Startseite G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
Artikel Open Access

G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway

  • Yanbin Zhu EMAIL logo , Shufeng Huang , Dan Chai und Lei Liang
Veröffentlicht/Copyright: 23. August 2024
Artikel downloaden (PDF)
Open Life Sciences
Aus der Zeitschrift Open Life Sciences Band 19 Heft 1

Abstract

Gestational diabetes mellitus (GDM) is a metabolic disease that occurs during pregnancy. Herein, we investigate G protein-coupled receptor 1 (GPR1) in mediating GDM through the phosphorylation of serine/threonine kinase (AKT) pathway. Thirty pregnant SD rats were grouped into: normal pregnancy control group (NC), GDM model group, and GDM model + high-dose GPR1 antagonist treatment (GDM + Ari) group. GDM model was established, and the GDM + Ari group adopted GPR1 antagonist aripiprazole. The blood glucose level, insulin level, and insulin resistance (IR) were detected. The expression and phosphorylation of GPR1, AKT, and extracellular signal-regulated kinase (ERK) in placental tissue were detected using reverse transcription-polymerase chain reaction (RT-PCR) and western blotting (WB). The serum insulin concentration, glucose concentration, and glycated hemoglobin concentration during pregnancy in GDM group SD rats were significantly higher than those in the NC group (P < 0.05). The expression and phosphorylation levels of GPR1, AKT, and ERK in the placental tissue of SD pregnant rats in the GDM group were significantly lower than those in the NC group. Furthermore, compared with the GDM group, the expression of GPR1, AKT, and ERK in placental tissue was significantly reduced in the GDM + Ari group, while simultaneously enhancing the blood glucose level and IR level. In addition, the survival number, body weight, and malformation rate of the offspring of the GDM + Ari group were significantly improved, and there was no significant effect on the number of offspring. The expressions of GPR1, AKT, and ERK in placental tissue exhibited a significant decrease, while the glucose level and IR were observed to increase in the GDM + Ari group. Enhancing the expression of GPR1 may activate AKT phosphorylation to alleviate GDM. GPR1 could potentially serve as a novel target for diabetes treatment, offering new insights into managing GDM.

Graphical abstract

Keywords: GPR1; AKT; GDM; diabetes treatment; pregnancy; metabolic dieases

1 Introduction

Gestational diabetes mellitus (GDM) is a metabolic disease occurring during pregnancy and is characterized by glucose metabolism disorders that first appear during pregnancy, which can pose a serious threat to the health of pregnant women and infants [1]. In the 2021 global and regional GDM prevalence assessment report, the prevalence of GDM was as high as 27.0% in the Southeast Asia (SEA) region and 7.5% in the Middle East and North Africa (MENA) region [2]. The annual incidence of GDM in China accounts for 9.3% of the total increase in the world [3]. Current studies have shown that in addition to insulin resistance (IR) during pregnancy, there are many other factors affecting the occurrence of GDM, including genetic factors, lifestyle, abnormal insulin secretion, and fetal factors [4]. At present, many countries and regions around the world have developed special strategies and treatment programs for women, including nutritional intervention, insulin injection, and oral hypoglycemic drugs [5]. However, there are still many challenges in the accurate diagnosis and effective treatment of GDM.

With the continuous advancement of medical technology and the increasing emphasis on health awareness, the prevention and treatment of GDM are becoming increasingly refined. Currently, the management of GDM primarily involves a range of lifestyle interventions and pharmacotherapy [6]. In terms of lifestyle interventions, dietary and exercise programs have emerged as the cornerstone in managing GDM [7]. For pregnant women with severe diabetes, drug therapy has become an indispensable measure. The pathogenesis of GDM has a variety of mechanisms, including β-cell dysfunction, IR, adipose tissue dysfunction, gluconeogenesis, intestinal microbiota imbalance, and oxidative stress [8]. Many studies have confirmed that molecular markers, such as metabolites, single nucleotide polymorphisms (SNPs), microRNA (miRNA), and proteins in the mechanism of GDM, can supplement existing clinical risk factors to identify women at high risk of developing GDM during pregnancy and postpartum type 2 diabetes (T2D) [9]. Therefore, the search for new therapeutic targets has become a research hotspot in the prevention and treatment of GDM.

Phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) participates in various cellular processes, including glucose metabolism, insulin signaling, cell survival, and proliferation. AKT is a serine/threonine kinase that is activated by phosphorylation of upstream kinases such as PI3K and 3-phosphatidylinositol-dependent protein kinase 1 (PDK1) at threonine 308 and serine 473. Studies have shown that the AKT phosphorylation pathway has a major role in regulating insulin metabolism and cell proliferation [10]. In a study to explore the mechanism of microRNA-351/flotillin-2 (FLOT2)/PI3K/AKT and IR during pregnancy, GDM rats had increased levels of PI3K, AKT, and FLOT2, as well as phosphorylation of PI3K and AKT, while miR-351 expression was decreased [11]. Activated Akt enters and phosphorylates many of its downstream substrates to regulate the severity of IR, thereby affecting the occurrence of GDM, suggesting that the symptoms of GDM rats can be regulated through the PI3K/AKT pathway. G protein-coupled receptor (GPR1) can regulate cell metabolism, proliferation, and survival by activating the PI3K-AKT signaling pathway. Studies have found that GPR1 expression promotes the phosphorylation of Akt and ERK and the expression of proliferating cell nuclear antigen (PCNA) protein in choriocarcinoma trophoblast cells [12]. Mlyczyńska et al. [13] found that GPR1 was expressed in the pituitary gland of pigs during the estrous cycle and early pregnancy and proposed that GPR1 was related to the regulation of MAPK/Erk1/2, Akt, and AMPK signaling pathways affecting reproductive function. Therefore, this article explored GPR1 in the pathogenesis of GDM and its interaction with the AKT pathway through animal experiments.

