. Int J Mol Sci. 2023;24(4):3772.Search in Google Scholar

[3] Jawahier PA, Waaijer L, d’Ailly PN, Schep NWL. Masquelet procedure for the treatment of intra-articular defects of the wrist. J Wrist Surg. 2023;12(6):543–8.Search in Google Scholar

[4] von Hertzberg-Boelch S, Luedemann M, Rudert M, Steinert A. PMMA bone cement: Antibiotic elution and mechanical properties in the context of clinical use. Biomedicines. 2022;10(8):1830.Search in Google Scholar

[5] Cao S, Zhao Y, Hu Y, Zou L, Chen J. New perspectives: In-situ tissue engineering for bone repair scaffold. Compos Part B: Eng. 2020;202:108445.Search in Google Scholar

[6] Koons GL, Diba M, Mikos AG. Materials design for bone-tissue engineering. Nat Rev Mater. 2020;5(8):584–603.Search in Google Scholar

[7] Guirguis D, Tucker C, Beuth J. Accelerating process development for 3D printing of new metal alloys. Nat Commun. 2024;15(1):582.Search in Google Scholar

[8] Siraj S, Al-Marzouqi AH, Iqbal MZ, Ahmed W. Impact of micro silica filler particle size on mechanical properties of polymeric based composite material. Polym (Basel). 2022;14(22):4830.Search in Google Scholar

[9] He C, Lv Q, Liu Z, Long S, Li H, Xiao Y, et al. Random and aligned electrostatically spun PLLA nanofibrous membranes enhance bone repair in mouse femur midshaft defects. J Biomater Appl. 2023;37(9):1582–92.Search in Google Scholar

[10] Fu Y, Huang S, Feng Z, Huang L, Zhang X, Lin H, et al. MXene-functionalized ferroelectric nanocomposite membranes with modulating surface potential enhance bone regeneration. ACS Biomater Sci Eng. 2023;9(2):900–17.Search in Google Scholar

[11] Lin J, He Y, He Y, Feng Y, Wang X, Yuan L, et al. Janus functional electrospun polyurethane fibrous membranes for periodontal tissue regeneration. J Mater Chem B. 2023;11(38):9223–36.Search in Google Scholar

[12] Wu S, Luo S, Cen Z, Li Q, Li L, Li W, et al. All-in-one porous membrane enables full protection in guided bone regeneration. Nat Commun. 2024;15(1):119.Search in Google Scholar

[13] Zhu Y, Zhou J, Dai B, Liu W, Wang J, Li Q, et al. A bilayer membrane doped with struvite nanowires for guided bone regeneration. Adv Healthc Mater. 2022;11(18):e2201679.Search in Google Scholar

[14] Niu X, Wang L, Xu M, Qin M, Zhao L, Wei Y, et al. Electrospun polyamide-6/chitosan nanofibers reinforced nano-hydroxyapatite/polyamide-6 composite bilayered membranes for guided bone regeneration. Carbohydr Polym. 2021;260:117769.Search in Google Scholar

[15] Cai P, Lu S, Yu J, Xiao L, Wang J, Liang H, et al. Injectable nanofiber-reinforced bone cement with controlled biodegradability for minimally-invasive bone regeneration. Bioact Mater. 2023;21:267–83.Search in Google Scholar

[16] Ruirui Z, He J, Xu X, Li S, Peng H, Deng Z, et al. PLGA-based drug delivery system for combined therapy of cancer: research progress. Mater Res Express. 2021;8(12):122002.Search in Google Scholar

[17] Jadidi A, Salahinejad E, Sharifi E, Tayebi L. Drug-delivery Ca-Mg silicate scaffolds encapsulated in PLGA. Int J Pharmaceutics. 2020;589:119855.Search in Google Scholar

[18] Bazgir M, Saeinasab M, Zhang W, Zhang X, Min Tsui K, Maasoumi Sarvestani A, et al. Investigation of cell adhesion and cell viability of the endothelial and fibroblast cells on electrospun PCL, PLGA and coaxial scaffolds for production of tissue engineered blood vessel. J Funct Biomater. 2022;13(4):282.Search in Google Scholar

[19] Bohner M, Santoni BLG, Döbelin N. β-tricalcium phosphate for bone substitution: Synthesis and properties. Acta Biomater. 2020;113:23–41.Search in Google Scholar

[20] Zhou Y, Hu J, Li B, Xia J, Zhang T, Xiong Z. Towards the clinical translation of 3D PLGA/β-TCP/Mg composite scaffold for cranial bone regeneration. Mater (Basel). 2024;2:17.Search in Google Scholar

[21] Hatt LP, van der Heide D, Armiento AR, Stoddart MJ. β-TCP from 3D-printed composite scaffolds acts as an effective phosphate source during osteogenic differentiation of human mesenchymal stromal cells. Front Cell Dev Biol. 2023;11:1258161.Search in Google Scholar

[22] Qiao F, Lv Y. Hybrid cell membrane-functionalized matrixes for modulating inflammatory microenvironment and improving bone defect repair. Adv Healthc Mater. 2023;e2203047.Search in Google Scholar

[23] Huang L, Lu S, Bian M, Wang J, Yu J, Ge J, et al. Punicalagin attenuates TNF-α-induced oxidative damage and promotes osteogenic differentiation of bone mesenchymal stem cells by activating the Nrf2/HO-1 pathway. Exp Cell Res. 2023;430(1):113717.Search in Google Scholar

