Startseite Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
Artikel Open Access

Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases

  • Jie Qi , Penghui Li , Yasong Yan , Gongmei Li EMAIL logo und Lingcong Kong EMAIL logo
Veröffentlicht/Copyright: 26. März 2024
Artikel downloaden (PDF)
Open Life Sciences
Aus der Zeitschrift Open Life Sciences Band 19 Heft 1

Abstract

Bovine respiratory disease (BRD) is a significant veterinary challenge, often exacerbated by pathogen resistance, hindering effective treatment. Traditional testing methods for primary pathogens – Mycoplasma bovis, Pasteurella multocida, and Mannheimia haemolytica – are notably time-consuming and lack the rapidity required for effective clinical decision-making. This study introduces a TaqMan MGB probe detection chip, utilizing fluorescent quantitative PCR, targeting key BRD pathogens and associated drug-resistant genes and sites. We developed 94 specific probes and primers, embedded into a detection chip, demonstrating notable specificity, repeatability, and sensitivity, reducing testing time to under 1 h. Additionally, we formulated probes to detect mutations in the quinolone resistance-determining region, associated with fluoroquinolone resistance in BRD pathogens. The chip exhibited robust sensitivity and specificity, enabling rapid detection of drug-resistant mutations in clinical samples. This methodology significantly expedites the diagnostic process for BRD and sensitive drug screening, presenting a practical advancement in the field.

Keywords: bovine respiratory disease syndrome; TaqMan MGB fluorescence quantification; QRDR; detection chip

1 Introduction

Bovine respiratory disease (BRD) has consistently posed a substantial challenge in the realm of beef cattle farming, inflicting notable economic repercussions globally, approximated at $300 million per annum. Solely in the UK, diseases of the respiratory system impact 1.9 million cattle, culminating in the demise of 157,000 individuals [1–3]. Research conducted by Gagea et al. [4] reveals that a substantial majority, over 50%, of respiratory diseases are attributed to mixed infections, predominantly involving Mannheimia haemolytica and Mycoplasma species. An epidemiological study in Ontario, Canada, executed by Hotchkiss et al. [5], discovered that respiratory tract diseases were the cause of death in 76% of cattle cases. Further, upon conducting pathogen detection in 54 pneumonia-afflicted cattle, Mycoplasma bovis was present in 53 cases, with numerous instances (19/53) also exhibiting concurrent infection with Histophilus somni, and others with Trueperella pyogenes (14/53), M. haemolytica (11/53), and Pasteurella multocida (9/53). A study by Pardon et al. [6] on Scottish cattle farms identified M. haemolytica as the causative agent in 17% of respiratory system diseases. Additionally, Xiao et al. [7] isolated pathogens from cattle experiencing respiratory diseases in Belgium, reporting isolation rates of 70.5% for Mycoplasma species, 21.5% for H. somni, and 26.0% for M. haemolytica.

Nonetheless, the principal pathogens correlated with BRD in China exhibit slight variations compared to those in international contexts. Predominantly, Mycoplasma species and M. haemolytica emerge as the chief pathogens in China, with a reduced incidence of mixed infections involving alternative pathogens. A study by Caruso and Ross [8] involved the collection of clinical samples from 35 cattle, diagnosed with primary Mycoplasma pneumonia across the nation. The isolation and identification of pathogens revealed a dominance of Mycoplasma species infection, with mixed infections primarily comprising Mycoplasma species and M. haemolytica Type A.

In addition, pertinent studies indicate that porcine respiratory mycoplasmas, sharing the same genus as bovine respiratory mycoplasmas, possess the capability to inflict damage on the respiratory tract. These mycoplasmas engage in interactions with bacteria such as Bordetella, Streptococcus, and Pasteurella, resulting in exacerbated lesions and an extended disease duration. Marois et al. [9] documented that simultaneous infections of M. haemolytica and P. multocida further diminish macrophage functionality and hypothesized that mycoplasmas might inhibit macrophage capability, thereby heightening the host’s susceptibility to secondary bacterial infections. A study conducted by Wang et al. [10] utilizing specific pathogen-free pigs revealed that an isolated infection with Actinobacillus pleuropneumoniae (APP) serotype 9 typically manifested subclinical symptoms. However, when pigs were pre-infected with M. haemolytica 4 weeks prior to APP infection, clinical symptoms of APP were evident, signifying that M. haemolytica enhances the pathogenicity of APP.

According to pertinent research, the confluence of Mycoplasma species and M. haemolytica within the lungs precipitates more severe lesions. Epithelial cells within respiratory organs serve as the initial physical barrier against external bacteria. Upon infection, bacteria must first engage with, invade, and dismantle the epithelial cells to penetrate the host’s tissues, subsequently inducing pneumonia and related diseases. Once adhered to host cells, mycoplasmas can disrupt the functionality of cell membrane surface receptors. For instance, porcine respiratory mycoplasmas can impair K+ channels in ciliated bronchial epithelial cells, resulting in cilia stasis. Moreover, mycoplasmas generate various toxic metabolites, such as cytolysins and superoxide radicals. The membrane-bound phospholipase in mycoplasmas catalyzes the hydrolysis of host cell phospholipids, disrupting the host cell’s signal transduction pathways. Resultant hemolysins can also compromise cell membrane integrity. Additionally, research indicates that mycoplasma infection typically triggers the production of prostaglandin E2, which inhibits neutrophil activity and may subsequently induce secondary bacterial infections [11–13].

Consequently, there is an imperative need to develop mutation detection methodologies for the primary pathogens and drug resistance genes of BRD, as well as routinely utilized drug resistance targets. This study pioneered a gene chip technology that is swift, efficient, continuous, and precise [14]. In recent years, gene chip technology has been recurrently employed for the identification and categorization of pathogenic microorganisms. Through the screening of pivotal genes, the microbial genome can be directly analyzed, facilitating the identification and classification of bacterial species. Anthony et al. [15] utilized gene chip technology to expedite the diagnosis and identification of bacterial cultures within 4 h, achieving an accuracy rate of up to 77.8%. El-Sayed and Kamel [16] employed the same gene chip to detect genes representing specific bacterial species, successfully accomplishing bacterial identification and classification. In China, Zhai and Guo [17] developed gene chips for over 20 bacteria, including Escherichia coli and Salmonella, successfully identifying clinically prevalent infectious bacteria. Aslam et al. [18] utilized oligonucleotide microarrays to detect mutations in the gyrA gene of three pathogenic bacteria.

