Home Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
Article Open Access

Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells

  • Rong Zhang , Lulu Li and Junyan Yu EMAIL logo
Published/Copyright: May 29, 2024
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 19 Issue 1

Abstract

Lung cancer (LC) is regarded as a fatal cancer, and insulin-like growth factor 1 (IGF1) and its receptor (IGF1R) have been found to play a key role in regulating tumor glycolytic metabolism. The aim of this study is to investigate LC proliferation regulated by metabolite-mediated IGF1R lactylation. IGF1R was highly expressed in LC tissues and cells, and the effects of IGF1R on protein stability were inhibited by Lactate dehydrogenase A (LDHA) inhibition. Moreover, the tightness of IGF1R binding to IGF1 was also enhanced by exogenous lactic acid but suppressed by LDHA silencing, while cell viability and proliferation were promoted by over-expression of IGF1R. Exogenous lactic acid further exacerbated the effects of the IGF1R gene, while LDHA knocking down reduced the IGF1R-induced malignant behaviors. The IGF1R and exogenous lactic acid were also found to increase extracellular acidification rate (ECAR) and decrease oxygen consumption rate to regulate glycolysis, which was inhibited by LDHA deficiency in LC cells. The study concluded that IGF1R-mediated aggressive behaviors of LC cells were associated with higher levels of IGF1R lactylation. Moreover, lactic acid can improve the protein stability of the IGF1R oncogene, thus promoting glycolysis and generating lactic acid, forming a closed loop. Therefore, targeting IGF1R is envisaged to provide a novel strategy for developing therapeutic agents against LC.

Keywords: lung cancer; IGF1R; IGF1; lactylation; glycolysis

1 Introduction

Lung cancer (LC) is the primary cause of death associated with tumors globally, posing a significant hazard to human health. Mounting evidence indicates that glycolytic metabolism plays a significant role in cancers, including LC, and growth and metastasis of LC inhibition can be achieved by targeting the gene associated with glycolysis [1,2].

Insulin-like growth factor 1 (IGF1) and its receptor (IGF1R) have been reported to play a key role in regulating tumor glycolytic metabolism, where IGF1 has been found to stimulate IGF1R to increase tumor growth and glycolysis in pancreatic cancer [3]. IGF1 plays an additional carcinogenic role in pancreatic ductal adenocarcinoma by reducing the acetylation modification level of ENO2, a key glycolytic enzyme [4], while IGF1R expression inhibition has been found to suppress glycolysis in hepatocellular carcinoma [5]. Moreover, IGF1R has also been reported to inhibit glycolysis in LC [6,7]. Hence, targeting IGF1R serves as a promising strategy for treating LC.

Glucose-generated lactic acid plays an important role in tumors as an energy source in the process of glycolysis, promoting angiogenesis, promoting tumor cell invasion and metastasis, and facilitating tumor cell immune escape. Research has demonstrated that lactic acid can facilitate LC progression, participate in regulating glycolysis and mitochondrial metabolism of LC cells [8], and induce the release of Mg2+ in the endoplasmic reticulum to participate in tissue damage [9]. Lactate dehydrogenase A (LDHA) is a significant enzyme in the glycolysis pathway that catalyzes the conversion of pyruvate into lactic acid. Previous research has demonstrated that LDHA levels are elevated in different types of tumors, and it has a significant role in regulating glycolysis, where downregulating the expression of LDHA had been found to significantly inhibit the proliferation and promote the apoptosis of tumor cells [10–12].

Therefore, this study attempted to investigate IGF1R implications in LC and whether the IGF1R modulation is related to glycolysis.

2 Materials and methods

2.1 Tissue collection

Forty-five pairs of LC tissues and the matched adjacent tissues were obtained from patients with LC diagnosed in Heping Hospital Affiliated to Changzhi Medical College. All enrolled subjects had not received chemotherapy or radiation before surgery. The tissues were stored immediately at −80 °C for subsequent use.

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance with the tenets of the Helsinki Declaration, and has been approved by the Ethics Committee of Heping Hospital Affiliated to Changzhi Medical College.

2.2 Bioinformatic analysis

The mRNA expression of IGF1R in samples of 501 lung squamous cell carcinoma (LUSC) tissues and 49 normal tissues were obtained from the Encyclopedia of RNA Interactomes (ENCORI) online platform (http://starbase.sysu.edu.cn/index.php). The protein expression of IGF1R in samples of 110 LUSC tissues and 102 normal tissues were obtained from the University of Alabama at Birmingham CANcer data analysis Portal (UALCAN) database (https://ualcan.path.uab.edu).

