Zum Hauptinhalt springen
Artikel Open Access

Identification of KDM4C as a gene conferring drug resistance in multiple myeloma

  • , , und EMAIL logo
Veröffentlicht/Copyright: 12. April 2024

Abstract

Bortezomib (BTZ), a proteasome inhibitor, is a promising therapeutic option for multiple myeloma (MM) patients. However, drug resistance often occurs, leading to disease relapse and poor prognosis. In this study, we aimed to identify novel genes associated with drug resistance and investigate their roles in BTZ resistance. Through the screening of 26 genes frequently associated with chemosensitivity or drug resistance, we discovered that KDM4C, a histone demethylase, exhibited increased expression in BTZ-resistant MM cells compared to their sensitive counterparts. Overexpression of KDM4C enhanced the tolerance of a MM cell line to the drug, whereas the knockdown of KDM4C, using shRNA, increased the sensitivity of resistant cells to BTZ treatment. This suggests that KDM4C plays a pivotal role in conferring BTZ resistance. Our study offers fresh insights into BTZ resistance in MM and highlights KDM4C as a potential target for overcoming drug resistance.

1 Introduction

Multiple myeloma (MM) is a malignant neoplasm of plasma cells, which accounts for approximately 1% of all cancers and 10% of hematological malignancies [1]. Bortezomib (BTZ), a proteasome inhibitor, has revolutionized the treatment of MM by inducing apoptosis and inhibiting cell proliferation [2]. Despite its effectiveness, resistance to BTZ frequently develops, resulting in disease relapse and a poor prognosis [3,4]. Consequently, understanding the mechanisms underlying BTZ resistance is crucial for enhancing therapeutic outcomes.

Several genes have been identified as contributing to the development of BTZ resistance in MM, such as MDR1, BCL-2, and NF-κB [5]. However, identifying novel genes that confer resistance to BTZ is essential for developing effective therapeutic strategies. In this study, we examined a group of 26 genes frequently associated with chemosensitivity or drug resistance, with the goal of identifying novel genes involved in BTZ resistance (Table 1).

Table 1

List of genes analyzed for expression in cell lines. A set of 26 genes, frequently associated with chemosensitivity or drug resistance, was screened to identify novel genes in BTZ resistance

No. Gene Reference*
1 KDM4C doi: 10.1038/s41419-020-03380-2
2 MDR1 doi: 10.1016/j.ejmech.2019.05.027
3 Bax doi: 10.15252/embr.201745235
4 Bcl-2 doi: 10.1016/j.bbcan.2021.188569
5 LC3 doi: 10.1080/01913123.2017.1419328
6 Beclin-1 doi: 10.1002/1878-0261.12641
7 cyclinD doi: 10.1080/14737140.2020.1834385
8 CDK4 doi: 10.1158/1078-0432.CCR-21-2947
9 JAK2 doi: 10.3389/pore.2022.1610273
10 STAT3 doi: 10.1016/j.biopha.2019.109135
11 JAG1 doi: 10.1002/jcb.26469
12 β-catenin doi: 10.1158/2159-8290.CD-19-0074
13 TMEM132A doi: 10.3389/fcell.2020.599890
14 B23 doi: 10.1016/j.imbio.2014.10.015
15 GLUT1 doi: 10.1007/s00210-020-01893-3
16 HIF-1α doi: 10.3390/cancers14246054
17 HK2 doi: 10.1158/0008-5472.CAN-21-1820
18 LDHA doi: 10.1158/0008-5472.CAN-14-3400
19 LDHB doi: 10.3390/genes12050777
20 PDHA1 doi: 10.3389/fcell.2021.738916
21 CKMT1 doi: 10.1080/09553002.2019.1554919
22 GRB7 doi: 10.1186/s12943-021-01476-7
23 PASK doi: 10.18632/aging.102745
24 NF-κB doi: 10.1530/ERC-19-0087
25 p53 doi: 10.1016/j.drup.2019.100671
26 c-Myc doi: 10.1016/j.canlet.2018.11.030

*Selected references linking the gene to drug resistance or chemosensitivity.