Numerous diseases originate from genetic factors, and conventional molecular biology techniques often fall short in elucidating the interactions and sequential information among multiple genes during biological processes. Gene chip technology emerges as a remedy to these limitations, offering early and precise diagnosis and treatment for certain diseases, particularly in identifying highly pathogenic genes. Heller et al. [19] explored the tissue genes of enteropathic rheumatoid arthritis utilizing gene chip technology, pinpointing IL-3, Gro-A, and other pertinent genes through the analysis of differentially expressed genes. Wang et al. [20] employed gene chip technology to sift through genes associated with drug resistance in tumor cells. Furthermore, Yao et al. [21] leveraged gene chip technology to scrutinize gene expression in breast cancer, unveiling two novel carcinogenic genes: H2AFJ and EPS8.

In light of the primary pathogens of bovine respiratory system diseases, prevalent drug resistance genes, and common mutation sites in fluoroquinolone drugs, this study meticulously crafted a gene chip, embodying a pivotal advancement in the realm of veterinary medicine, especially concerning BRD. This innovation is not merely a diagnostic tool but a comprehensive system that facilitates systematic, swift, and high-throughput detection, thereby significantly enhancing the identification of major pathogens and the screening of sensitive drugs for BRD. The precision and accuracy in detection, underscored by the chip’s ability to target specific genes, ensure that the identification is not only rapid but also highly accurate, minimizing the risk of false positives and negatives, which is paramount for effective disease management. Furthermore, the high-throughput capabilities of the gene chip enable it to process and analyze multiple samples simultaneously, which is vital for managing BRD on a larger scale, such as in farming industries, where timely detection and management can prevent widespread outbreaks and minimize economic losses. The rapid detection offered by the gene chip is a pivotal advancement, providing timely intervention that can save lives and resources, while its enhanced drug screening functionality ensures that the management of BRD is not only reactive but also proactive, thereby providing a comprehensive solution to managing the disease. Moreover, the gene chip has practical applicability and can be seamlessly integrated into real-world scenarios, such as veterinary clinics and farms, ensuring that the benefits of the technology extend to where it is most needed. The development of the gene chip also paves the way for further research and development, providing a foundational technology that can be adapted and evolved to manage other diseases and conditions, thereby contributing not only to the immediate field but also providing a springboard for future advancements in veterinary medicine and beyond.

2 Materials and methods

2.1 Strains and clinical samples

Isolates A, B, D, E, and F types of P. multocida (Pm), M. haemolytica (Mh), M. bovis, Streptococcus spp., APP, and Haemophilus parasuis from cows were identified and preserved in our laboratory. From a cattle farm in Jilin Province, China, a total of 97 nasal swabs were gathered from BRD suspected clinical cases.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals.

2.2 Selection of target genes

Currently, P. multocida, M. bovis, and M. haemolytica are recognized as the predominant pathogens of BRDs in China. In recent years, the drug resistance spectrum of these pathogens has progressively expanded. Consequently, this experiment was undertaken, targeting seven drug resistance genes and a range of pathogens commonly associated with BRD for the high-throughput detection chip. These pathogens include bovine podococcal A, B, D, E, and F type Pm, bovine M. bovis, bovine Mh, porcine M. pneumoniae, Streptococcus, Haemophilus parvum, and bronchial septic bacillus.

2.3 Primer and probe design

Conserved regions across 81 antibiotic resistance genes and 13 pathogenic bacterial species were identified by selecting their full sequences from the NCBI database. Multiple alignments were executed using BLAST, and specific primers along with TaqMan-MGB probes were crafted for the conserved regions, adhering to the principles of primer and probe design via Premier 5.0 software. The probes were marked with a fluorescent group FAM at the 5ʹ end and a quencher group MGB at the 3ʹ end. The design principles for the probes are as follows:

  1. The first nucleotide at the 5ʹ end of the probe cannot be G.

  2. The probe should be as short as possible, but not less than 13 nucleotides.

  3. The Tm value of the probe should be designed between 65 and 67°C.

  4. The same nucleotide should not repeat more than four times, especially guanine (G).

  5. The probe should contain more cytosine (C) than guanine (G).

After designing the probes, specific primers for the target genes were designed according to the following principles:

  1. The primers should be as close as possible to the probes, but they should not overlap.

  2. The GC content should be maintained between 30 and 80%.

  3. Among the last five nucleotides at the 3ʹ end, the sum of G and C should not exceed 2.

  4. The amplicon size should be between 50 and 150 bp.

The designed specific primers and MGB probes were synthesized and embedded into a solid-phase template by Thermo Fisher Scientific (China) Co., Ltd.

2.4 Vector construction and transformation

The antibiotic resistance gene sequences were ligated to pMD18-T vector and transformed into competent E. coli DH5α cells by heat shock to construct cloning vectors. The pMD18-T vector connection system is shown in Table 1.

Table 1

pMD18-T carrier connection system

Component Amount (μL)
DNA 5
Solution I buffer 4.5
pMD 18-T 0.5
Total 10

2.5 Extraction of recombinant plasmids

About 1.5–5 mL of overnight culture was collected in an EP tube, centrifuged at 8,000×g for 2 min, and the supernatant was completely removed. Plasmid extraction was performed according to the instructions of the plasmid extraction kit from Beijing Saibaisheng Gene Technology Co., Ltd. The obtained plasmid DNA was stored at −20°C for future use.

2.6 Preparation of standard solutions

The concentration of the extracted plasmid DNA was determined using a UV spectrophotometer, and the purity of the plasmid DNA was assessed by the OD260/OD280 ratio. If the ratio was between 1.6 and 1.8, the purity of the extracted plasmid was considered satisfactory for the construction of a standard curve. The copy number of the plasmid was calculated using the formula: Plasmid copy number (copies/μL) = OD value (ng/μL) × (6.02 × 1023) × 10–9/(plasmid DNA base pairs × 660). The plasmid was diluted ten-fold with Elution Buffer and stored at −80°C.