2 Materials and methods

2.1 Subjects

Sprague–Dawley (SD) rats (Changzhou Cavens Experimental Animal Co., Ltd.), SPF grade, all of them 8–9 weeks old, weighing (186 ± 9) g, were used in the experiments. The rats were kept in a general animal room at a temperature of 24–27°C, a relative humidity of 60%, and the alternating light cycle was parallel to the outside day and night. Light and dark exchange was carried out every 12 h. The purchased rats were adaptively housed for 1 week, and all rats were allowed to eat and drink freely.

  1. Ethical approval: The research related to animal use complied with all the relevant national regulations and institutional policies for the care and use of animals and has been approved by the Institutional Animal Care and Use Committee (IACUC).

2.2 GDM model and grouping

The procured SD rats were placed in a cage overnight at a ratio of 2:1 female to male. On the second day, the vaginal secretions of the female rats were taken and observed under a microscope, and the presence of sperm was judged as pregnancy, marked as day 0 of pregnancy (d0). Eighteen pregnant SD rats were randomly grouped: NC, GDM model, and GDM model + high-dose GPR1 antagonist treatment (GDM + Ari).

For GDM model establishment, GDM rats were intraperitoneally injected with 45 mg/kg streptozotocin (STZ), and blood glucose was collected from the tail vein 24 h after administration. When the blood glucose concentration was greater than 11.1 mM, the model was considered successful.

NC group had no interventions.

In the GDM + Ari group, GDM rats were intraperitoneally injected with GPR1 antagonist aripiprazole at 2.5 mg/(kg day)−1, 5 mg/(kg day)−1 for 3 weeks, and the rats were killed after continuous injection. The blood collection and dissection were performed.

2.3 Serum glycosylated hemoglobin (HbA1c)

Blood samples were collected in a fasting state in the morning before modeling and 24 h after modeling. The content of HbA1c was detected by high-performance liquid chromatography.

Methods: The collected blood was stored in ethylenediamine tetraacetic acid (EDTA) anticoagulant tube (−80°C). Before the test, the blood was taken out of the refrigerator and placed in an ice box for dissolution. Then, part of the blood was put into a centrifuge tube for centrifugation (3,000 r/15 min), the serum was separated, and normal saline (volume 1:5) was added to the serum for washing. After 4 h, the blood was centrifuged (1,000 r/10 min). After removal of the supernatant, 2 nM EDTA-Na2 was added to the centrifuge tube, shaken for 5 min, and then centrifuged (3,000 r/5 min). The upper blood red liquid, HbA1c, was sucked by using a pipette. American Bio-Rad D-10 HbA1c instrument was applied.

2.4 Glucose and lipid metabolism parameters of pregnant SD rats after modeling

Following modeling, pregnant SD rats were subjected to tail vein blood sampling in the morning under a fasting state, and the rats were fasted the night before blood sampling.

Fasting plasma glucose (FPG) was detected by using the Johnson & Johnson One Touch Horizon blood glucose meter and matching test paper. The tail (5 mm) of pregnant SD rats was removed, and the hand was used to massage until bleeding. The test paper dipped into the blood was put into the blood glucose meter to detect FPG.

Fasting insulin (FINS) was detected by enzyme-linked immunosorbent assay (ELISA): a rat FINS ELISA kit was used for detection, and the operation was carried out in strict accordance with the instructions.

  1. The required reagents were mixed based on the instructions, eliminating bubbles in the liquid.

  2. About 50 μL of the standard was added to the blank microplate, repeating five wells.

  3. Samples to be tested were numbered, and then 50 μL of samples were added to the wells of the blank microplate, repeating five wells.

  4. Immediately, 50 μL of the enzyme labeling solution was added to the reaction empty well, shaken well with an oscillator, and incubated in the cell incubator for 1 h.

  5. The liquid in the microplate was shaken until clear and washed with washing solution. It was shaken for 30 s, and the washing solution was dry; this was repeated three times.

  6. Substrate was added to each sampling well, with 50 μL of solution A and 50 μL of solution B, and incubated in the dark (room temperature, 10 min) after uniform shaking.

  7. The microplate was removed, 50 μL termination solution was added, and the microplate was immediately placed in the instrument to detect the absorbance of the sample (450 nm).

  8. The standard curve was drawn. The vertical coordinate is the absorbance value, and the abscissa is the concentration of the standard. The concentration of the sample to be tested was calculated.

For assessment of IR-related indicators, IR index, and islet B cell function, homeostasis model assessment (HOMA) was adopted.