Our findings revealed an upregulation of KDM4C in BTZ-resistant MM cells (Figure 1). Additionally, we found that reducing its expression made the cells more sensitive to BTZ treatment. These results suggest that KDM4C, a histone demethylase, may be a promising therapeutic target for combating BTZ resistance in MM.

Figure 1 
               Relative gene expression in cell lines. Compared to KM3, KDM4C, MDR1, Bax, cyclinD, JAK2, B23, GLUT1, LDHA, LDHB, CKMT1A, GRB7, NF-κB, and c-Myc mRNA levels were upregulated and Bcl-2, JAG1, and β-catenin mRNA levels were decreased in the KM3/BTZ.
Figure 1

Relative gene expression in cell lines. Compared to KM3, KDM4C, MDR1, Bax, cyclinD, JAK2, B23, GLUT1, LDHA, LDHB, CKMT1A, GRB7, NF-κB, and c-Myc mRNA levels were upregulated and Bcl-2, JAG1, and β-catenin mRNA levels were decreased in the KM3/BTZ.

This study offers new understanding into the molecular mechanisms behind BTZ resistance in MM and highlights KDM4C as a potential gene related to drug resistance. Further insight into KDM4C’s role in BTZ resistance could guide the development of innovative therapeutic strategies, with the aim of enhancing clinical outcomes for patients with MM.

2 Materials and methods

2.1 Cell culture and transfection

The human MM cell lines KM3 and KM3/BTZ were provided by Qilu Hospital of Shandong University. KM3 cells were cultured in RPMI-1640 medium, supplemented with 10% fetal bovine serum. The cells were maintained at a temperature of 37°C in a 5% CO2 humidified atmosphere. KM3/BTZ cells were established as follows [6]: parent KM3 cells in logarithmic growth phase were subjected to gradient induction with BTZ at concentrations ranging from 5 to 160 ng/mL, then sustained in 5 ng/mL. After 10 months of this treatment, the BTZ-resistant cell line, KM3/BTZ, was successfully established. Lentivirus for overexpression and knockdown of KDM4C (NM_015061) were obtained from Shanghai Genechem Co., Ltd. Cells were plated at a density of 5 × 104 cells/well in 500 μL of complete medium in 24-well plates. The lentivirus was added to the cells at a multiplicity of infection ratio of 1:100. After 12 h, the medium was replaced. The shRNA sequences used for targeting KDM4C were as follows: scramble sequence: TTCTCCGAACGTGTCACGT; sh1: AGGAGTTCCGGGAGTTCAACA; sh2: GCAAGTACTGGAAGAACTTAA.

2.2 Real-time quantitative PCR

Total RNA was isolated from cell lysates utilizing the RNA-easyTM isolation reagent (Nanjing Vazyme BioTech CO., Ltd, R711-01). Complementary DNA was then synthesized from the extracted RNA using the HiscriptII Q RT Supermix for qPCR (Vazyme, R223-01). The mRNA expressions of target genes were quantified using a SYBR green PCR master mix (abm, G891-1). The PCR amplification was carried out on a QuantaStudio5 real‐time PCR system (Applied biosystems by Thermo Fisher Scientific). Each PCR experiment was conducted in triplicate. The relative mRNA levels of target genes were calculated using the 2−ΔΔCt method, with β-ACTIN as the internal control.

Primer sequences were as follows:

KDM4C-F: 5′-CATGGAGTCTAAAGGAGCCCA-3′;

KDM4C-R: 5′-TGTACTGAGTGAACAGTCCTGA-3′;

MDR1-F: 5′-CCCATCATTGCAATAGCAGG-3′;

MDR1-R: 5′-GTTCAAACTTCTGCTCCTGA-3′;

β-ACTIN-F: 5′-CTGGAACGGTGAAGGTGACA-3′;

β-ACTIN-R: 5′-AAGGGACTTCCTGTAACAACGCA-3′.