2.7 Optimization of TaqMan MGB fluorescent quantitative PCR reaction conditions

The optimization of the TaqMan MGB fluorescent quantitative PCR system aimed to reduce non-specific hybridization during the experiment. In this study, 91 constructed plasmid standards were used as templates to optimize the reaction conditions. The annealing temperature was gradually increased from 55 to 60°C in steps of 1°C, and PCR amplification was performed. The obtained Ct values and curve shapes were analyzed to select the optimal reaction system and conditions based on the recommended conditions of Thermo Fisher Scientific (China) Co., Ltd.

2.8 Construction of standard curves

Using the optimized PCR system and conditions, plasmid standards with concentrations of 1 × 1010 copies/μL, 1 × 108 copies/μL, 1 × 106 copies/μL, 1 × 104 copies/μL, and 1 × 102 copies/μL were used as templates for fluorescent quantitative PCR. Each group was tested in triplicate to construct the standard curves, and data analysis was performed based on the curve.

2.9 Specificity of detection for antibiotic resistance genes and pathogens

Plasmid standards of M. bovis, Streptococcus spp., and APP were successfully constructed and adjusted to a concentration of approximately 1 × 108 copies/μL. Plasmid standards of M. bovis and P. multocida were used as positive controls to assess the specificity of the TaqMan MGB fluorescent quantitative PCR detection chip.

2.10 Sensitivity of detection for antibiotic resistance genes and pathogens

The constructed plasmid standards were diluted ten-fold to a concentration ranging from 1.0 × 101 to 1.0 × 1010 copies/μL. TaqMan MGB fluorescent quantitative PCR reactions were performed to determine the lowest detectable concentration of the plasmid standards by the chip.

2.11 Reproducibility of detection for antibiotic resistance genes and pathogens

Plasmid standards of P. multocida A type and M. haemolytica with concentrations ranging from 1.0 × 104 to 1.0 × 108 copies/μL were selected as templates for inter-batch and intra-batch reproducibility tests. The average Ct (MN), standard deviation (SD), and coefficient of variation (CV) were calculated based on the obtained Ct values. The calculation formula for the CV was CV% = SD/MN × 100%.

2.12 Clinical sample detection

To evaluate the clinical applicability of the high-throughput detection chip established in this study, 97 bovine nasal swab samples collected from a cattle farm in Jilin Province were tested. The collected samples were evenly spread on LB solid medium containing ampicillin in a biosafety cabinet. The plates were incubated overnight at 37°C, and suspected positive colonies were picked and transferred to LB liquid medium containing ampicillin. The liquid cultures were shaken at 37°C for 6–12 h. Then, 1 mL of bacterial suspension was used as the template for clinical detection.

3 Results

3.1 Synthesis of primers and probes

In this study, based on the gene sequences provided in the NCBI database, we designed and synthesized 81 specific primers and probes for seven classes of drug-resistant genes and 13 probes and primers for seven common pathogen species associated with bovine respiratory system diseases, following the principles of probe and primer design (Table 2).

Table 2

Primers and probe sequences for TaqMan MGB fluorescence quantitative PCR amplification