2.5 RT-PCR to detect gene mRNA expression levels

The placentas of pregnant SD rats were collected. The mRNA expression levels of GPR1, AKT, P-AKT, mammalian target of rapamycin (mTOR), and P-mTOR were detected by RT-PCR.

Total RNA was extracted from the placental tissue using the Trizol method. Labeled Eppendorf (EP) tubes were placed in an ice box, mashed tissue was placed into the EP tubes, thoroughly ground, centrifuged (3,000 r/10 min), and the supernatant was collected. About 250 μL of chloroform was added to the EP tube containing the supernatant, shaken to make it fully react, and centrifuged after 3 min to collect the supernatant. Isopropyl alcohol (volume 1:5) was added to extract RNA, shaken thoroughly, incubated at −20°C for the reaction, and centrifuged to collect the precipitate after 15 min. The precipitate was collected by centrifugation (1,200 r/5 min), and RT-PCR grade water (AM9935) was added to dissolve the precipitate. The concentration and purity of the RNA were detected by the instrument. The obtained RNA was reverse-transcribed into cDNA, and the PCR quantitative kit was used for the experiment. The reference gene GAPDH, F: 5′-CTGGAGAAACCTGCCAAGTATG-3′, R: 5′-GGTGGAAGAATGGGAGTTGCT-3′; primers for GPR1, AKT, P-AKT, and mTOR were designed.

GPR1 primer: F: 5′ CCACAGGTTTCTTCATTCTGCAC - 3′, R: 5′ GCCTCACACAAAAGCTGTATACTGAC - 3′.

AKT primer: F: 5′-GGACAACCGCCATCCAGACT-3′, R: 5′-GCCAGGGACACCTCCATCTC-3′.

P-AKT primers: F: 5′-GTGCTGGAGGACAATGACTACGG-3′, R: 5′-AGCAGCCCTGAAAGCAAGGA-3′.

mTOR primers: F: 5′-ATGACGAGACCCAGGCTAAG-3′, R: 5′-GCCAGTCCTCTACAATACGC-3′.

2.6 Western blotting (WB) to detect the protein expression level

Part of the placenta tissues of the rats were cut and placed in the corresponding EP tube. It was ground thoroughly, adding 200 μL of protein lysate, and then it was mashed to homogenize. The placenta tissues were centrifuged (4°C, 3,000 r/15 min), and the supernatant was collected. The protein concentration was detected using the bicinchoninic Acid Assay (BCA), and the operation was strictly according to the BCA protein concentration assay kit. The concentration and separation gels were prepared using sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The collected proteins were subjected to gel electrophoresis, then transferred to polydivinylidene fluoride (PVDF) membrane, washed using the buffer solution (TBST) and blocked by adding 5% skim milk powder. The primary antibody was added 30 min later, incubated at 4°C, and it was placed in a shaker overnight. The membrane was washed again with TBST, repeating three times. The secondary antibody was added and incubated at room temperature, the membrane was rinsed, and then the infrared imager was used for development. The gray value was analyzed.

2.7 Hematoxylin and eosin (HE) staining and immunohistochemistry

First, the placental tissues of rats were dehydrated, with the alcohol gradient concentration from low to high. The placentas were soaked in xylene to make the tissues transparent. The clear tissue was immersed in paraffin for embedding, and the wax solution was solidified before use. The paraffin specimens were sectioned using a micrograph and placed in a water bath at 40°C to stretch the wax slides. Then, they were removed and placed in the center of the slide and baked at 60°C for 3 h. The dried sections were deparaffinized and stained with HE. First, the slices were stained with hematoxylin and washed with water after 5 min. The paraffin sections turned blue. Then, they were stained with eosin, soaked in water for 30 s, 5 min later, and then paraffin sections were dehydrated with alcohol. They were transparent again with xylene, sealed, and examined under a microscope. The photographic results were analyzed according to the degree of staining and the positive range.

2.8 Relevant equations

The relevant equations are as follows:

(1) purity RNA = A 260 / A 280 = 2.0 ,

(2) C RNA = OD 260 × 40 × 10 − 3 ( μ g / μ L ) ,

(3) HOMA - IR = FINS × FBG / 22.5 ,

(4) HOMA - β = 20 × FINS / ( FBG − 3.5 ) .

2.9 State of offspring

The 21-day survival rate and fetal malformation rate of the offspring in the NC group, GDM group, GDM + Ari(2.5) group, and GDM + Ari(5) group were observed, and the number of fetuses and birth weight were recorded.

2.10 Data processing

SPSS 25.0 data analysis software was utilized for statistical analysis. Measurement data are presented as the mean ± standard deviation, and a t-test was employed for analysis. Count data are expressed as percentages (%), and the X 2 test was used for analysis. Statistical significance was defined as a P value less than 0.05.

3 Results

3.1 Contrast of blood glucose levels before and after modeling in pregnant SD rats

The blood glucose level of the GDM group was markedly higher than that of NC after modeling. The blood glucose level of the GDM + Ari group was markedly higher than that of NC after GPR1 antagonist administration. Moreover, the blood glucose levels in the GDM + Ari group were significantly higher compared to the GDM group (P < 0.05), with statistically significant differences (Figure 1).