2.3 Western blotting

Cells were lysed using pierce IP lysis buffer (Thermo scientific, REF: 89900), supplemented with phosphatase inhibitors (MCE, HY-K0021), protease inhibitor (MCE, HY-K0010), and phenylmethanesulfonyl fluoride (MCE, HY-B0296/CS-2617). Proteins were separated by SDS-PAGE gel based on their molecular weight. The gel was then transferred onto a polyvinylidene fluoride (PVDF) membrane using a semi-dry method. After the transfer, the PVDF membrane was blocked with 5% BSA in tris buffered saline with tween 20 (TBST). The membrane was then incubated with primary antibodies, including anti-MDR1 (CST, #13978S), KDM4C (ABclonal, A8485), β-TUBULIN (CST, #81253SF), β-ACTIN (CST, #4970S) diluted with 1% BSA at 4°C overnight. After incubation, the membrane was washed three times with TBST and then incubated with HRP-conjugated secondary antibody for 1 h at room temperature. Enhanced chemiluminescence substrates were added to the membrane and images were captured and developed by a FluoChem E system (Proteinsimple). The protein levels were normalized by β-TUBULIN or β-ACTIN. All experiments were performed three times.

2.4 IC50 assay

The drug susceptibility of the cells was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Solarbio, 298-93-1) assay. MM cells (5 × 103 cells/well) were seeded into 96-well plates (Nest), and were incubated with different concentrations of BTZ at 37°C in a humidified incubator containing 5% CO2 for 48 h. The BTZ concentrations for KM3 and KM3/BTZ were 0, 5, 10, 20, 50, 100, 200, and 400 ng/mL. BTZ concentrations for empty vector (EV) and overexpression (OE) cells were 0, 5, 10, 20, 40, and 80 ng/mL. BTZ concentrations for scramble, sh1, and sh2 cells were 0, 60,120, 240, 480, and 960 ng/mL. After the incubation period, 20 µL of MTT (5 mg/mL in phosphate-buffered saline) was added to each well and incubated for 4 h. The supernatant was then carefully removed, and 100 µL of dimethyl sulfoxide was added to dissolve the formazan crystals that had formed. The absorbance of each well was then measured at 490 nm using a CLARIOstarPlus spectrophotometer. Cell survival and inhibitory rates were derived as (optical density [OD]treated/ODcontrol)  ×  100% and (1 − ODtreated/ODcontrol)  × 100%, respectively. IC50 was calculated by GraphPad Prism 9 software. All experiments were carried out in triplicate.

2.5 Intracellular ADM detection by flow cytometry

Intracellular ADM (Adriamycin) accumulation was evaluated by flow cytometry (BD FACS Celesta). 1.0 × 106 cells were cultured with or without 1 μg/mL ADM for 9 h. The ADM fluorescence intensity was analyzed by FlowJo Software Version 10. Each experiment was repeated three times.

2.6 Statistical analysis

Data are presented as the mean ± standard deviation. Differences between groups were evaluated with T-test by GraphPad Prism 9 software. p < 0.05 was considered to be a statistically significant difference (*p < 0.05, **p < 0.01, *** p < 0.001).