Assay name Primer sequence Probe sequence
F R
aacA/aphD AGAGCCTTGGGAAGATGAAGTTTTT CTATCTCATCAGTTTTTGGATAATGATAATCAGTATATAACTC CCATATCCAATAGGAACATTG
aph(2ʹ)-Id-01 GACAGAACAATCAATCTCTATGGAATGT GAGCAGTATCATAAGTTGAGTGAAAAGG ACGTCGCTTCATCATATG G
aph(2ʹ)-Id-02 CCTCTTCATACCAATCCATATAACCATATTCC AAGGATATACCGACAGTTTTGGAAAA TCGAACGACCAGTATTTT
aac(6ʹ)-Iy GGAGAACAAAAATACCTTCAAGGAAAGC CCGCCACGATTATGTCAATGG ACGGGCGAACTGTCAC
aac(6ʹ)I1 CGGATTAAGGCCGATGTACGAT GCCTTGATATTCAGTTTTTATAACCATGGG AAGACCTGGGAACTTC
aacC1 GCAAGTTCCCGAGGTAATCG GGTCGTGAGTTCGGAGACGTA CCACCTACTCCCAACATC
aadA-01 CTCGAAGATACCTGCAAGAATGTCA TTATCCAGCTAAGCGCGAACT CCATTCTCCAAATTGC
aadA1 GCTCGAAGATACCTGCAAGAATGT GCGCGAACTGCAATTTGGA CATTGCGCTGCCATTC
aadA-1-01 CTTTCACAAAGATGTTGCTGTCTCC GCCCGAAGAGGAACTTGTCT TTCCCACGGCGACCTG
aadA2-01 CGGCTCCGCAGTGGAT GCCACAGTAACCAACAAATCA ATATCGCTGTATGGCTTCAG
aadA5-01 CTGCGGATGGGCCTAGAAG TCACGATCTTGCGATTTTGCT AAGGCGAGGCAACACA
aadA5-02 AGGCAAACGCTCCGATACC ACTGGTCTCATTGCTCCTAAGGA CATGCGGCAGCAACG
aadA9-01 CGCGGCAAGCCTATCTTG CCAATGAACGCCGAAGTCTCA CTGCACGCAAAGCAA
aadD AGCGCTCGTCGTATAACAGATG CCTTGACTGTACAGGTAGCAATGG ATGCAGACCAATCAAC
aadE GGAACTATGTCCCTTTTAATTCTACAATCT TGCCCTTGGAAGAGTTAGATAATTACCT AAAGGGCGATAAATTAAT
aph CCAAGCTGTTTCCACTGTTTTTCTG CAGCAAGTGGATCATGTTAAAATAATTGTGT ATGCGCCCAATGGTT
aph6ia CCCATCCCATGTGTAAGGAAATT CACCGCTTCTGCTGTACGA TCGTCGGACCACATCCA
aphA1(aka kanR) ACCATGAGTGACGACTGAATCC TGAACAAGTCTGGAAAGAAATGCA AAGCTTTTGCCATTCTC
aphA3-01 CTTTCACAAAGATGTTGCTGTCTCC GCCCGAAGAGGAACTTGTCT TTCCCACGGCGACCTG
aphA3-02 TCCCACCAGCTTATATACCTTAGCA CGGAATTGAAAAAACTGATCGAAAAAT ACCGCTGCGTAAAAG
sul2 CCGCAATGTGATCCATGATGTC CCAAACTCGTCGTTATGCATTCG CCTCGCGCCGATCTG
strA GCTTAAAATGAGAGATAGACCGGAACA GTAAGTCCGAGAACATGCTTTCC CCGGTGCAAGACCAT
strB CGGTCGTGAGAACAATCTGATGT GGCAACGATGTGAGAGAGCAT TCGCTCCCCGGCATAT
dfrA1 GCCCTGATATTCCATGGAGTGC CGTCCAACCAACAGCCATTG CAGGAGCTGTTCACCTTT
dfrA12 GCGACAGCGTTGAAACAACTAC CGAACCGTCACACATTGGTAATCT CACGCCAAGCTAACTAC
folA CCCAGTCATCCGGTTCATAATCC GCAGAAGCTTTATCTGACGCATATT ATCGCCTTCGACTTCC
tet(34) CTTAGCGCAAACAGCAATCAGTT GGTGATACAGCGCGTAAACTAC TCGCTTTCGGGTACATTT
tet(35) CAACCCACACTGGCTACCA GTACCTGTAGAGAACGCCATTAGG CCAGACAGCAAGAACA
tet(36)-01 TCAGCAGAGGTCAGTTCCTACA TGGTAGGTCGATAACCCGAAAATC ACGCCCAAGCCTTGTG
tet(36)-02 CAGGAAAGACCTCCATTACAGAGAA TTTGTCCACACTTCCACGTACTATG CTCCACTCGCAAATAG
tet(37) GAGAACGTTGAAAAGGTGGTGAAC ACCAAGCCTGGATCAGTCTC ATGATCGTATGTCGAAATAT
tet(38) GCCTGGGAAATTTAATGCTTTAAAATCGA TGGCGGTATCTGTAGGTATTGC TAGAGCCGCAGCAATC
tetA-02 CACGTTGTTATAGAAGCCGCA CAGCCTGACCTCGATCGT TCCTCTTCACGGCGATCTA
tetB-01 GCCCCAGTAGCTCCTGTGA GTGCGCTTTGGATGCTGTATT CCCTGAAAGCAAACGGCCTA
tetB-02 TGAAAGCAAACGGCCTAAATACAG CGCATCGCTGGATTACTTATTGC TCCAAAGCGCACTTGAA
tetE TTGGCGCTGTATGCAATGATG CGACGACCTATGCGATCTGA TTTGCCCCTCTTCTCGGC
tetG-01 TGCCCGCCCCATAACAG GAAGGTTCTCGCGCACG CCATGTAGCCGAACCAG
tetG-02 CAATGGTTGAGGCTGCTACAG CGGTCTTATGGGTGCTCTATATCG CCGTGACGCCGGACAC
tetH GCGCATTATCATCGACAGATTTTGA GCTTAGCGGCAGGAGGTAT ATGCGGGTTGCCCC
tetL-02 TCCCATGGCTACTATCGATCCAATA GTAGTTGCGCGCTATATTCCAAAG ATGCTTTACCCCTATTTTC
tetK CAGCAGTCATTGGAAAATTATCTGATT CAAAATAAAAAAGTGATTGTGACCAATAAAAGCA CCAAGACAGCTCAAACTA
tetL-01 CGCAACGACAACCATCACA GCCCGATTTATTCAAGGAATTGGT CCGCATTCCCAGCTCT
tetM-01 CGCCATCTTTTGCAGAAATCAGTAG CAGGACATATGGATTTCTTAGCAGAAGT TTGCCCCATCTAAAACT
