Home Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
Article Open Access

Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks

  • Guo-Bo Sun , Yan-Feng Lu and Xiu-Jun Duan EMAIL logo
Published/Copyright: June 11, 2024
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 19 Issue 1

Abstract

To elucidate the molecular genetic mechanisms underpinning feather color in Muscovy ducks. A cohort of 100 Muscovy ducks was meticulously selected for this research. Follicular tissues from ducks exhibiting black and white plumage served as the experimental samples. From these tissues, RNA and proteins were extracted for further analysis. The RNA underwent reverse transcription polymerase chain reaction amplification, followed by validation through western blot assays. The data revealed a significant upregulation in the expression of FN domain-containing protein 1 (FNDC1) and ADAMTS12 genes in Muscovy ducks with white plumage traits as opposed to those with black plumage traits. Specifically, individuals with pure white plumage demonstrated a markedly elevated expression of the FNDC1 gene in comparison to their pure black counterparts. Conversely, expression levels of the ADAMTS12 gene were found to be reduced in ducks with pure black plumage relative to those with pure white plumage. Notably, the expression patterns of FNDC1 and ADAMTS12 genes exhibited inconsistencies between mRNA and protein levels. This study offers significant insights into the molecular genetic mechanisms underlying feather color variation in Muscovy ducks. FNDC1 and ADAMTS12 could be considered potential targets for genetic manipulation or selective breeding strategies aimed at achieving specific feather color phenotypes in Muscovy ducks.

Graphical abstract

Keywords: ADAMTS12 ; feather color; FNDC1 ; Muscovy duck; protein expression; RT-PCR

1 Introduction

The Muscovy duck (Cairina moschata), native to South and Central America, has been introduced to numerous countries worldwide, including China, over the past two centuries [1]. Distinguished from other duck varieties by its unique attributes, the Muscovy duck is characterized by low body fat, a high proportion of lean meat, robust resilience to nutritional challenges, formidable disease resistance, and superior liver quality in comparison to other poultry breeds [2]. The notable characteristics of the Muscovy duck underscore its significant potential for future development within avian agriculture.

Feather color, serving as a critical genetic marker in ducks, constitutes a readily apparent epigenetic trait [3]. Studies in this field have demonstrated that the genesis of duck feather coloration is principally governed by melanin production, which is subject to the influence of several genes [3,4]. Classical genetic models on duck feather color suggest that nine loci are instrumental in this process, interacting synergistically to manifest a spectrum of feather colors [4,5]. Historically, research efforts have primarily concentrated on the genetic inheritance mechanisms of white feather traits [5]. However, the breeding and selection processes for Muscovy ducks are intricate and the existing methodologies are not without flaws. Therefore, it is essential to undertake additional research focused on the genetic mechanisms regulating the black feather gene in Muscovy ducks, to enhance breeding strategies and selection criteria.

In this study, Muscovy ducks exhibiting three unique feather colors – black, white, and floral – were selected. Sample collection occurred at two distinct developmental stages: 120 and 300 days. Following established protocols, tissue RNA and proteins were extracted. The mRNA was then converted into complementary DNA (cDNA), serving as a basis for designing primers for reverse transcription quantitative polymerase chain reaction (qRT-PCR). This technique was employed not only to validate sequencing outcomes but also to evaluate RNA purity and to facilitate the development of antibodies for subsequent western blot verification experiments.

The FN domain-containing protein 1 (FNDC1) and ADAMTS12 genes have garnered significant interest within the realm of biological research. The protein product of the FNDC1 gene is a transmembrane protein, which exhibits widespread expression across diverse cell types. Notably, FNDC1 has been associated with the pigmentation of skin and feathers in animals, particularly in avian species. The expression level of the FNDC1 gene has been found to have a direct correlation with the coloration and patterning of feathers in birds.

Likewise, the protein produced by the ADAMTS12 gene is implicated in the color traits of animals. As a metalloproteinase, ADAMTS12 is involved in the metabolism and regulation of various extracellular matrices. Its critical function in modulating the synthesis and degradation of collagen has a significant impact on the color and texture of animal skin and feathers. A thorough investigation into these two genes can aid in uncovering the molecular mechanisms behind pigment deposition and coloration in animals, while also offering insights into their significance in evolutionary processes and natural selection.