  1. Ethical approval: The conducted research is not related to either human or animals use.

3 Results

3.1 KDM4C was upregulated in the BTZ-resistant MM cell line KM3/BTZ

KM3/BTZ is a BTZ-resistant human MM cell line, derived from the MM cell line KM3. The BTZ IC50 was found to be 290.29 ng/mL for KM3/BTZ. This is 11.17 times higher than that of the original parent cell line, KM3 (p < 0.001, Figure 2a). Furthermore, KM3/BTZ shows cross-resistance to ADM (Figure 2b). ADM accumulation in drug-resistant KM3/BTZ cells was significantly lower than in the KM3 cells (Figure 2c and d). MDR1, also known as P-glycoprotein /ABCB1, is a prominent member of ABCB (encoded by ABCB1 gene) subfamily and is a membrane-embedded drug transporter. MDR1, commonly overexpressed in cancers, is considered as a primary factor in the induction of multidrug resistance. It is the leading causes of various mechanisms of multidrug resistance [7]. As we anticipated, the levels of MDR1 mRNA and protein were significantly elevated in KM3/BTZ (Figure 2e and f). Meanwhile, we identified that the histone demethylase KDM4C was significantly elevated in KM3/BTZ (Figure 2e and f). KDM4C (also known as JMJD2C/GASC1) consists of a conserved JmjC catalytic domain and has been shown to demethylate lysine 9 of histone H3 (H3K9me2 and H3K9me3) and lysine 36 of histone H3 (H3K36me2 and H3K36me3). KDM4C could activate target genes by binding to their promoters and removing trimethyl (me3) and dimethyl (me2) groups [8,9]. KDM4C is amplified or overexpressed in many human cancers and is closely associated with the degree of malignancy of the tumors [1019]. Given the elevated levels of KDM4C in KM3/BTZ, we questioned whether KDM4C plays a role in BTZ resistance in MM cells.

Figure 2 
                  KDM4C was upregulated in KM3/BTZ cells. (a) Survival curves and BTZ IC50 values of KM3 and KM3/BTZ. (b) Survival curves and IC50 values of KM3 and KM3/BTZ for ADM. (c) Representative plots showing intracellular ADM accumulation in KM3 and KM3/BTZ. (d) ADM fluorescence intensity in KM3 and KM3/BTZ cells were determined by flow cytometry. (e) mRNA levels of KDM4C and MDR1 in KM3 and KM3/BTZ. (f) Protein levels of KDM4C and MDR1 in KM3 and KM3/BTZ.
Figure 2

KDM4C was upregulated in KM3/BTZ cells. (a) Survival curves and BTZ IC50 values of KM3 and KM3/BTZ. (b) Survival curves and IC50 values of KM3 and KM3/BTZ for ADM. (c) Representative plots showing intracellular ADM accumulation in KM3 and KM3/BTZ. (d) ADM fluorescence intensity in KM3 and KM3/BTZ cells were determined by flow cytometry. (e) mRNA levels of KDM4C and MDR1 in KM3 and KM3/BTZ. (f) Protein levels of KDM4C and MDR1 in KM3 and KM3/BTZ.

3.2 KDM4C overexpression enhanced BTZ resistance in KM3

To explore whether KDM4C is connected to BTZ resistance in MM cells, KM3 cells were transfected with either an EV or a KDM4C OE lentivirus (Figure 3a). RT-PCR and western blot assays were used to confirm that the KDM4C level in the OE group was significantly higher than that in the EV group (Figure 3b and c). As anticipated, we observed a significantly higher expression of MDR1 in the OE group (Figure 3b and c). Similarly, the MTT assay showed that the IC50 of BTZ in the OE group was significantly higher than that in the EV group (32.77 ng/mL vs 7.87 ng/mL, p < 0.01, Figure 3d). The intracellular ADM fluorescence intensity was found to be decreased in the OE group (Figure 3e and f). These findings suggest that KDM4C may be associated with BTZ resistance in MM cells.

Figure 3 
                  
                     KDM4C overexpression in KM3 promoted BTZ resistance. (a) Lentivirus transfection efficiency in KM3 cells, assessed by fluorescence microscopy (magnification, ×100; scale bar  =  100 μm). (b and c) KDM4C overexpression was associated with increased MDR1 mRNA and protein expression. (d) Survival curves and BTZ IC50 of OE and EV. (e) Representative flow cytometry plots showing ADM accumulation in EV and OE group. (f) ADM fluorescence intensity was decreased in OE group.
Figure 3

KDM4C overexpression in KM3 promoted BTZ resistance. (a) Lentivirus transfection efficiency in KM3 cells, assessed by fluorescence microscopy (magnification, ×100; scale bar  =  100 μm). (b and c) KDM4C overexpression was associated with increased MDR1 mRNA and protein expression. (d) Survival curves and BTZ IC50 of OE and EV. (e) Representative flow cytometry plots showing ADM accumulation in EV and OE group. (f) ADM fluorescence intensity was decreased in OE group.