tetM-02 CCGTCCTCGTTGTACCTTTGTC AGAAAGCTTATTATATAACAGTGGAGCGATT ACGCTTCCTAATTCTG
tetO-01 CTCAAGGATGGCACAAATGACTTC TGTGGATACTACAACGCATGAGATT CATCTGCACATTCCC
tetO-02 TGTCCTTGTTGTGCCTTCATCT GAAAGTTTATTGTATACCAGTGGTGCAA ACGCTCCCTAGTTCTGC
tetPA TGCTACAAGTACGAAAACAAAACTAGAAA AGTTGCAGATGTGTATAGTCGTAAAC CAGGAGTGGGATTTAT
tetPB-02 TGATACACCTGGACACGCT CGTCCAAAACGCGGAATGATC CTCCACTTCAGCGATAAAA
tetPB-03 GGCGACAGTAGGCTTAGAAATAGAA GACCCTACTGAAACATTAGAAATATACCT ACCTTCGCCTCTCCC
tetPB-04 GGTGCAAATACTGAAAAAGTTGTAAAGCA TTGTTCCTTCGTTTTGGACAGAAT CAAATGAAGCATTCCCC
tetPB-05 TGAAGTGGAGCGATCATTCCG CCCTCAACGGCAGAAATAACTAAA ATCGCACCGTCCAAAAC
tetQ GGCTTAGGCGTTTTTATGGTCAAG TGCGGATATTATCAGAATAATCGCCTTT CCATGCGGGTATCAAA
tetR-01 ATGAGTTCGGCCAGAATTTCCT GGTTGTGCGCGAAATGATTT TCGGCGACCACGCGAC
tetR-02 CTTTTCGCCAATCCATCGACAA CGGACGCAGCGTTCGA TCACCGCGAGTCCCT
tetR-03 CGCGATGGAGCAAAAGTACATTTAG GCTAATTGATTTTCGAGAGTTTCATACTGT ACACGGCCTACAGAAAA
tetS AGGACAAACTTTCTGACGACATCAT TCTCCCATTGTTCTGGTTCAGTATAATCTA AAGCAGACTGTGAATCTA
tetT CCATATAGAGGTTCCACCAAATCCT GACCCTATTGGTAGTGGTTCTATTGA CAGTCCAATAGATGCCC
tetU-01 GTGGCAAAGCAACGGATTGG TGCGGGCTTGCAAAACTATCT AAGCTTTCCTGAACCATCG
tetW-01 AGCTTATCCCGAACAGACTGAAC CATTCCCACCGTTATCTTTATCAACAAG ACGCTCTGCAAATCA
tetU-02 GGGTTAAGTGTGCAAGGTACGA CAGTTTTCCGACAATTGTAATTCGATCA CACCCCCCTAAAATT
tetV CTCACGACCATGATGCTGATGT CGACGATGTATATCCCACGATCAC TCGGCTCGATTCCCCT
tetX CATAGCTGAAAAAATCCAGGACAGTT CACGGAAGTTGAAGAAACAGGTACT CTGGTTGATGAATATCG
TETX4 CAGAAATGACTTAAGGGCTATCTTGTTGA ACTTCTTCTTACCAGGTTCAAGCAT ACGACACGGTTATTTG
TETX3 GGTGTAAATATTGTTGATGAAAAGGGCAA TTCTGTTTATTTCAGGATTGTCAAAACGATTT TCGGGCCTTACATTTT
kmt1 ACCGGCAAATAACAATAAGCTGAGT AGCCAATCTGCTTCCTTGACA ACGGCGCAACTGATTG
PASTEURELLA-2 TGCCAAAACTTCTTAACATTACACCATCT TGTTGATGGACGTTGTAAAGACTGA ACGGAGTACCAATTTT
PASTEURELLA-3 TCATAGAATGATTAAATACTATGGTAAAAATAGGATAAATAACTT CATCTACCCACTCAACCATATCAGAA CAATGCGTGAAGATTC
PASTEURELLA-4 TCCCCAACTCAACTTCATGAAATTGT GCGCTAAGCGAGCATGTG CCCAACGATCATTTTC
PASTEURELLA-5 GTACAGCAAAGTATGATTTTGTCTCGAT TCTTCTAATAGTTCTGTAAGATAAGAATGAACCCA ATGGCACCACAACAAT
MBoppd GGGCGAAGATGTAGAATTTGGTTAC TCCGCCGTCAATTACTCTGAAAA CCTTTGGCAAATAATCT
MB16s CTAACAAAAACGCTTTTAATAATTTTCTTTCGGAA TCTATGTCGTAAGTATTTAATCTTGCATAACGG ACGAGATCAAAATTTG
MCATTCE CGGTGAAGCCTTTGACAAAACAG TCGGCTAATTTTGACATCGCTACA TCGGTTTGGATTACCC
MHY-GENE CCTTTAAGACTGGGATAACTATTGGAAACA GAAGCTGTGAAGCTCCTTTCTATTAC CATCATGCGATAAATAAC
HPARA TGGCTTAGATGATTGGGACAAATGT AGCCCCTGGCACTGC AACGCAGGATAGCTTG
STREPTOCOCCUS CGAAGAAGAACACCAACGTTGTC CTGGTGTTGAAATGTTCCGTAAACA CCCTGCAAGACCTTC
ABRAC CGCACATTTCCGAACTTCACTTTT GATTTCCTTTGTTGCCTGGATTACG TCCGTCGCAAACCT
ERMB ACACTCAAGTCTCGATTCAGCAATT GGCGGGTAAGTTTTATTAAGACACTGT CCAGCGGAATGCTTT
CATB GGTCAGACGTTCCATTGCATCA GGTGGCATTGATCTGATCGAACA CCTTGCGCCATTAAC
QNRA GCGCGATGCCAGTTTCAAG GTTGGCACCGCTGAAGTTG CTGCCGTCTGTCTTTG
ACRA GCGAAAGCTGCCGTTGAA CGGAGAGGTAACTTTGGTGTAAGC ACTGCGCGAATCAA
ACRB CGGCGGCGGTTCTG CGTTTAAATGCCCACTTGACTTTTG TTGCTTGGCTTCTTCC
FLOR TGGGAGCAGCTTGGTCTTC CCACTGCTTGAAGTAGACGGAAAG CTGCACCGGCCTTTGT
FEXA TCTGTTGTAGCTTTGGTGGGATTT GTTATTGAACAGGACAGGTGGTACA ACCGCAGAAAATCCAT
OPTRA CGTAGTATGGGTTTTACTGAAGCAGAT TCATCAAGTAATAGAATGTCTGGCTTTGTT CCACCTGAAAATTC
CFR-1 GTTCCTCACTATAAGGTGAGTGTAATGA CTCGTAGACTTTCTATATCAACGATTGGTATT AACCCAGGAATATCC
tetJ GGGTGCCGCATTAGATTACCTATT CGTCCAATGTAGAGCATCCATAAT ATGGCTTGCCCCACCTC