Our research centered on the FNDC1 and ADAMTS12 genes, exploring their association with the feather color phenotype in Muscovy ducks. The objective was to decipher the genetic determinants influencing feather coloration in this species, thereby laying the groundwork for precision breeding strategies aimed at cultivating Muscovy ducks with a diverse palette of feather colors. The insights garnered from this study are intended to facilitate the identification of specific loci or genes that regulate feather color in Muscovy ducks, enhancing the comprehension of the genetic architecture underlying feather color variations in these birds.

2 Research material and method

2.1 Material

2.1.1 Formation of experimental groups

One hundred Muscovy ducks, displaying an array of feather colors – specifically white and black – were meticulously selected to constitute the experimental group. These ducks were reared from the brooding stage up to the initial egg-laying phase, concluding at 350 days of age. Initially, they were kept on the ground during the brooding period, subsequently transitioning to cage rearing during the breeding phase.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals.

2.1.2 Experimental instruments and reagents

The experimental setup encompassed a comprehensive suite of instruments and reagents, including: Trizol reagent, chloroform, isopropyl alcohol, 75% ethanol, diethyl pyrocarbonate (DEPC)-treated water, 0.5× tris-borate-EDTA (TBE) buffer, agarose gel, lysate, Oligo dT(18), 40 u/μL RNase inhibitor, 5× reaction buffer, 10 mM deoxy-ribonucleoside triphosphates (dNTPs) mix, M-MuLV reverse transcriptase, 2X real-time PCR master mix, protein powder, and polypropylene gel. The array of equipment used in the study comprised a centrifuge, nano-spectrophotometer, PCR amplification system, electrophoresis apparatus, and PVDF membrane.

2.2 Hair follicle sampling of Muscovy duck tissue

For the collection of hair follicle samples, two principal methodologies were utilized: destructive sampling and non-destructive sampling. The non-destructive approach is generally favored due to its rapid and uncomplicated procedure, minimal harm to the animals, and a lower risk of inducing stress in the subjects.

2.2.1 Destructive sampling

To collect skin hair follicle samples from Muscovy ducks, the following procedure was implemented.

First, an area approximately 4 cm2 on the side of the duck’s neck was cleaned with a cotton ball soaked in alcohol, ensuring the removal of any superficial feathers. When fuzziness became evident around 10 days later, surgical scissors were carefully used to trim it, followed by another cleansing with an alcohol-soaked cotton ball. Using forceps to lift the skin, a 1 cm2 piece of skin was excised from the cleaned area. This skin sample was then placed into a 1.5 mL centrifuge tube filled with PBS and DEPC-treated water, and subsequently stored in liquid nitrogen for later analysis. This process also involved measures to reduce inflammation and promote hemostasis at the site of the sample collection.

2.2.2 Non-destructive sampling

The procedure for collecting feather samples from the left wing of the Muscovy duck involved the following steps.

Initially, feathers that had grown to approximately 5 cm in length and displayed visible content at the root were selected for plucking. This process of plucking and collecting samples was carried out over a period of approximately 20 days. During each session of sample collection, the surface dirt on the feathers was removed using a cotton ball soaked in alcohol. Subsequently, forceps were employed to securely grasp the base of each feather, facilitating the swift extraction of the hair follicles.

For sample preparation prior to analysis, 0.5 cm segments of the hair follicles were carefully trimmed and immersed in PBS for thorough cleaning. Subsequently, these cleaned samples were promptly placed in liquid nitrogen for preservation through freezing. The procurement of hair follicle tissue samples was systematically executed across the three distinct feather color categories of Muscovy ducks at two developmental milestones: 120 and 300 days. Notably, the samples were derived from specific areas on each duck that exhibited significant color transitions in their plumage, particularly from black to white, to closely study the genetic underpinnings of feather color variation.

2.3 Sample RNA extraction

The RNA extraction from hair follicle tissues was conducted using the Trizol method, a technique known for preserving RNA integrity. Initially, samples were pulverized in liquid nitrogen and homogenized in 1 mL of Trizol reagent, followed by a 5 min incubation at room temperature. The addition of chloroform preceded centrifugation, after which the supernatant was mixed with isopropyl alcohol. A subsequent centrifugation step allowed for the RNA precipitate to be collected, which was then washed with 75% ethanol and left to air-dry. Finally, DEPC-treated water was used to dissolve the RNA, which was thereafter stored at −80°C for preservation. It is important to note that while Trizol, a phenol-based reagent, is effective in ensuring the integrity of RNA during the processing, it requires careful handling due to its potential health hazards.