Figure 1 Contrast of blood glucose levels before and after modeling. Note: relative to controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model. The blood glucose levels in the GDM group were significantly elevated, indicating successful model establishment, whereas in the GDM + Ari group, the blood glucose concentration was even higher, suggesting that the GPR1 antagonist could exacerbate IR in GDM rats.
Figure 1

Contrast of blood glucose levels before and after modeling. Note: relative to controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model. The blood glucose levels in the GDM group were significantly elevated, indicating successful model establishment, whereas in the GDM + Ari group, the blood glucose concentration was even higher, suggesting that the GPR1 antagonist could exacerbate IR in GDM rats.

3.2 Contrast of HbA1c levels in pregnant SD rats after modeling

The HbA1c level of the GDM group was markedly superior than in the NC after modeling, and that of the GDM + Ari group was superior than in the NC after GPR1 antagonist administration (P < 0.05). Moreover, the HbA1c levels in the GDM + Ari group were significantly higher compared to the GDM group (P < 0.05), with statistically significant differences (Figure 2).

Figure 2 Contrast of HbA1c levels after modeling. Note: Relative to controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; HbA1c represents glycated hemoglobin, which reflects blood glucose levels.
Figure 2

Contrast of HbA1c levels after modeling. Note: Relative to controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; HbA1c represents glycated hemoglobin, which reflects blood glucose levels.

3.3 Contrast of glucose and lipid metabolism parameters in pregnant SD rats

Figure 3 illustrates that the FPG level of GDM and GDM + Ari groups was markedly higher than in the NC (P < 0.05). The level of FINS in the GDM group was markedly higher than in NC. Relative to the NC group, the level of FINS in the GDM + Ari group was markedly increased (P < 0.05). Furthermore, the FPG and FINS levels in the GDM + Ari group were significantly higher compared to the GDM group (P < 0.05), with statistically significant differences.

Figure 3 Contrast of glucose and lipid metabolic parameters. Note: Relative to controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; FPG represents fasting plasma glucose; FINS represents fasting insulin.
Figure 3

Contrast of glucose and lipid metabolic parameters. Note: Relative to controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; FPG represents fasting plasma glucose; FINS represents fasting insulin.

3.4 Contrast of HOMA in pregnant SD rats

Figure 4 indicates that the HOMA-IR index of pregnant rats in the GDM and GDM + Ari groups was markedly higher than in the NC (P < 0.05). Furthermore, the HOMA-IR in the GDM + Ari group was significantly higher compared to the GDM group (P < 0.05), with statistically significant differences. The HOMA-β index in the GDM and GDM + Ari groups was markedly lower as than in the NC (P < 0.05). Additionally, the HOMA-β index in the GDM + Ari group was significantly lower compared to the GDM group (P < 0.05), with statistically significant differences.

Figure 4 Contrast of HOMA: (a) HOMA-IR index and (b) HOMA-β index. Note: Relative to controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; HOMA-IR represents the IR index, where HOMA-IR > 2.6 indicates IR; HOMA-β is used to evaluate pancreatic β-cell function.
Figure 4

Contrast of HOMA: (a) HOMA-IR index and (b) HOMA-β index. Note: Relative to controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; HOMA-IR represents the IR index, where HOMA-IR > 2.6 indicates IR; HOMA-β is used to evaluate pancreatic β-cell function.

3.5 HE staining characteristics of pregnant SD rats

The results showed that in the NC, the villi were smaller in volume, the number of trophoblast cells was less, the syncytiotrophoblast cells were densely aggregated into trophoblast cell knots, and the trophoblast cells did not show delamination. The villous interstitium was tightly integrated, the number of venule vessels was more, and fibrin was deposited in the intervillous space. In the GDM group, the villus maturation was different, and most of the villi were poorly developed. The number of trophoblast cells and syncytiotrophoblast knots increased markedly, and the basement membrane of trophoblast cells thickened locally. The fibrotic portion of the villous interstitial substance increased, the villous state became edematous, and the capillaries distended. In the GDM + Ari group, there was a significant increase in the thickness of the trophoblast basement membrane in pregnant mouse placentas, accompanied by a noticeable reduction in lipid droplet accumulation within the placenta (Figure 5).

Figure 5 Histological images of placental tissues from SD pregnant rats stained with hematoxylin and eosin (HE) (a) HE staining, magnification ×200, and immunohistochemistry. (b) Immunohistochemical staining, magnification ×200. Note: NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model.
Figure 5

Histological images of placental tissues from SD pregnant rats stained with hematoxylin and eosin (HE) (a) HE staining, magnification ×200, and immunohistochemistry. (b) Immunohistochemical staining, magnification ×200. Note: NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model.

3.6 Expression of GPR1 mRNA in placental tissue of pregnant SD rats

Figure 6 indicates that the GPR1 mRNA expression level of pregnant rats in the GDM and GDM + Ari groups was markedly lower than in the NC (P < 0.05). Furthermore, the GPR1 mRNA expression in the GDM + Ari group was significantly lower compared to the GDM group (P < 0.05), with statistically significant differences.