[24] Zheng S, Zhou C, Yang H, Li J, Feng Z, Liao L, et al. Melatonin accelerates osteoporotic bone defect repair by promoting osteogenesis-angiogenesis coupling. Front Endocrinol (Lausanne). 2022;13:826660.Search in Google Scholar

[25] Deyneko DV, Lebedev VN, Barbaro K, Titkov VV, Lazoryak BI, Fadeeva IV, et al. Antimicrobial and cell-friendly properties of cobalt and nickel-doped tricalcium phosphate ceramics. Biomim (Basel). 2023;9(1):14.Search in Google Scholar

[26] Sudo Y, Nishida Y, Nakashima H, Arai T, Takatsu T. Clinical outcomes of a novel unidirectional porous β-tricalcium phosphate filling in distal radius fracture with volar locking plate fixation: secondary publication of the Japanese version. Medicina (Kaunas). 2023;60(1):1.Search in Google Scholar

[27] Umrath F, Schmitt LF, Kliesch SM, Schille C, Geis-Gerstorfer J, Gurewitsch E, et al. Mechanical and functional improvement of β-TCP scaffolds for use in bone tissue engineering. J Funct Biomater. 2023;14(8):427.Search in Google Scholar

[28] Paul PS, Patel T, Cho JY, Yarahmady A, Khalili A, Semenchenko V, et al. Native PLGA nanoparticles attenuate Aβ-seed induced Tau aggregation under in vitro conditions: potential implication in Alzheimer’s disease pathology. Sci Rep. 2024;14(1):144.Search in Google Scholar

[29] Hatt LP, Wirth S, Ristaniemi A, Ciric DJ, Thompson K, Eglin D, et al. Micro-porous PLGA/β-TCP/TPU scaffolds prepared by solvent-based 3D printing for bone tissue engineering purposes. Regen Biomater. 2023;10:rbad084.Search in Google Scholar

[30] Li Z, Li G, Xu J, Li C, Han S, Zhang C, et al. Hydrogel transformed from nanoparticles for prevention of tissue injury and treatment of inflammatory diseases. Adv Mater. 2022;34(16):e2109178.Search in Google Scholar

[31] Lin Z, Chen Z, Chen Y, Yang N, Shi J, Tang Z, et al. Hydrogenated silicene nanosheet functionalized scaffold enables immuno-bone remodeling. Exploration (Beijing). 2023;3(4):20220149.Search in Google Scholar

[32] Wang X, Li X, Gu N, Shao Y, Guo Y, Deng Y, et al. pH-responsive, self-sculptured Mg/PLGA composite microfibers for accelerated revascularization and soft tissue regeneration. Biomater Adv. 2024;158:213767.Search in Google Scholar

[33] Cao H, Li L, Li L, Meng X, Liu Y, Cheng W, et al. New use for old drug: Local delivery of puerarin facilitates critical-size defect repair in rats by promoting angiogenesis and osteogenesis. J Orthop Transl. 2022;36:52–63.Search in Google Scholar

[34] Liu X, Chen M, Luo J, Zhao H, Zhou X, Gu Q, et al. Immunopolarization-regulated 3D printed-electrospun fibrous scaffolds for bone regeneration. Biomaterials. 2021;276:121037.Search in Google Scholar

[35] Wang J, Zhang L, Wang L, Tang J, Wang W, Xu Y, et al. Ligand-selective targeting of macrophage hydrogel elicits bone immune-stem cell endogenous self-healing program to promote bone regeneration. Adv Healthc Mater. 2024;e2303851.Search in Google Scholar

[36] Kong L, Li J, Bai Y, Xu S, Zhang L, Chen W, et al. Inhibition of soluble epoxide hydrolase enhances the dentin-pulp complex regeneration mediated by crosstalk between vascular endothelial cells and dental pulp stem cells. J Transl Med. 2024;22(1):61.Search in Google Scholar

[37] Diomede F, Marconi GD, Fonticoli L, Pizzicanella J, Merciaro I, Bramanti P, et al. Functional relationship between osteogenesis and angiogenesis in tissue regeneration. Int J Mol Sci. 2020;21(9):3242.Search in Google Scholar

[38] Hu F, Huang K, Zhang H, Hu W, Tong S, Xu H. IGF-PLGA microspheres promote angiogenesis and accelerate skin flap repair and healing by inhibiting oxidative stress and regulating the Ang 1/Tie 2 signaling pathway. Eur J Pharm Sci. 2024;193:106687.Search in Google Scholar

[39] Cheng D, Ding R, Jin X, Lu Y, Bao W, Zhao Y, et al. Strontium ion-functionalized nano-hydroxyapatite/chitosan composite microspheres promote osteogenesis and angiogenesis for bone regeneration. ACS Appl Mater Interfaces. 2023;15(16):19951–65.Search in Google Scholar

[40] Ding J, Liu Y, Liu Z, Tan J, Xu W, Huang G, et al. Glutathione-responsive organosilica hybrid nanosystems for targeted dual-starvation therapy in luminal breast cancer. Mol Pharm. 2023;21(2):745–59.Search in Google Scholar

Received: 2023-11-09
Revised: 2024-01-29
Accepted: 2024-03-13
Published Online: 2024-04-16

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Downloaded on 9.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0854/html
Scroll to top button