2.4 Agarose gel electrophoresis

To conduct the electrophoresis, the tank and gel plate were first set up. Then, a 6 μL aliquot of the previously described RNA sample was thoroughly mixed with 0.5× TBE buffer. This mixture was subsequently loaded into the gel specimen port. Upon turning on the power switch, the voltage was adjusted to 6 V/cm. The electrophoresis was performed, allowing the RNA to migrate from the negative electrode toward the positive electrode over a span of approximately 25 min. Finally, the results were examined using a UV transmission detector.

2.5 Determination of RNA concentration and purity

To evaluate RNA purity and integrity, the NanoPhotometer P 360 (Implen, Germany) was utilized. Initially, the spectrophotometer’s detection base was calibrated through cleansing with DEPC-treated water. For zero calibration, a 1 μL droplet of DEPC-treated water was applied, followed by drying the surface using mirror wiping paper. Afterward, a 1 μL aliquot of the RNA sample was deposited on the sample base, and the sample arm was lowered to initiate analysis. Post-analysis, the arm was meticulously cleaned with dust-free paper to eliminate any residual sample, maintaining the instrument’s precision for subsequent tests. The RNA concentration was determined, and sample purity was assessed based on the A260/A280 absorbance ratio. Given that proteins absorb at 280 nm, a pure RNA sample is expected to exhibit a ratio greater than 2.0. Ratios falling below 2.0 suggest the presence of impurities, indicating compromised RNA purity.

2.6 RT-PCR detection and RNA reverse transcription

The initial specimen for the RT-PCR analysis comprised RNA extracted from the hair follicles of Muscovy ducks, with β-actin serving as the internal control. To construct a cDNA library, the Illumina mRNA-Seq 8 sample kit was utilized. Based on the cDNA and protein data, specific RT-q-PCR primers were designed (as listed in Table 1). For the reverse transcription process, 4 μL of total RNA and 2 μL of Oligo dT (18) were combined in a microcentrifuge tube. This mixture was then incubated at 65°C for 5 min, followed by a 5 min cooling period on ice. Subsequent additions included RNase inhibitor, reaction buffer, dNTPs, and M-MuLV reverse transcriptase. The synthesized cDNA was preserved at −20°C. The final reaction mixture totaled 20 μL, comprising 10 μL of 2X real-time PCR master mix, 1 μL of the cDNA template (diluted tenfold), 2 μL of primer MIX (with forward and reverse primers at 10 μM each), and 7 μL of 0.1% DEPC-treated water. The PCR protocol included an initial denaturation step at 95°C for 5 min, annealing at 60°C for 20 s, and extension at 72°C for 40 s, across 40 cycles.

Table 1

Primer sequences associated with feather color of black Muscovy duck

Gene name Primer
β-actin F:CTCTGACTGACCGCGTTACT
R:TACCAACCATCACACCCTGAT
FNDC1 F:GGAAGGGGTGAAGACCACTG
R:GGCGGTAATACCCTCGGATG
ADAMTS12 F:AAAAGCCGGATCATGCCAGA
R:CAGTGCACTCATTCCAAGGTTC

2.7 Protein extraction and western blotting verification test

Fresh muscle tissue from a Muscovy duck was minced and placed into a centrifuge tube, which was then completely filled with protein grinding powder and lysate. Using a plastic pestle, the tissue was pulverized for approximately 2–3 min. More lysate was added, and the grinding process was extended for an additional minute to ensure thorough homogenization. Following this, the tube was centrifuged at maximum speed for 1 min to separate the supernatant, which contained the extracted proteins, from the tissue debris. This supernatant was then carefully decanted into a new tube for subsequent analysis.

Protein analysis was conducted using western blotting. Post-separation, the proteins were transferred onto a PVDF membrane to facilitate detection. This detection involved the application of specific primary antibodies that bind to the target protein, followed by secondary antibodies that bind to the primary antibodies. The proteins were then evaluated based on their resultant coloration, which indicates the presence and abundance of the target protein within the sample.

2.8 Statistical analysis

Statistical analysis was performed using GraphPad Prism software. Data are presented as mean ± standard deviation. One-way analysis of variance followed by Tukey’s post hoc test were employed to determine significant differences among multiple groups. p < 0.05 was considered statistically significant. All experiments were conducted in triplicate, ensuring reliable and reproducible results.