After the sequence design of primers and probes was completed, 91 probes and primers were mosaicked into the solid-phase template to construct the high-throughput detection chip designed for this experiment, and the results of the layout plate are shown in Figure 1.

Figure 1 High-throughput detection chip layout board.
Figure 1

High-throughput detection chip layout board.

3.2 Establishment of TaqMan MGB fluorescence quantitative PCR reaction conditions

In this experiment, the optimized reaction conditions were established using a panel of 91 constructed plasmid standards as templates. The reaction system was set at 25 μL to obtain a strong signal for selecting the best reaction system and conditions (Table 3, Figure 2). The final selected optimal reaction conditions were as follows: pre-denaturation at 95℃ for 20 s, denaturation at 95℃ for 3 s, annealing and extension at 60℃ for 30 s, with a total of 40 cycles. The optimal reaction system is shown in Tables 1–5.

Table 3

Optimum reaction system and conditions

Reagent Volume (μL)
2 × Taq ManTMFast Advanced Master Mix 12.5
DNA template 1
ddH2O 11.5
Total 25
Figure 2 Optimal reaction conditions for TaqMan MGB fluorescence quantitative PCR.
Figure 2

Optimal reaction conditions for TaqMan MGB fluorescence quantitative PCR.

Table 4

Repeatability experiment

DNA Copies Ct value Mean Ct SD CV (%)
108 16.78 16.88 16.71 16.76 0.08 0.48
107 19.62 19.65 19.66 19.64 0.06 0.31
Pm A 106 22.98 22.92 22.94 22.95 0.07 0.34
105 26.45 26.48 26.44 26.47 0.07 0.24
104 29.33 29.36 29.38 29.34 0.05 0.17
Table 5

Repeatability experiment

DNA Copies Ct value Mean Ct SD CV (%)
108 18.33 18.34 18.36 18.33 0.06 0.46
107 19.78 19.73 19.77 19.72 0.04 0.37
Mh 106 23.55 23.56 23.58 23.53 0.05 0.32
105 27.68 27.69 27.63 27.64 0.07 0.51
104 31.34 31.35 31.37 31.34 0.08 0.43

3.3 Drawing standard curves

Using plasmid standards with known copy numbers at concentrations of 1 × 1010 copies/μL, 1 × 108 copies/μL, 1 × 106 copies/μL, 1 × 104 copies/μL, and 1 × 102 copies/μL as templates, amplification was performed under the optimized reaction conditions. The standard curves were plotted under conditions where the Ct values were stable.

The curve morphology was analyzed, and the correlation coefficients (R 2) of the standard curves were between 0.99 and 1. The amplification efficiency ranged from 90 to 110%. This indicates that within the concentration range of 102–1010 copies/μL, there is a good linear relationship between the logarithm of plasmid concentration and Ct value, and the amplification efficiency is high. Some of the standard curves are shown in Figure 3.

Figure 3 Standard curve of high throughput detection chip AAC6I1, AAC6.
Figure 3

Standard curve of high throughput detection chip AAC6I1, AAC6.

3.4 Specific detection

The results of this experiment showed that only the plasmid DNA of M. bovis and Pm in cattle exhibited positive curves, while the remaining pathogenic bacteria showed no amplification curves. This indicates that the high-throughput detection chip that was established has good specificity. Refer to Figure 4 for details.

Figure 4 Specific detection of Taq Man MGB fluorescence quantitative PCR.
Figure 4

Specific detection of Taq Man MGB fluorescence quantitative PCR.

3.5 Sensitivity detection

The constructed plasmid standard was diluted in a ten-fold gradient using Elution Buffer. From the detection results, it can be observed that the template with a concentration of 1 × 1010 copies/μL showed good amplification curves, while the template with a concentration of 1 × 101 copies/μL exhibited minimal amplification, with Ct values above 40. Therefore, the lower detection limit of the high-throughput detection chip established in this experiment is 1 × 101 copies/μL. Refer to Figures 5 and 6 for details.

Figure 5 Sensitivity detection of Taq Man MGB fluorescence quantitative PCR (1 × 1010 copies/μL).
Figure 5

Sensitivity detection of Taq Man MGB fluorescence quantitative PCR (1 × 1010 copies/μL).

Figure 6 Sensitivity test of Taq Man MGB fluorescence quantitative PCR (1 × 101 copies/μL).
Figure 6

Sensitivity test of Taq Man MGB fluorescence quantitative PCR (1 × 101 copies/μL).

3.6 Reproducibility testing

Reproducibility experiments were conducted using ten-fold gradient diluted plasmid DNA from bovine Podoviridae Pm and bovine Myoviridae Mh as templates. The experiments were performed three times to evaluate inter-batch and intra-batch reproducibility under the optimized reaction conditions. The results are presented in Tables 4 and 5. According to Tables 4 and 5, the CV% values for the Pm A group ranged from 0.17 to 0.49%, and for the Mh group, the CV% values ranged from 0.31 to 0.5%. All CV% values were below 0.5%, indicating good reproducibility of the constructed high-throughput detection chip.

3.7 Clinical sample testing results

Among the 97 throat swab samples collected from the cattle farm, 29 samples were detected as positive, which was consistent with the antimicrobial susceptibility test results from our laboratory. Among these positive samples, 11 samples showed resistance to aminoglycoside drugs, 9 samples showed resistance to sulfonamide drugs, 5 samples showed resistance to chloramphenicol drugs, and 4 samples showed resistance to tetracycline drugs. Additionally, two pathogenic bacteria, bovine Podoviridae Pm and bovine M. bovis, were detected. Refer to Figure 7 for more details.

Figure 7 TaqMGB fluorescence quantitative PCR detected 29 clinical positive samples.
Figure 7

TaqMGB fluorescence quantitative PCR detected 29 clinical positive samples.

4 Discussions

BRD has been a persistent and pervasive challenge in the cattle industry, with its tentacles reaching both local and global scales, substantiated by a myriad of studies and surveys. A striking revelation from a survey conducted by Zhao et al. [22] underscores the severity of the situation in China, where the infection rate in beef cattle farms soars to over 90%, and the mortality rate is staggeringly high at 35%. This not only poses a substantial threat to the livelihoods of farmers but also casts a shadow over the sustainable development of the entire cattle industry. In the context of China, BRD predominantly manifests as a mixed infection, notably involving bovine M. bovis and bovine capsular type A Pm, presenting a unique challenge in understanding and managing the disease in this region.

Internationally, the scenario is equally concerning. Research from Belgium and the United Kingdom [23–25] has not only highlighted the prevalence of BRD but also brought to light the isolation rates and incidence percentages, which are indicative of the disease’s significant impact in these areas. The current methodologies for diagnosing BRD and testing for drug resistance predominantly hinge on conventional methods. These traditional approaches, while reliable, are inherently time-consuming and labor-intensive, thereby inhibiting their efficacy in providing swift and effective clinical interventions.

In this study, a novel approach was adopted, developing a TaqMan MGB fluorescence quantitative detection method. This method, which involved the crafting of specific probes and primers for the primary pathogen and 81 related drug resistance genes of BRD, demonstrated a promising sensitivity of 1 × 101 copies/μL and a SD of less than 0.5%. This method not only showcased superior specificity and repeatability but also outperformed the multiplex PCR method for detecting BRD, established by Jeon et al. [26], in terms of sensitivity. When applied to clinical samples, this method identified a positivity rate of 30% from 97 nasal swab samples, surpassing conventional detection methods in both speed and efficacy by providing results within 1 h. This marks a substantial advancement compared to previous gene chip technology [27] and other methods like the multiplex PCR method [28–30], which necessitated considerably longer durations to yield results.