3.3 KDM4C knockdown reduced the resistance to BTZ in KM3/BTZ

To further investigate the role of KDM4C in BTZ resistance, two different KDM4C knockdown cell lines were developed using two different lentivirus-mediated shRNAs in KM3/BTZ. A scramble group was used as a control (Figure 4a). The knockdown of KDM4C in KM3/BTZ, as predicted, led to a decrease in MDR1 expression (Figure 4b and c), The knockdown also decreased the IC50 of BTZ (from 221.03 ng/mL to either 88.77 or 104.35 ng/mL, both p values <0.05, Figure 4d) and increased ADM accumulation (Figure 4e and f). The collected data strongly suggest that KDM4C plays a role in promoting resistance to BTZ in MM cells.

Figure 4 
                  
                     KDM4C knockdown attenuated BTZ resistance in KM3/BTZ. (a) Verification of lentivirus transfection efficiency, with mCherry expression observed in >90% of cells using fluorescence microscopy (magnification, ×100; scale bar  =  100 μm). (b and c) mRNA and protein levels of MDR1 after KDM4C knockdown in KM3/BTZ. (d) Survival curves and BTZ IC50 of scramble, sh1 and sh2 groups. (e) Representative flow cytometry plots showing ADM accumulation in scramble, sh1 and sh2 groups. (f) Intracellular ADM accumulation was increased in sh1 and sh2.
Figure 4

KDM4C knockdown attenuated BTZ resistance in KM3/BTZ. (a) Verification of lentivirus transfection efficiency, with mCherry expression observed in >90% of cells using fluorescence microscopy (magnification, ×100; scale bar  =  100 μm). (b and c) mRNA and protein levels of MDR1 after KDM4C knockdown in KM3/BTZ. (d) Survival curves and BTZ IC50 of scramble, sh1 and sh2 groups. (e) Representative flow cytometry plots showing ADM accumulation in scramble, sh1 and sh2 groups. (f) Intracellular ADM accumulation was increased in sh1 and sh2.

The BTZ-resistant MM cell line KM3/BTZ showed an upregulation of KDM4C. Furthermore, overexpression of KDM4C resulted in an increase in the BTZ IC50 for the wild type MM cell line KM3. Conversely, knockdown of KDM4C led to a decrease in BTZ IC50 in the BTZ-resistant MM cell line KM3/BTZ. Consequently, we have established a connection between KDM4C and BTZ resistance in MM cells.

4 Discussion

In this study, we discovered a previously unidentified role of KDM4C in mediating drug resistance in a MM cell line. Our study revealed that KDM4C expression is elevated in BTZ-resistant MM cells and that depleting its levels increases the susceptibility of these cells to BTZ therapy. These significant findings strongly propose a regulatory role for KDM4C in imparting BTZ resistance in MM.

The aforementioned findings necessitated a deeper exploration into the potential mechanisms underlying the connection between KDM4C and MDR1 in MM cells. As a histone demethylase, KDM4C could potentially engage in a mechanism: it is plausible that KDM4C may bind to the promoter region of MDR1, thereby stimulating its transcription and leading to enhanced drug resistance in MM. However, no pertinent literature reports have been identified to support this hypothesis, necessitating further experimental verification.

KDM4C may promote BTZ resistance in MM cell lines by affecting the expression of MDR1. Apart from this, KDM4C is known to govern various cellular pathways. It plays a pivotal role in the DNA damage response [20], moderating cell cycle progression [21], directing differentiation [22], and maintaining the characteristics of tumor stem cells [23,24]. Hence, KDM4C could potentially influence BTZ resistance by impacting some of these pathways. The role of KDM4C in drug resistance may depend on the specific disease context and warrants further research. KDM4C plays a crucial role in various cancers, including lung cancer, hepatocellular carcinoma, ovarian cancer, and acute myeloid leukemia (AML). Overexpression of KDM4C has been shown to promote radioresistance in lung cancer and hepatocellular carcinoma [25,26]. Additionally, KDM4C is involved in maintaining the stem cell properties of cancer cells in ovarian cancer and AML [23,24,27]. Lowering the expression of KDM4C has been found to induce cellular senescence in JAK2-mutated neoplasms and gastric cancer with TP53 mutations [28,29]. It is important to note that KDM4C may also play a role in resistance to other medications. For example, KDM4C has been found to mediate resistance to cytarabine in AML [30]. However, further research is needed to fully understand the role of KDM4C in cancers and to develop effective KDM4C-targeted therapies.