3 Results

3.1 Sample QC data (agarose gel electrophoresis)

In this article, we detail the evaluation of RNA samples utilizing PCR and agarose gel electrophoresis, methods that successfully met the established testing criteria. The comprehensive results of this assessment are depicted in Figure 1.

Figure 1 Results of agarose gel electrophoresis. Note: gel plots: Maker: 3 μL, sample: 150 ng; M: Maker; B: black; W: White.
Figure 1

Results of agarose gel electrophoresis. Note: gel plots: Maker: 3 μL, sample: 150 ng; M: Maker; B: black; W: White.

3.2 Expression results of the FNDC1 and ADAMTS12 genes

3.2.1 mRNA expression results

In this research, we investigated the mRNA expression patterns of the FNDC1 and ADAMTS12 genes within the muscle tissues of Muscovy ducks characterized by distinct plumage colors: black and white. The outcomes,as depicted in Figure 2, the expression levels of both FNDC1 and ADAMTS12 genes in Muscovy ducks with white feathers was significantly higher than Muscovy ducks with black feathers. This pivotal finding illuminates the genetic underpinnings of feather color variations in Muscovy ducks, providing crucial insights into avian genetic diversity and evolutionary dynamics. Furthermore, these insights hold practical significance for poultry breeding endeavors, potentially facilitating the selective breeding of ducks with preferred feather colors. Such advancements could significantly contribute to the poultry industry’s economic value by enabling the customization of plumage color in domestic ducks.

Figure 2 mRNA expression level of FNDC1 and ADAMTS12. **Compared with black. P < 0.01.
Figure 2

mRNA expression level of FNDC1 and ADAMTS12. **Compared with black. P < 0.01.

3.2.2 Protein expression results

In this study, we performed an in-depth examination of muscle tissues from black and white Muscovy ducks to explore the protein expression profiles of the FNDC1 and ADAMTS12 genes. The results, presented in Table 2, distinctly underscore the differential patterns of gene expression between the two color phenotypes. Specifically, Muscovy ducks with purely white feathers demonstrated significantly higher expression levels of the FNDC1 gene, while those with purely black feathers showed diminished expression levels of the ADAMTS12 gene relative to their white-feathered counterparts.

Table 2

Findings from the analysis of protein expression in pertinent genes

Gene name Expression quantity
Pure black feather Muscovy ducks Pure white feather Muscovy ducks
FNDC1 1.13 ± 0.11 1.18 ± 0.15
ADAMTS12 1.09 ± 0.09 1.07 ± 0.10

4 Discussion

The expression of the FNDC1 gene plays a pivotal role in the coloration and patterning of feathers in poultry, influencing both the deposition of pigments and the differentiation of pigment cells. Meanwhile, ADAMTS12, functioning as a metalloproteinase, is involved in the metabolism and regulatory processes of various extracellular matrices. Through its regulation of collagen synthesis and degradation, ADAMTS12 impacts the structural organization and tissue configuration of the skin matrix. This, in turn, affects the distribution of pigment cells and the formation of pigment deposits, thereby contributing to the observed variations in feather color and patterns.

The regulation of feather color represents a complex trait influenced by the concerted action of multiple genes, epitomizing a trait characterized by polygenic causation leading to a singular phenotypic effect [5]. Presently, the focus of research efforts has been on exploring variations in feather color and examining the genetic underpinnings of feather coloration in Muscovy ducks [6]. Despite these efforts, there is a scarcity of literature dedicated to unraveling the genetic mechanisms and the correlation between molecular expressions related to feather color in Muscovy ducks. Additionally, there is a conspicuous gap in research concerning gene transcriptomics, highlighting an area ripe for further investigation.

Fibronectin (FN) is a high molecular weight adhesive glycoprotein predominantly occurring in dimeric form [7]. It is ubiquitously present across animal tissues and bodily fluids, fulfilling several critical biological functions [7,8]. FNDC1, classified as a type III FN gene situated on the human chromosome 6q25.3, acts as a receptor-independent facilitator of G protein signal transduction. This action is mediated through its interaction with the Gβγ subunit, thereby initiating G protein signal transduction pathways [9].

Prior studies have established a correlation between the expression of FNDC1 and the occurrence of various human diseases, including gastric cancer and a range of other tumorous conditions [9,10]. Within the context of poultry, particularly in broilers, FNDC1 expression has been linked to femoral head separation, a condition affecting growth [11]. Despite these associations, current literature lacks information regarding the potential relationship between FNDC1 gene expression and feather traits in Muscovy ducks.