Simultaneously, this study engineered and synthesized nine specific primers and MGB probes, targeting bovine capsule type A Pm and bovine M. bovis QRDR mutation sites. The quantitative analysis of the chip revealed that both the standard curve and amplification efficiency met satisfactory levels. The method’s specificity was rigorously tested, demonstrating robust specificity as only the positive samples produced an amplification curve. Further verification confirmed the minimum detection limit of plasmid DNA to be 1 × 104 copies/μL. The method exhibited stability, evidenced by the in-batch and inter-batch CV values being below 2%. In clinical sample detection experiments, the chip showcased its advantageous attributes, enabling the rapid, efficient, and accurate detection of QRDR target mutations, with its genotype aligning consistently with the drug resistance phenotype.

5 Conclusions

In the pursuit of advancing the management and control of BRD, this study introduced a pioneering detection chip, leveraging TaqMan MGB probes and focusing on the sequences of major BRD pathogens and drug resistance genes. While the chip exhibits promising capabilities, particularly in conducting drug resistance profiling of clinical strains and potential future applications in pathogen identification, it is imperative to acknowledge its limitations and envision future research trajectories.

A palpable limitation of the current study revolves around the production cost of the developed chip, which stands as a substantial barrier to its widespread clinical application. This economic constraint necessitates a meticulous exploration into alternative manufacturing processes and materials that could potentially mitigate costs without sacrificing the chip’s efficacy and reliability. Moreover, while the chip is grounded in the sequences of predominant BRD pathogens and drug resistance genes, it is crucial to consider the dynamic nature of microbial genomes and resistance mechanisms, which may necessitate ongoing updates and validations to ensure its sustained relevance and accuracy in detection.

Peering into the future, the chip could indeed serve as a foundational tool in fortifying the management of BRD across cattle farms, transcending its current applications and morphing into a pivotal asset in BRD prevention and control. Future research could delve into enhancing the chip’s accessibility and applicability, ensuring it can be seamlessly integrated into various operational scales and contexts within the cattle farming industry. Furthermore, forging collaborations with diverse stakeholders, spanning cattle farmers, veterinary professionals, and policymakers, could unearth invaluable insights into the chip’s practical applications and potential challenges in broader implementation. Such collaborations could also facilitate the co-creation of strategies to navigate these challenges, ensuring that the chip is not only a scientific innovation but also a practical, real-world solution to managing BRD.

In essence, while the developed chip marks a significant stride toward more efficient and precise management of BRD, it is the amalgamation of ongoing scientific innovation, practical adaptability, and collaborative efforts that will truly propel its impact in the field, fostering a future where BRD can be effectively diagnosed, managed, and potentially mitigated across the global cattle farming landscape.

Acknowledgments

This project is supported by Jilin Province Science and Technology Development Plan Project (20220202060NC; YDZJ202203CGZH050).

  1. Funding information: Authors state no funding involved.

  2. Author contributions: Q.J.: manuscript writing, methodology, analysis, and validation; L.P.: data collection, data curation, and analysis; Y.Y.: data curation, analysis, and draft editing; L.G.: study conceptualization, supervision, reviewing, manuscript writing, and revising; K.L.: study conceptualization, supervision, reviewing, manuscript writing, revising, and editing.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Lin L, Lai Z, Yang H, Zhang J, Qi W, Xie F, et al. Genome-centric investigation of bile acid metabolizing microbiota of dairy cows and associated diet-induced functional implications. ISME J. 2023;17(1):172–84.10.1038/s41396-022-01333-5Suche in Google Scholar PubMed PubMed Central

[2] Sáfár J, Hejel P, Vass-Bognár B, Kiss L, Seregi B, Könyves L. The impact of environmental factors on bovine respiratory disease complex in dairy calves – a review. Acta Vet Brno. 2023;92(3):213–31.10.2754/avb202392030213Suche in Google Scholar

[3] Klima CL, Holman DB, Ralston BJ, Stanford K, Zaheer R, Alexander TW, et al. Lower respiratory tract microbiome and resistome of bovine respiratory disease mortalities. Microb Ecol. 2019;78:446–56.10.1007/s00248-019-01361-3Suche in Google Scholar PubMed

[4] Gagea MI, Bateman KG, Van Dreumel T, McEwen BJ, Carman S, Archambault M, et al. Diseases and pathogens associated with mortality in Ontario beef feedlots. J Vet Diagn Invest. 2006;18(1):18–28.10.1177/104063870601800104Suche in Google Scholar PubMed

[5] Hotchkiss EJ, Dagleish MP, Willoughby K, McKendrick IJ, Finlayson J, Zadoks RN, et al. Prevalence of Pasteurella multocida and other respiratory pathogens in the nasal tract of Scottish calves. Vet Rec. 2010;167(15):555–60.10.1136/vr.c4827Suche in Google Scholar PubMed

[6] Pardon B, De Bleecker K, Dewulf J, Callens J, Boyen F, Catry B, et al. Prevalence of respiratory pathogens in diseased, non-vaccinated, routinely medicated veal calves. Vet Rec. 2011;169(11):278.10.1136/vr.d4406Suche in Google Scholar PubMed

[7] Xiao GW, Peng QJ, Cui P. Bacteriological study of Mycoplasma bovis pneumonia infection in beef cattle. Chin. J Anim Sci. 2012;38(3):22–6.Suche in Google Scholar

[8] Caruso JP, Ross RF. Effects of Mycoplasma hyopneumoniae and Actinobacillus (Haemophilus) pleuropneumoniae infections on alveolar macrophage functions in swine. Am J Vet Res. 1990;51(2):227–31.10.2460/ajvr.1990.51.02.227Suche in Google Scholar

[9] Marois C, Gottschalk M, Morvan H, Fablet C, Madec F, Kobisch M. Experimental infection of SPF pigs with Actinobacillus pleuropneumoniae serotype 9 alone or in association with Mycoplasma hyopneumoniae. Vet Microbiol. 2009;135(3):283–91.10.1016/j.vetmic.2008.09.061Suche in Google Scholar PubMed

[10] Wang Y, Su L, Morin MD, Jones BT, Whitby LR, Surakattula MM, et al. TLR4/MD-2 activation by a synthetic agonist with no similarity to LPS. Proc Natl Acad Sci USA. 2016;113(7):E884–93.10.1073/pnas.1525639113Suche in Google Scholar PubMed PubMed Central