2.3 Cell lines and cell culture

The human lung bronchial epithelial cell 16HBE and LC cell lines including PC9, A549, H460, and H1299 used in this study were purchased from the Cell Bank, Chinese Academy of Sciences. All cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum (Gibco, 23400-021) and placed in an incubator at 37℃, 5% CO2 and 95% humidity. The PC9 and A549 cells (1 × 104 cells/well) were inoculated in six-well plates and treated with lactic acid (15 mM, Sigma) for 24 h [13]. HEK293T cells were cultured in DMEM supplemented with 10% FBS, 2 mM glutamine, and 1% penicillin and streptomycin.

2.4 Cell transfection

In order to downregulate LDHA in PC9 and A549 cells, the small interfering RNA of LDHA (si-LDHA) and the negative control (si-NC), the adenovirus plasmid pAdTrack-CMV of IGF1R cDNA (IGF1R), and the empty control (vector) obtained from GenePharma were transfected into cells. In brief, cells with the density of 5 × 104 cells/well were seeded in the 24-well plates. The transfection was performed with the help of Lipofectamine 3000 (Invitrogen). The siRNA sequences are: si-LDHA: GGCAAAGACUAUAAUGUAACU (sense), UUACAUUAUAGUCUUUGCCAU (antisense); si-NC: UUCUCCGAACGUGUCACGUTT (sense), ACGUGACACGUUCGGAGAATT (antisense).

2.5 Reverse-transcription quantitative real-time polymerase chain reaction (RT-qPCR)

RNA was extracted from tissues and cells using TRIzol kit (Invitrogen), and was reverse-transcribed into cDNA according to PrimeScript RT kit instruction (Takara). IGF1R expression was detected by qRCP. The reaction conditions were as follows (40 cycles): 95℃ for 30 s, 95℃ for 15 s, and 60℃ for 30 s. The melting curve and amplification curve were obtained after the reaction. β-actin was used as the internal reference for the relative expression of IGF1R (sense: GTGGGGGCTCGTGTTTCTC, antisense: GATCACCGTGCAGTTTTCCA) using an optimized comparative Ct (2ΔΔCt) value method.

2.6 Western blot

Tumor tissues and adjacent tumor tissues were added with 200 μL of lysate for 30 min, then the mixture was centrifuged (12,000 rpm, 4℃), and the supernatant was collected for use. For cell lines, all operations are performed on ice, and the procedures are the same as for tissue extraction. The total protein content was determined using a BCA quantitative kit, and the centrifuged supernatant was turned on SDS-PAGE for 2 h. Then, 10 μL of samples were taken for electrophoresis at 80–120 V and transferred to PVDF membranes (Millipore). The membranes were blocked with 5% skim milk for 2 h. Membranes were then incubated with primary antibodies at 4°C overnight, followed by incubation with secondary antibody for 1 h. Band signals were visualized using an ECL kit, and exposed in a ChemiDocTM XRSC System (Bio-Rad). The information of all antibodies are listed as follows: anti-IGF1R antibody (ab182408, 1/1,000) and anti-IGF1 antibody (ab9572, 0.1 µg/mL) were purchased from Abcam. Anti-l-Lactyl Lysine Rabbit pAb (PTM-1401, 1/500) was obtained from PTM Biolabs. Moreover, cycloheximide (CHX, 150 µg/mL) treated on PC9 and A549 cells for 0, 6, 12, and 24 h was used for inhibition of protein synthesis [14].

2.7 Immunoprecipitation (IP) and Co-IP

The IP method was conducted for purification of IGF1R protein from tissues and cell lines. The specific process is as follows: the anti-IGF1R antibody was mixed with the extracted protein (400 μg) at 4℃ overnight. The incubated sample was mixed with protein A/G magnetic beads (Bimake) and incubated for 1 h. After washing the beads with PBST for 3 times, the captured proteins were eluted with SDS loading buffer. Western blot was performed with anti-l-Lactyl Lysine Rabbit pAb to detect the lactic modified IGF1R level.