A Disintegrin And Metalloproteinase with Thrombospondin Motifs (ADAMTS) represents a family of zinc-dependent proteases found in both invertebrates and mammals, characterized by their function as depolymerizing, protein-like metalloproteinases, which include a type I platelet-binding protein motif. Comprising 19 distinct members, this group shares the type I platelet-binding protein motifs with ADAM metalloproteinases and matrix metalloproteinases, situating them within the broader family of secreted enzymes known as metalloproteinases. These enzymes are instrumental in modulating the structural and functional dynamics of the extracellular matrix, as well as the regulation of extracellular proteins circulating within the bloodstream [12].

The ADAMTS enzyme family is classified into various subgroups, distinguished by their distinct structural features, with each subgroup fulfilling specific biological roles. For instance, ADAMTS7 and ADAMTS12 are unique in that they contain a mucin domain within the thrombospondin repeat sequence at their C-terminal end, a characteristic that facilitates their ability to cleave cartilage proteins [13]. On another front, ADAMTS15 is recognized for its function as a tumor suppressor gene, playing a pivotal role in tumor development [14]. Similarly, the expression of ADAMTS13 has been associated with the incidence of cardiovascular diseases, including stroke [12]. In an avian study, Carré et al. demonstrated the role of ADAMTS12 in the process of gonad formation in birds [15]. Concurrently, Guo et al. [16] proposed a potential connection between ADAMTS3 gene expression and the physical traits of combs in domestic chickens. However, there is a notable absence of research on the involvement of the ADAMTS family in determining the plumage of Muscovy ducks.

In our research, we explored the mRNA expression and protein concentrations of the FNDC1 and ADAMTS12 genes to ascertain their correlation with feather color variations in Muscovy ducks. The findings demonstrated differential expression levels of these genes associated with feather color. Notably, both FNDC1 and ADAMTS12 genes exhibited significantly elevated expression in Muscovy ducks possessing white feathers in comparison to their counterparts with black feathers.

Furthermore, among the pure white Muscovy ducks, the expression level of the FNDC1 gene was significantly elevated compared to that in the pure black Muscovy ducks. Conversely, the expression of the ADAMTS12 gene was found to be lower in pure black ducks when compared with pure white ducks. Discrepancies between the mRNA and protein levels of the FNDC1 and ADAMTS12 genes were observed, indicating the possibility of regulatory interferences affecting their expression. This may play a role in the observed variations in feather color across different anatomical locations.

Our results shed light on the potential genetic factors underlying feather color variations in Muscovy ducks, delivering crucial contributions to the field of avian genetics. Additionally, the implications of this research extend into practical fields, furnishing valuable data for selective breeding initiatives focused on optimizing particular characteristics within domestic duck populations. Such advancements hold the promise of conferring substantial benefits upon the poultry industry, by facilitating the development of breeds with desired phenotypic traits.

The insights garnered from this study underscore the need for further investigation to enhance our understanding significantly. To achieve a more comprehensive grasp of the roles played by the FNDC1 and ADAMTS12 genes in dictating feather color traits in Muscovy ducks, it is imperative to extend the research in several key areas. Increasing the sample size will provide a broader data set for analysis, thereby enhancing the statistical power and reliability of the findings. Advancing the research methodologies used will allow for more precise and accurate measurement of gene expression and function. Additionally, validating the expression patterns and regulatory mechanisms of the FNDC1 and ADAMTS12 genes through further experimental studies is crucial for confirming their influence on feather color variations.

5 Conclusion

In this study, we identified a significant correlation between the FNDC1 and ADAMTS12 genes and feather color variations in Muscovy ducks. However, to fully elucidate the exact mechanisms of their expression and the regulatory pathways involved, further detailed investigations are necessary.

# These authors contributed equally to this study.

tel: +86 13961078031, fax: +86 052386158521

Acknowledgements

The authors would like to acknowledge the hard and dedicated work of all the staff that implemented the intervention and evaluation components of the study.

  1. Funding information: This work was supported by 2023 Taizhou seed industry research and development project and Taizhou Science and Technology Support Program (No. TN202029).