Figure 6 GPR1 mRNA expression level in the placental tissue. Note: As against controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GPR1 mRNA represents the transcription level of GPR1.
Figure 6

GPR1 mRNA expression level in the placental tissue. Note: As against controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GPR1 mRNA represents the transcription level of GPR1.

3.7 Expression of AKT, P-AKT, mTOR, and P-mTOR mRNA in placental tissues of pregnant SD rats

Figure 7 indicates that the expression levels of P-AKT mRNA and P-mTOR mRNA in GDM and GDM + Ari groups were apparently lower relative to NC (P < 0.05). Moreover, the levels of AKT mRNA and mTOR mRNA were significantly decreased compared to the NC group (P < 0.05), with statistically significant differences. Additionally, in the high-dose GDM + Ari group, the mRNA levels of AKT, P-AKT, mTOR, and P-mTOR in placental tissues were significantly reduced compared to the GDM group (P < 0.05).

Figure 7 Expression of AKT pathway-related proteins in the placental tissues. Note: As against controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; AKT: protein kinase B; P-AKT: phosphorylated protein kinase B; mTOR: mammalian target of rapamycin; P-mTOR: phosphorylated mammalian target of rapamycin.
Figure 7

Expression of AKT pathway-related proteins in the placental tissues. Note: As against controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; AKT: protein kinase B; P-AKT: phosphorylated protein kinase B; mTOR: mammalian target of rapamycin; P-mTOR: phosphorylated mammalian target of rapamycin.

3.8 GPR1 protein expression in placental tissue of pregnant SD rats

Figure 8 indicates that the expression level of GPR1 in the GDM and GDM + Ari groups was apparently lower than in the NC (P < 0.05). Furthermore, the expression level of GPR1 in pregnant rats of the GDM + Ari group was significantly lower compared to the GDM group (P < 0.05).

Figure 8 GPR1 protein expression in placental tissue. (a) protein expression level; and (b) protein expression gel image. Note: As against controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GPR1 represents G protein-coupled receptor.
Figure 8

GPR1 protein expression in placental tissue. (a) protein expression level; and (b) protein expression gel image. Note: As against controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GPR1 represents G protein-coupled receptor.

3.9 Expression of AKT, P-AKT, mTOR, and P-mTOR proteins in placental tissues of pregnant SD rats

Figure 9 reveals that the expression levels of P-AKT and P-mTOR in GDM and GDM + Ari groups were apparently lower than those in NC (P < 0.05). Furthermore, the expression levels of AKT, P-AKT, mTOR, and P-mTOR in pregnant rats of the GDM + Ari group were significantly lower compared to the GDM group (P < 0.05).

Figure 9 Contrast of AKT pathway-related protein expression levels in the placental tissue. (a) protein expression level; and (b) protein expression gel image. Note: As against controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; AKT: protein kinase B; P-AKT: phosphorylated protein kinase B; mTOR: mammalian target of rapamycin; P-mTOR: phosphorylated mammalian target of rapamycin.
Figure 9

Contrast of AKT pathway-related protein expression levels in the placental tissue. (a) protein expression level; and (b) protein expression gel image. Note: As against controls, # P < 0.05; compared with the GDM group, *P < 0.05. NC: control group; GDM: gestational diabetes mellitus model; GDM + Ari(2.5): indicates treatment with 2.5 mg/(kg day)−1 GPR1 antagonist in the GDM model; GDM + Ari(5): indicates treatment with 5 mg/(kg day)−1 GPR1 antagonist in the GDM model; AKT: protein kinase B; P-AKT: phosphorylated protein kinase B; mTOR: mammalian target of rapamycin; P-mTOR: phosphorylated mammalian target of rapamycin.

3.10 21-day survival rate and fetal malformation rate of offspring in each group

The effects of the GPR1 antagonist on the 21-day survival number and malformation rate of the offspring on this pathway were observed, and the results are illustrated in Figure 10. Compared with the NC group, the survival rate of offspring significantly decreased, and the malformation rate significantly increased in the GDM group at 21 days. Compared with the GDM group, the 21-day survival number was obviously higher, and the malformation rate was significantly reduced in the GDM + Ari(2.5) and GDM + Ari(5) groups, with significant differences.

Figure 10 The 21-day survival number and fetal malformation rate of offspring in each group: (a) 21-day survival number and (b) malformation rate. *indicates a significant difference compared with NC (P < 0.05); #indicates a significant difference compared with GDM (P < 0.05).
Figure 10

The 21-day survival number and fetal malformation rate of offspring in each group: (a) 21-day survival number and (b) malformation rate. *indicates a significant difference compared with NC (P < 0.05); #indicates a significant difference compared with GDM (P < 0.05).

3.11 Number and weight of offspring at birth

The effects of the GPR1 antagonist on the number and weight of offspring were observed, and the results are illustrated in Figure 11. There was no significant difference in the number of offspring in each group (P > 0.05). The GDM group had significantly higher birth weight than the NC group, and the GDM + Ari(2.5) and GDM + Ari(5) groups had significantly lower birth weight (P < 0.05).