Co-IP assays were performed to detect the interaction between IGF1R and IGF1 using protein A/G magnetic beads. The pre-cooled IP cell lysate of HEK293T cells containing protease inhibitors was added into the collected cells (4℃, 30 min), centrifuged, and determined by BCA method. The supernatant was denatured and used for input. IgG (1.0 μg) and protein A/G beads (20 μL) were added to the IgG group, and 20 μL protein A/G beads were added to the IP group, and incubated at 4℃ for 1 h. After centrifugation, antibody was added to the supernatant at 4℃ and incubated overnight. The IP complex was collected after centrifugation, and washed with pre-cooled IP lysate (without inhibitor) for four times. After each centrifugation, the supernatant was collected, and 80 μL loading buffer was added. Finally, the supernatant (10 μL) which has been boiled for 10 min was centrifuged for Western blot detection.

2.8 Cell counting kit 8 (CCK-8) assay

Cell viability was tested by CCK-8 (Corning Corporation). In short, the PC9 and A549 cells (1 × 104 cells/well) were seeded into 96-well plates. The optical density value at 450 nm was determined 2 h subsequent to the addition of CCK-8 reagent with the utilization of a microplate reader (BioTek).

2.9 5-Ethynyl-2′-deoxyuridine (EdU) staining

Cell proliferative capacity was tested with the aid of a Cell-Light EdU DNA Cell Proliferation Kit (RiboBio). After digestion, cells of each group were inoculated into 48-well plates, with 15,000 cells inoculated in each well, and continued to be cultured until the cells were attached to the wall. EdU working solution was added for 48 h culture. Cell nuclei was stained with 4,6-diamidino-2-phenylindole, and after washing with phosphate buffer saline, EdU staining was observed under the inverted fluorescence microscope (Leica). EdU positive cells shows red fluorescence.

EdU positive rate (%) = Number of red fluorescent cells/Number of blue fluorescent cells × 100%.

2.10 Glycolysis index detection

Forty-eight hours after transfection, the glucose uptake and production of lactate of PC9 and A549 cells were examined utilizing the glucose uptake colorimetric assay kit and lactic acid colorimetric assay kit (Biovision). Cell oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using Seahorse XFe96 analyzer (Seahorse Bioscience) using Seahorse XF Glycolysis Stress Test Kit and Seahorse XF Cell Mito Stress Test Kit, respectively.

2.11 Statistical analysis

SPSS 22.0 software was used for statistical analysis. All experiments were repeated three times, and the results were expressed as mean value ± standard deviation. The t-test was used to test the difference between the two groups of data, and the one-way analysis of variance was used to test the difference between the multiple groups of data. p < 0.05 was statistically significant.

3 Results

3.1 IGF1R is significantly highly expressed in tissues and cells of LC

The mRNA expression of IGF1R was analyzed in 501 LUSC tissues and 49 normal tissues from the ENCORI database. The results indicated that IGF1R was significantly overexpressed in LUSC (Figure 1a). Meanwhile, data collected from UALCAN database also verified the high protein level of IGF1R in LUSC (Figure 1b). Subsequently, the outcome was confirmed in clinical specimens, which indicated that IGF1R mRNA (Figure 1c, p < 0.01) and protein levels (Figure 1d, p < 0.01) were elevated in tissues of LC patients. Meanwhile, both the mRNA and protein levels of IGF1R also upregulated multiple LC cell lines (Figure 1e and f, p < 0.05). Furthermore, the upregulation of IGF1R was more pronounced in PC9 and A549 cells, which were chosen for further experiments.

Figure 1 IGF1R is highly expressed in lung cancer (LC) tissues and cells. (a) IGF1R expression in samples of patients with LUSC accessed from the ENCORI. (a) and (b) High protein level of IGF1R in samples of patients with LUSC accessed from the UALCAN Portal. (c) and (d) IGF1R expression levels in LC and para-cancerous tissues were evaluated by RT-qPCR and western blot methods, n = 3. (e) and (f) IGF1R expression levels in diverse LC cell lines were evaluated by RT-qPCR and western blot methods, n = 3. * p < 0.05, ** p < 0.01.
Figure 1

IGF1R is highly expressed in lung cancer (LC) tissues and cells. (a) IGF1R expression in samples of patients with LUSC accessed from the ENCORI. (a) and (b) High protein level of IGF1R in samples of patients with LUSC accessed from the UALCAN Portal. (c) and (d) IGF1R expression levels in LC and para-cancerous tissues were evaluated by RT-qPCR and western blot methods, n = 3. (e) and (f) IGF1R expression levels in diverse LC cell lines were evaluated by RT-qPCR and western blot methods, n = 3. * p < 0.05, ** p < 0.01.