Targeting KDM4C could potentially be a therapeutic strategy for overcoming BTZ resistance in MM. Several molecules that inhibit KDM4C activity, such as JIB-04 [31] and SD70 [32], have been created and demonstrated anti-tumor effects in preclinical studies. As such, these molecules could potentially enhance the effectiveness of BTZ treatment in MM patients who are resistant to BTZ.

In conclusion, this study has shed new light on the molecular mechanisms underlying BTZ resistance in MM by highlighting the role of KDM4C as a key gene involved in conferring drug resistance. These findings have significant implications for the development of innovative therapeutic approaches to overcome BTZ resistance. Further investigations are warranted to fully elucidate the precise mechanisms through which KDM4C mediates BTZ resistance. Moreover, future studies should prioritize the evaluation of the therapeutic potential of KDM4C inhibitors, such as JIB-04 and SD70, in the treatment of MM patients.


# These authors contributed equally to this study.


Acknowledgements

Thanks for generous gifts of MM cell lines KM3 and KM3/BTZ from Luqun Wang (Qilu Hospital of Shandong University).

  1. Funding information: This work was supported by the Startup Fund for Scientific Research, Fujian Medical University #1 under Grant number 2019QH1048 and Natural Science Foundation of Fujian Province #2 under Grant number 2022J01676.

  2. Author contributions: The authors have applied the SDC and FLAE approaches for the sequence of authors. Y.Y.C. and J.D.H. designed the experiments. N.Z. and R.L.L. carried out the experiments and prepared the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Kyle RA, Rajkumar SV. Multiple myeloma. Blood. 2008;111(6):2962–72.10.1182/blood-2007-10-078022Suche in Google Scholar PubMed PubMed Central

[2] Tan CRC, Abdul-Majeed S, Cael B, Barta SK. Clinical pharmacokinetics and pharmacodynamics of bortezomib. Clin Pharmacokinet. 2019;58(2):157–68.10.1007/s40262-018-0679-9Suche in Google Scholar PubMed

[3] Ding K, Jiang W, Jia H, Lei M. Synergistically anti-multiple myeloma effects: flavonoid, non-flavonoid polyphenols, and bortezomib. Biomolecules. 2022;12:11.10.3390/biom12111647Suche in Google Scholar PubMed PubMed Central

[4] Robak P, Drozdz I, Szemraj J, Robak T. Drug resistance in multiple myeloma. Cancer Treat Rev. 2018;70:199–208.10.1016/j.ctrv.2018.09.001Suche in Google Scholar PubMed

[5] Thibaudeau TA, Smith DM. A practical review of proteasome pharmacology. Pharmacol Rev. 2019;71(2):170–97.10.1124/pr.117.015370Suche in Google Scholar PubMed PubMed Central

[6] Yedi Pu DM LL, Dong K, Zhao C, Song Q, Wang L. Establishment of a bortezomib-resistant cell line KM3/BTZ of human multiple myelom. J Shandong Univ (Health Sci). 2013;51:33–6.Suche in Google Scholar

[7] Kumar A, Jaitak V. Natural products as multidrug resistance modulators in cancer. Eur J Med Chem. 2019;176:268–91.10.1016/j.ejmech.2019.05.027Suche in Google Scholar PubMed

[8] Berry WL, Janknecht R. KDM4/JMJD2 histone demethylases: epigenetic regulators in cancer cells. Cancer Res. 2013;73(10):2936–42.10.1158/0008-5472.CAN-12-4300Suche in Google Scholar PubMed PubMed Central

[9] Cloos PA, Christensen J, Agger K, Maiolica A, Rappsilber J, Antal T, et al. The putative oncogene GASC1 demethylates tri- and dimethylated lysine 9 on histone H3. Nature. 2006;442(7100):307–11.10.1038/nature04837Suche in Google Scholar PubMed