Figure 11 Contrast of number and weight of offspring at birth: (a) number of offspring and (b) weight of offspring at birth. *indicates a significant difference compared with NC (P < 0.05); #indicates a significant difference compared with GDM (P < 0.05).
Figure 11

Contrast of number and weight of offspring at birth: (a) number of offspring and (b) weight of offspring at birth. *indicates a significant difference compared with NC (P < 0.05); #indicates a significant difference compared with GDM (P < 0.05).

4 Discussion

GDM refers to a type of diabetes that occurs during pregnancy. The prevalence of GDM is on the rise worldwide [14], and it can have adverse effects on the pregnancy of patients and may lead to a series of complications. Patients with GDM exhibit elevated blood glucose levels during pregnancy, which, if left uncontrolled, can result in fetal macrosomia, fetal malformation, fetal death, and other complications [15]. The hyperglycemic environment exposes the fetus to excessive glucose levels and stimulates increased insulin secretion. This leads to excessive fat accumulation in the fetal body and subsequently contributes to the development of macrosomia while also impacting fetal organ function and increasing the risk of fetal malformations. Furthermore, GDM not only poses adverse effects on the fetus but also elevates the mother’s susceptibility to T2D [16]. Studies have shown that pregnant women with GDM have an apparently increased risk of developing T2D in the first 10 years of pregnancy [17]. This is because IR increases during GDM, and the insulin secreted by the islet β cells cannot meet the demand, causing the occurrence of hyperglycemia. If blood glucose is not controlled during pregnancy, it may accelerate the deterioration of islet β-cell function and increase the risk of diabetes. In addition, GDM can also increase the risk of complications such as gestational hypertension and preeclampsia, and the hyperglycemic environment impairs the vasoconstrictor function of pregnant women, leading to increased blood pressure [18]. Preeclampsia is a grave pregnancy complication that can result in life-threatening consequences for both the mother and the baby. Hence, GDM not only poses detrimental effects on maternal health but also escalates the risk of complications for both mothers and infants. Timely diagnosis and effective management of GDM are imperative to safeguard the well-being of pregnant women and fetuses.

This study used STZ to induce GDM. STZ can selectively destroy islet β cells, resulting in reduced insulin secretion, thus mimicking the pathological process of GDM [19]. The advantage of using STZ to induce GDM is that the experimental conditions can be controlled, making the experimental results more reliable. Herein, a series of experiments have been conducted adopting STZ-induced GDM animal models. In an experiment to explore whether crocetin can inhibit GDM in diabetic rats by inhibiting inflammatory response, an STZ-induced GDM model was adopted. By detecting indicators such as blood glucose level, insulin level, and islet morphology, researchers evaluated the occurrence and development process of GDM and the influence of different factors on GDM [20].

The occurrence of GDM is closely related to IR. Increased hormone levels during pregnancy lead to increased IR, which prevents insulin from working properly. IR refers to the decreased response of tissue cells to insulin, leading to the inability of insulin to effectively promote the uptake and utilization of glucose and then causing the occurrence of hyperglycemia [21]. In GDM patients, GPR1 participates in the mechanism of regulating IR by phosphorylating the AKT pathway. AKT is an important signaling molecule that participates in important physiological processes. In the process of insulin signaling, the activation of AKT can promote the translocation of intracellular glucose transporter (GLUT), increase glucose uptake and utilization, and thus reduce blood glucose levels. In a study, FPG, CRP, and PI3K/Akt were analyzed by qRT-PCR, morphological observation, and WB. This indicates that the inhibition of PI3K/Akt can accelerate the progression of GDM [22]. The research findings indicate that diabetic pregnancies are associated with reduced placental p-Akt levels and decreased mTOR phosphorylation. Moreover, under OGD conditions, primary cell cultures from the trophoblast layer demonstrate lower levels of p-Akt and p-mTOR compared to cells cultured under standard conditions (all P < 0.05). However, the effects of increased glucose concentration on their respective levels are opposite. Administration of AMPK inhibitors does not significantly affect Akt phosphorylation but partially reverses mTOR phosphorylation [23,24]. This suggests that Akt is involved in regulating mTOR activity in the trophoblast layer of the GDM placenta. In the study by Lees et al. [25], Pls-mediated ERK phosphorylation was found to be suppressed in GPR61. This is consistent with the results in this article, in which GPR1 expression levels were apparently decreased in pregnant GDM rats, and phosphorylated AKT levels were correspondingly decreased. This implies that the activity of the GPR1-AKT pathway is inhibited in pregnant GDM rats, leading to the blockage of insulin signaling. Further studies demonstrated that downregulation of GPR1 expression and inhibition of AKT phosphorylation effectively mitigate the development of GDM in pregnant rats [26]. Activation of the GPR1-AKT pathway enhances insulin signaling and facilitates glucose uptake and utilization, thereby ameliorating the symptoms associated with GDM. These findings suggest a close association between GDM occurrence and IR, with GPR1 playing a role in regulating GDM through AKT phosphorylation. Activation of GPR1 can enhance insulin signaling, thereby improving IR. In GDM pregnant rats, the decreased expression level of GPR1 significantly reduces AKT phosphorylation, consequently inhibiting insulin signaling transduction. Further studies indicate that by inhibiting GPR1 expression and AKT phosphorylation, the diabetic condition in GDM pregnant rats can be effectively ameliorated. Activation of the phosphorylated AKT pathway can enhance insulin signaling transduction and promote glucose uptake and utilization, thus alleviating diabetic symptoms. In subsequent studies, it was found that GPR1 antagonists did not affect the number of offspring produced in experimental pregnant rats and had positive significance in improving the survival, weight, and malformation of offspring. Based on the mechanism of GPR1 activation of the phosphorylated AKT pathway, therapeutic strategies targeting this pathway can be developed. This may contribute to drug development, gene therapy, or other interventions aimed at restoring insulin signaling transduction and alleviating diabetic symptoms.