[11] Hildebrand D, Heeg K, Kubatzky KF. Pasteurella multocida toxin manipulates T cell differentiation. Front Microbiol. 2015;6:1273.10.3389/fmicb.2015.01273Suche in Google Scholar PubMed PubMed Central

[12] St MF, Li J, Cox AD. Structural analysis of the core oligosaccharide from Pasteurella multocida strain X73. Carbohydr Res. 2005;340(6):1253–7.10.1016/j.carres.2005.02.014Suche in Google Scholar PubMed

[13] Keramas G, Bang DD, Lund M, Madsen M, Rasmussen SE, Bunkenborg H, et al. Development of a sensitive DNA microarray suitable for rapid detection of Campylobacter spp. Mol Cell Probes. 2003;17(4):187–96.10.1016/S0890-8508(03)00052-5Suche in Google Scholar

[14] Sun B, Yan CX, Zhang TT. Research progress on the application of gene chip technology in plant gene cloning. Genomics Appl Biol. 2009;28(1):153–8.Suche in Google Scholar

[15] Anthony RM, Brown TJ, French GL. Rapid diagnosis of bacteremia by universal amplification of 23S ribosomal DNA followed by hybridization to an oligonucleotide array. J Clin Microbiol. 2000;38(2):781–8.10.1128/JCM.38.2.781-788.2000Suche in Google Scholar PubMed PubMed Central

[16] El-Sayed A, Kamel M. Advanced applications of nanotechnology in veterinary medicine. Environ Sci Pollut Res. 2020;27:19073–86.10.1007/s11356-018-3913-ySuche in Google Scholar PubMed

[17] Zhai JH, Guo ZB. Detection of common clinical infectious bacteria using 16S rDNA gene chip. J Clin Lab Sci. 2002;20(3):133–7.Suche in Google Scholar

[18] Aslam HMU, Riaz H, Killiny N, Zhou XG, Thomashow LS, Peters NT, et al. Microarray technology for detection of plant diseases. In: Haq IUl, Ijaz S, editors. Trends in plant disease assessment. Singapore: Springer; 2022. 10.1007/978-981-19-5896-0_11.Suche in Google Scholar

[19] Heller RA, Schena M, Chai A, Shalon D, Bedilion T, Gilmore J, et al. Discovery and analysis of inflammatory disease-related genes using cDNA microarrays. Proc Natl Acad Sci USA. 1997;94(6):2150–5.10.1073/pnas.94.6.2150Suche in Google Scholar PubMed PubMed Central

[20] Wang W, Cassidy J, O’Brien V, Ryan KM, Collie-Duguid E. Mechanistic and predictive profiling of 5-fluorouracil resistance in human cancer cells. Cancer Res. 2004;64(22):8167–76.10.1158/0008-5472.CAN-04-0970Suche in Google Scholar PubMed

[21] Yao J, Weremowicz S, Feng B, Gentleman RC, Marks JR, Gelman R. Combined cDNA array comparative genomic hybridization and serial analysis of gene expression analysis of breast tumor progression. Cancer Res. 2006;66(8):4065–78.10.1158/0008-5472.CAN-05-4083Suche in Google Scholar PubMed

[22] Zhao W, Choi CY, Li G, Li H, Shi Z. Pre-weaned dairy calf management practices, morbidity and mortality of bovine respiratory disease and diarrhea in China. Livest Sci. 2021;251:104608.10.1016/j.livsci.2021.104608Suche in Google Scholar

[23] Pardon B, Callens J, Maris J, Allais L, Van Praet W, Deprez P, et al. Pathogen-specific risk factors in acute outbreaks of respiratory disease in calves. J Dairy Sci. 2020;103(3):2556–66.10.3168/jds.2019-17486Suche in Google Scholar PubMed PubMed Central

[24] Crosby S, Credille B, Giguère S, Berghaus R. Comparative efficacy of enrofloxacin to that of tulathromycin for the control of bovine respiratory disease and prevalence of antimicrobial resistance in Mannheimia haemolytica in calves at high risk of developing bovine respiratory disease. J Anim Sci. 2018;96(4):1259–67.10.1093/jas/sky054Suche in Google Scholar PubMed PubMed Central

[25] Dorso L, Rouault M, Barbotin C, Chartier C, Assié S. Infectious bovine respiratory diseases in adult cattle: an extensive necropsic and etiological study. Animals. 2021;11(8):2280.10.3390/ani11082280Suche in Google Scholar PubMed PubMed Central

[26] Jeon GT, Kim HR, Shin YK, Kwon OK, Kang HE, Kwon OD, et al. An improved duplex real-time quantitative RT-PCR assay with a canine endogenous internal positive control for more sensitive and reliable detection of canine parainfluenza virus 5. Vet Sci. 2023;10(2):142.10.3390/vetsci10020142Suche in Google Scholar PubMed PubMed Central

[27] Jin S, Lee HG, Park C, Kim KY. Small‐organelle‐enriched metagenomics: an improved method for environmental DNA‐based identification of marine plankton. Limnol Oceanogr Methods. 2023;21(4):178–91.10.1002/lom3.10538Suche in Google Scholar

[28] Andrés-Lasheras S, Jelinski M, Zaheer R, McAllister TA. Bovine respiratory disease: conventional to culture-independent approaches to studying antimicrobial resistance in North America. Antibiotics. 2022;11(4):487.10.3390/antibiotics11040487Suche in Google Scholar PubMed PubMed Central

[29] Zhang C. Semi-nested multiplex PCR enhanced method sensitivity of species detection in further-processed meats. Food Control. 2013;31(2):326–30.10.1016/j.foodcont.2012.11.002Suche in Google Scholar

[30] Liu J, Yu X, Wang Y, Han Y, Cao Y, Wang Z, et al. Dispersion characteristics of bioaerosols during treatment of rural solid waste in northwest China. Environ Pollut. 2023;324:121338.10.1016/j.envpol.2023.121338Suche in Google Scholar PubMed

Received: 2023-07-05
Revised: 2023-10-12
Accepted: 2023-10-25
Published Online: 2024-03-26

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
https://doi.org/10.1515/biol-2022-0778
Schlagwörter für diesen Artikel
bovine respiratory disease syndrome; TaqMan MGB fluorescence quantification; QRDR; detection chip
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 24.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0778/html
Button zum nach oben scrollen