[10] Yang ZQ, Imoto I, Fukuda Y, Pimkhaokham A, Shimada Y, Imamura M, et al. Identification of a novel gene, GASC1, within an amplicon at 9p23-24 frequently detected in esophageal cancer cell lines. Cancer Res. 2000;60(17):4735–9.Suche in Google Scholar

[11] Luo WB, Chang R, Zhong J, Pandey A, Semenza GL. Histone demethylase JMJD2C is a coactivator for hypoxia-inducible factor 1 that is required for breast cancer progression. Proc Natl Acad Sci USA. 2012;109(49):E3367–E76.10.1073/pnas.1217394109Suche in Google Scholar PubMed PubMed Central

[12] Crea F, Sun L, Mai A, Chiang YT, Farrar WL, Danesi R, et al. The emerging role of histone lysine demethylases in prostate cancer. Mol Cancer. 2012;11.10.1186/1476-4598-11-52Suche in Google Scholar PubMed PubMed Central

[13] Wu X, Deng Y, Zu Y, Yin J. Histone demethylase KDM4C activates HIF1alpha/VEGFA signaling through the costimulatory factor STAT3 in NSCLC. Am J Cancer Res. 2020;10(2):491–506.Suche in Google Scholar

[14] Li N, Jiang DZ. Jumonji domain containing 2C promotes cell migration and invasion through modulating CUL4A expression in lung cancer. Biomed Pharmacother. 2017;89:305–15.10.1016/j.biopha.2017.02.014Suche in Google Scholar PubMed

[15] Lee DH, Kim GW, Yoo J, Lee SW, Jeon YH, Kim SY, et al. Histone demethylase KDM4C controls tumorigenesis of glioblastoma by epigenetically regulating p53 and c-Myc. Cell Death Dis. 2021;12:1.10.1038/s41419-020-03380-2Suche in Google Scholar PubMed PubMed Central

[16] Kim TD, Fuchs JR, Schwartz E, Abdelhamid D, Etter J, Berry WL, et al. Pro-growth role of the JMJD2C histone demethylase in HCT-116 colon cancer cells and identification of curcuminoids as JMJD2 inhibitors. Am J Transl Res. 2014;6(3):236–47.Suche in Google Scholar

[17] Wu XW, Deng Y, Zu YK, Yin J. Histone demethylase KDM4C activates HIF1 alpha/VEGFA signaling through the costimulatory factor STAT3 in NSCLC. Am J Cancer Res. 2020;10(2):491.Suche in Google Scholar

[18] Liu G, Bollig-Fischer A, Kreike B, van de Vijver MJ, Abrams J, Ethier SP, et al. Genomic amplification and oncogenic properties of the GASC1 histone demethylase gene in breast cancer. Oncogene. 2009;28(50):4491–500.10.1038/onc.2009.297Suche in Google Scholar PubMed PubMed Central

[19] Lv M, Liu Q. JMJD2C triggers the growth of multiple myeloma cells via activation of beta‑catenin. Oncol Rep. 2021;45(3):1162–70.10.3892/or.2021.7934Suche in Google Scholar PubMed PubMed Central

[20] Huang B, Wang B, Yuk-Wai Lee W, Pong UK, Leung KT, Li X, et al. KDM3A and KDM4C regulate mesenchymal stromal cell senescence and bone aging via condensin-mediated heterochromatin reorganization. iScience. 2019;21:375–90.10.1016/j.isci.2019.10.041Suche in Google Scholar PubMed PubMed Central

[21] Black JC, Allen A, Van Rechem C, Forbes E, Longworth M, Tschop K, et al. Conserved antagonism between JMJD2A/KDM4A and HP1gamma during cell cycle progression. Mol Cell. 2010;40(5):736–48.10.1016/j.molcel.2010.11.008Suche in Google Scholar PubMed