5 Conclusion

GDM is a disease that can adversely affect both the mother and the fetus and may lead to a range of complications. An animal model of STZ-induced GDM can effectively simulate the pathological process of GDM. The occurrence of GDM is closely correlated with IR, and GPR1 participates in the mechanism of regulating IR by phosphorylating the AKT pathway. Therefore, further study on the regulatory mechanism of GPR1 on IR will help to understand the occurrence and development of GDM.

# These authors contributed equally to this work as co-first author.

  1. Funding information: Authors state no funding involved.

  2. Author contributions: Yanbin Zhu and Shufeng Huang are responsible for the overall design and guidance of the research, including experimental operation and data analysis. Danchai participants in data collection and data interpretation. Leiliang is responsible for writing and revising the manual. All the authors involved in stages of the research and reviewed and approved the final manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Mora-Janiszewska O, Faryniak-Zuzak A, Darmochwał-Kolarz D. Epigenetic links between microbiota and gestational diabetes. Int J Mol Sci. 2022;23(3):1831.10.3390/ijms23031831Suche in Google Scholar PubMed PubMed Central

[2] Wang H, Li N, Chivese T, Werfalli M, Sun H, Yuen L, et al. IDF diabetes atlas: estimation of global and regional gestational diabetes mellitus prevalence for 2021 by international association of diabetes in pregnancy study group’s criteria. Diabetes Res Clin Pract. 2022;183:109050 (1–7).10.1016/j.diabres.2021.109050Suche in Google Scholar PubMed

[3] Ramezani Tehrani F, Behboudi-Gandevani S, Farzadfar F, Hosseinpanah F, Hadaegh F, Khalili D, et al. A cluster randomized noninferiority field trial of gestational diabetes mellitus screening. J Clin Endocrinol Metab. 2022;107(7):e2906–20.10.1210/clinem/dgac181Suche in Google Scholar PubMed

[4] Amrom D, Schwartz SS. Maternal metabolic health, lifestyle, and environment - Understanding how epigenetics drives future offspring health. Curr Diabetes Rev. 2023;19(2):e220422203919.10.2174/1573399818666220422085016Suche in Google Scholar PubMed

[5] Vasile FC, Preda A, Ștefan AG, Vladu MI, Forțofoiu MC, Clenciu D, et al. An update of medical nutrition therapy in gestational diabetes mellitus. J Diabetes Res. 2021;2021:5266919 (1–10).10.1155/2021/5266919Suche in Google Scholar PubMed PubMed Central

[6] Leslie RD, Ma RCW, Franks PW, Nadeau KJ, Pearson ER, Redondo MJ. Understanding diabetes heterogeneity: Key steps towards precision medicine in diabetes. Lancet Diabetes Endocrinol. 2023;11(11):848–60.10.1016/S2213-8587(23)00159-6Suche in Google Scholar PubMed

[7] Ou L, Zhu Z, Hao Y, Li Q, Liu H, Chen Q, et al. 1,3,6-Trigalloylglucose: A novel potent anti-Helicobacter pylori adhesion agent derived from aqueous extracts of Terminalia chebula Retz. Molecules (Basel, Switz). 2024;29(5):1161.10.3390/molecules29051161Suche in Google Scholar PubMed PubMed Central

[8] Gajera D, Trivedi V, Thaker P, Rathod M, Dharamsi A. Detailed review on gestational diabetes mellitus with emphasis on pathophysiology, epidemiology, related risk factors, and its subsequent conversion to type 2 diabetes mellitus. Horm Metab Res. 2023;55(5):295–303.10.1055/a-2061-9441Suche in Google Scholar PubMed

[9] Lu W, Hu C. Molecular biomarkers for gestational diabetes mellitus and postpartum diabetes. Chin Med J (Engl). 2022;135(16):1940–51.10.1097/CM9.0000000000002160Suche in Google Scholar PubMed PubMed Central

[10] Entezari M, Hashemi D, Taheriazam A, Zabolian A, Mohammadi S, Fakhri F, et al. AMPK signaling in diabetes mellitus, insulin resistance and diabetic complications: A pre-clinical and clinical investigation. Biomed Pharmacother. 2022;146:112563.10.1016/j.biopha.2021.112563Suche in Google Scholar PubMed

[11] Aghaei-Zarch SM. Crosstalk between MiRNAs/lncRNAs and PI3K/AKT signaling pathway in diabetes mellitus: Mechanistic and therapeutic perspectives. Noncoding RNA Res. 2024;9(2):486–507.10.1016/j.ncrna.2024.01.005Suche in Google Scholar PubMed PubMed Central