  2. Author contributions: Conception and design of the research: S.G.B.; acquisition of data: S.G.B. and L.Y.F.; analysis and interpretation of the data: D.X.J. and L.Y.F.; statistical analysis: S.G.B. and D.X.J.; obtaining financing: S.G.B.; writing of the manuscript: S.G.B. and L.Y.F.; critical revision of the manuscript for intellectual content: D.X.J. All authors read and approved the final draft.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Lin J, Guan L, Ge L, Liu G, Bai Y, Liu X. Nanopore-based full-length transcriptome sequencing of Muscovy duck (Cairina moschata) ovary. Poult Sci. 2021;100(8):101246.Search in Google Scholar

[2] Bao X, Song Y, Li T, Zhang S, Huang L, Zhang S, et al. Comparative transcriptome profiling of ovary tissue between black muscovy duck and white muscovy duck with high- and low-egg production. Genes (Basel). 2020;12(1):57.Search in Google Scholar

[3] Sun Y, Wu Q, Lin R, Chen H, Zhang M, Jiang B, et al. Genome-wide association study for the primary feather color trait in a native Chinese duck. Front Genet. 2023;14:1065033.Search in Google Scholar

[4] Guo Q, Jiang Y, Wang Z, Bi Y, Chen G, Bai H, et al. Genome-wide analysis identifies candidate genes encoding feather color in ducks. Genes (Basel). 2022;13(7):1249.Search in Google Scholar

[5] Li S, Wang C, Yu W, Zhao S, Gong Y. Identification of genes related to white and black plumage formation by RNA-Seq from white and black feather bulbs in ducks. PLoS One. 2012;7(5):e36592.Search in Google Scholar

[6] Wu N, Qin H, Wang M, Bian Y, Dong B, Sun G, et al. Variations in endothelin receptor B subtype 2 (EDNRB2) coding sequences and mRNA expression levels in 4 Muscovy duck plumage colour phenotypes. Br Poult Sci. 2017;58(2):116–21.Search in Google Scholar

[7] Dalton CJ, Lemmon CA. Fibronectin: molecular structure, fibrillar structure and mechanochemical signaling. Cells. 2021;10(9):2443.Search in Google Scholar

[8] Patten J, Wang K. Fibronectin in development and wound healing. Adv Drug Deliv Rev. 2021;170:353–68.Search in Google Scholar

[9] Jiang T, Gao W, Lin S, Chen H, Du B, Liu Q, et al. FNDC1 promotes the invasiveness of gastric cancer via Wnt/β-catenin signaling pathway and correlates with peritoneal metastasis and prognosis. Front Oncol. 2020;10:590492.Search in Google Scholar

[10] Ren J, Niu G, Wang X, Song T, Hu Z, Ke C. Overexpression of FNDC1 in gastric cancer and its prognostic significance. J Cancer. 2018;9(24):4586–95.Search in Google Scholar

[11] Ibelli AMG, Peixoto JO, Zanella R, Gouveia JJS, Cantão ME, Coutinho LL, et al. Downregulation of growth plate genes involved with the onset of femoral head separation in young broilers. Front Physiol. 2022;13:941134.Search in Google Scholar

[12] Santamaria S, de Groot R. ADAMTS proteases in cardiovascular physiology and disease. Open Biol. 2020;10(12):200333.Search in Google Scholar

[13] Mead TJ, McCulloch DR, Ho JC, Du Y, Adams SM, Birk DE, et al. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification. JCI Insight. 2018;3(7):e92941.Search in Google Scholar

[14] Binder MJ, McCoombe S, Williams ED, McCulloch DR, Ward AC. ADAMTS-15 has a tumor suppressor role in prostate cancer. Biomolecules. 2020;10(5):682.Search in Google Scholar

[15] Carré GA, Couty I, Hennequet-Antier C, Govoroun MS. Gene expression profiling reveals new potential players of gonad differentiation in the chicken embryo. PLoS One. 2011;6(9):e23959.Search in Google Scholar

[16] Guo X, Wang J, Ma C, Wang Z, Chen H, Su H, et al. Genome-wide re-sequencing and transcriptome analysis reveal candidate genes associated with the pendulous comb phenotype in domestic chickens. Anim Sci J. 2020;91(1):e13308.Search in Google Scholar
Received: 2023-10-17
Revised: 2024-04-08
Accepted: 2024-04-29
Published Online: 2024-06-11

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
https://doi.org/10.1515/biol-2022-0877
Keywords for this article
ADAMTS12; feather color; FNDC1; Muscovy duck; protein expression; RT-PCR
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 28.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0877/html
Scroll to top button