[22] Wu L, Wary KK, Revskoy S, Gao X, Tsang K, Komarova YA, et al. Histone demethylases KDM4A and KDM4C regulate differentiation of embryonic stem cells to endothelial cells. Stem Cell Rep. 2015;5(1):10–21.10.1016/j.stemcr.2015.05.016Suche in Google Scholar PubMed PubMed Central

[23] Chen GQ, Ye P, Ling RS, Zeng F, Zhu XS, Chen L, et al. Histone demethylase KDM4C is required for ovarian cancer stem cell maintenance. Stem Cell Int. 2020;2020:1–7.10.1155/2020/8860185Suche in Google Scholar PubMed PubMed Central

[24] Wang J, Li Y, Wang P, Han G, Zhang T, Chang J, et al. Leukemogenic chromatin alterations promote AML leukemia stem cells via a KDM4C-ALKBH5-AXL signaling axis. Cell Stem Cell. 2020;27(1):81–97.10.1016/j.stem.2020.04.001Suche in Google Scholar PubMed

[25] Jie X, Fong WP, Zhou R, Zhao Y, Zhao Y, Meng R, et al. USP9X-mediated KDM4C deubiquitination promotes lung cancer radioresistance by epigenetically inducing TGF-beta2 transcription. Cell Death Differ. 2021;28(7):2095–111.10.1038/s41418-021-00740-zSuche in Google Scholar PubMed PubMed Central

[26] Zeng Z, Li Z, Xue J, Xue H, Liu Z, Zhang W, et al. KDM4C silencing inhibits cell migration and enhances radiosensitivity by inducing CXCL2 transcription in hepatocellular carcinoma. Cell Death Discov. 2023;9(1):137.10.1038/s41420-023-01418-wSuche in Google Scholar PubMed PubMed Central

[27] Li Y, Hu Y, Yang L, Liu J, Cui C, Yang M, et al. Luteolin directly binds to KDM4C and attenuates ovarian cancer stemness via epigenetic suppression of PPP2CA/YAP axis. Biomed Pharmacother. 2023;160:114350.10.1016/j.biopha.2023.114350Suche in Google Scholar PubMed

[28] Wang K, Gong Z, Chen Y, Zhang M, Wang S, Yao S, et al. KDM4C-mediated senescence defense is a targetable vulnerability in gastric cancer harboring TP53 mutations. Clin Epigenetics. 2023;15(1):163.10.1186/s13148-023-01579-6Suche in Google Scholar PubMed PubMed Central

[29] Ernst P, Schnoder TM, Huber N, Perner F, Jayavelu AK, Eifert T, et al. Histone demethylase KDM4C is a functional dependency in JAK2-mutated neoplasms. Leukemia. 2022;36(7):1843–9.10.1038/s41375-022-01611-3Suche in Google Scholar PubMed PubMed Central

[30] Xue L, Li C, Ren J, Wang Y. KDM4C contributes to cytarabine resistance in acute myeloid leukemia via regulating the miR-328-3p/CCND2 axis through MALAT1. Ther Adv Chronic Dis. 2021;12:1–16.10.1177/2040622321997259Suche in Google Scholar PubMed PubMed Central

[31] He Y, Yi X, Zhang Z, Luo H, Li R, Feng X, et al. JIB-04, a histone demethylase Jumonji C domain inhibitor, regulates phenotypic switching of vascular smooth muscle cells. Clin Epigenetics. 2022;14(1):101.10.1186/s13148-022-01321-8Suche in Google Scholar PubMed PubMed Central

[32] Jin C, Yang L, Xie M, Lin C, Merkurjev D, Yang JC, et al. Chem-seq permits identification of genomic targets of drugs against androgen receptor regulation selected by functional phenotypic screens. Proc Natl Acad Sci U S A. 2014;111(25):9235–40.10.1073/pnas.1404303111Suche in Google Scholar PubMed PubMed Central

Received: 2023-11-14
Revised: 2024-03-05
Accepted: 2024-03-05
Published Online: 2024-04-12

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Heruntergeladen am 29.4.2026 von https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0848/html?lang=de
Button zum nach oben scrollen