[12] Guven B, Akdemir Y. The change pattern in serum G protein-coupled estrogen receptor-1 (GPER1) levels during pregnancy with and without gestational diabetes mellitus. Horm Mol Biol Clin Investig. 2021;43(2):207–10.10.1515/hmbci-2021-0023Suche in Google Scholar PubMed

[13] Mlyczyńska E, Myszka M, Kurowska P, Dawid M, Milewicz T, Bałajewicz-Nowak M, et al. Anti-apoptotic effect of apelin in human placenta: Studies on BeWo cells and villous explants from third-trimester human pregnancy. Int J Mol Sci. 2021;22(5):2760.10.3390/ijms22052760Suche in Google Scholar PubMed PubMed Central

[14] Peng C, Feng Z, Ou L, Zou Y, Sang S, Liu H, et al. Syzygium aromaticum enhances innate immunity by triggering macrophage M1 polarization and alleviates Helicobacter pylori-induced inflammation. J Funct Foods. 2023;107:105626.10.1016/j.jff.2023.105626Suche in Google Scholar

[15] Chen X, Huang J, Peng Y, Han Y, Wang X, Tu C. The role of circRNA polyribonucleotide nucleoside transferase 1 on gestational diabetes mellitus. Cell Mol Biol. 2022;68(6):148–54.10.14715/cmb/2022.68.6.24Suche in Google Scholar PubMed

[16] Xie J, Li L, Xing H. Metabolomics in gestational diabetes mellitus: A review. Clin Chim Acta. 2023;539:134–43.10.1016/j.cca.2022.12.005Suche in Google Scholar PubMed

[17] Bukhari I, Iqbal F, Thorne RF. Editorial: Relationship between gestational and neonatal diabetes mellitus. Front Endocrinol (Lausanne). 2022;13:1060147.10.3389/fendo.2022.1060147Suche in Google Scholar PubMed PubMed Central

[18] Ye W, Luo C, Huang J, Li C, Liu Z, Liu F. Gestational diabetes mellitus and adverse pregnancy outcomes: Systematic review and meta-analysis. BMJ. 2022;377:e067946 (1–13).10.1136/bmj-2021-067946Suche in Google Scholar PubMed PubMed Central

[19] Norris GA, Tsai AC, Schneider KW, Wu YH, Caulfield T, Green AL. A novel, germline, deactivating CBL variant p.L493F alters domain orientation and is associated with multiple childhood cancers. Cancer Genet. 2021;254–255:18–24.10.1016/j.cancergen.2021.01.008Suche in Google Scholar PubMed

[20] Zheng Y, Zhu N, Wang J, Zhao N, Yuan C. Crocetin suppresses gestational diabetes in streptozotocin-induced diabetes mellitus rats via suppression of inflammatory reaction. J Food Biochem. 2021;45(9):e13857 (1–11).10.1111/jfbc.13857Suche in Google Scholar PubMed

[21] Kadam I, Dalloul M, Hausser J, Huntley M, Hoepner L, Fordjour L, et al. Associations between nutrients in one-carbon metabolism and fetal DNA methylation in pregnancies with or without gestational diabetes mellitus. Clin Epigenetics. 2023;15(1):137.10.1186/s13148-023-01554-1Suche in Google Scholar PubMed PubMed Central

[22] Zheng XD, Huang Y, Li H. Regulatory role of Apelin-13-mediated PI3K/AKT signaling pathway in the glucose and lipid metabolism of mouse with gestational diabetes mellitus. Immunobiology. 2021;226(5):152135.10.1016/j.imbio.2021.152135Suche in Google Scholar PubMed

[23] Hung TH, Wu CP, Chen SF. Differential changes in Akt and AMPK phosphorylation regulating mTOR activity in the placentas of pregnancies complicated by fetal growth restriction and gestational diabetes mellitus with large-for-gestational age infants. Front Med (Lausanne). 2021;8:788969.10.3389/fmed.2021.788969Suche in Google Scholar PubMed PubMed Central

[24] Liu H, Tang T. MAPK signaling pathway-based glioma subtypes, machine-learning risk model, and key hub proteins identification. Sci Rep. 2023;13(1):19055.10.1038/s41598-023-45774-0Suche in Google Scholar PubMed PubMed Central

[25] Lees JA, Dias JM, Rajamohan F, Fortin JP, O’Connor R, Kong JX, et al. An inverse agonist of orphan receptor GPR61 acts by a G protein-competitive allosteric mechanism. Nat Commun. 2023;14(1):5938.10.1038/s41467-023-41646-3Suche in Google Scholar PubMed PubMed Central

[26] Liu H, Li Y. Potential roles of cornichon family AMPA receptor auxiliary protein 4 (CNIH4) in head and neck squamous cell carcinoma. Cancer Biomark. 2022;35(4):439–50.10.3233/CBM-220143Suche in Google Scholar PubMed

Received: 2024-03-04
Revised: 2024-06-07
Accepted: 2024-06-17
Published Online: 2024-08-23

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
https://doi.org/10.1515/biol-2022-0920
Schlagwörter für diesen Artikel
GPR1; AKT; GDM; diabetes treatment; pregnancy; metabolic dieases
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 24.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0920/html
Button zum nach oben scrollen