3.2 Exogenous lactic acid promotes IGF1R protein stability by enhancing lactylation in LC cells

Results of pan lysine lactylation (Pan-Kla) levels in LC revealed that the Pan-Kla protein levels were significantly higher in both tissues and LC cell lines (Figure 2a and b), in addition to upregulated lactated IGF1R in LC (Figure 2c and d). The IGF1R protein was found to degrade significantly in PC9 and A549 cells compared with the 16HBE group (Figure 2e and f, p < 0.01). It proceeded by utilizing exogenous lactic acid interference and LDHA knockdown performance to promote lactylation in LC cells, respectively, and results showed that the exogenous lactic acid treatment significantly increased the IGF1R protein levels as well as lactated IGF1R in both PC9 and A549 cells, which were significantly decreased following inhibition of LDHA performance (Figure 3a and b). It is pertinent to mention that the IGF1R protein degradation was significantly delayed by exogenous lactic acid application while accelerated by LDHA silencing in both PC9 and A549 cells (Figure 3c and d). Moreover, the tightness of IGF1R binding to IGF1 verified in HEK293T cells was also enhanced by exogenous lactic acid treatment but suppressed by LDHA silencing (Figure 4a).

Figure 2 Lactylation regulated the stability of IGF1R protein. The pan lysine lactylation (Pan-Kla) levels of (a) LC and para-cancerous tissues and (b) 16HBE, PC9, and A549 cells were detected by western blot, n = 3. IGF1R and lactated IGF1R levels in (c) LC and para-cancerous tissues and (d) 16HBE, PC9, and A549 cells were detected by western blot, n = 3. (e) Protein degradation of IGF1R protein in 16HBE, PC9, and A549 cells treated by cycloheximide (CHX, 150 µg/mL) interference, n = 3. (f) The quantitative analysis of protein degradation, n = 3. ** p < 0.01.
Figure 2

Lactylation regulated the stability of IGF1R protein. The pan lysine lactylation (Pan-Kla) levels of (a) LC and para-cancerous tissues and (b) 16HBE, PC9, and A549 cells were detected by western blot, n = 3. IGF1R and lactated IGF1R levels in (c) LC and para-cancerous tissues and (d) 16HBE, PC9, and A549 cells were detected by western blot, n = 3. (e) Protein degradation of IGF1R protein in 16HBE, PC9, and A549 cells treated by cycloheximide (CHX, 150 µg/mL) interference, n = 3. (f) The quantitative analysis of protein degradation, n = 3. ** p < 0.01.

Figure 3 Exogenous lactic acid promotes IGF1R protein stability by enhancing lactylation in LC cells. The protein levels of IGF1R and lactylated IGF1R in PC9 and A549 cells under the interference of (a) the exogenous lactic acid (15 mM) and (b) knockdown of LDHA, n = 3. (c) Protein degradation of IGF1R protein in PC9 and A549 cells treated by interference of the exogenous lactic acid (15 mM) and knockdown of LDHA, n = 3. (d) The quantitative analysis of protein degradation, n = 3. ** p < 0.01 (vs PC9-NC and PC9-si-NC), ## p < 0.01 (vs A549-NC and A549-si-NC).
Figure 3

Exogenous lactic acid promotes IGF1R protein stability by enhancing lactylation in LC cells. The protein levels of IGF1R and lactylated IGF1R in PC9 and A549 cells under the interference of (a) the exogenous lactic acid (15 mM) and (b) knockdown of LDHA, n = 3. (c) Protein degradation of IGF1R protein in PC9 and A549 cells treated by interference of the exogenous lactic acid (15 mM) and knockdown of LDHA, n = 3. (d) The quantitative analysis of protein degradation, n = 3. ** p < 0.01 (vs PC9-NC and PC9-si-NC), ## p < 0.01 (vs A549-NC and A549-si-NC).

Figure 4 LA enhanced IGF1R and IGF binding. (a) The binding relationship between IGF1R and IGF1 was accessed by Co-IP verified in HEK293T cells, n = 3.
Figure 4

LA enhanced IGF1R and IGF binding. (a) The binding relationship between IGF1R and IGF1 was accessed by Co-IP verified in HEK293T cells, n = 3.

3.3 Lactylation of IGF1R promotes glycolysis in LC cells

The regulatory effects of IGF1R and its lactylation on cellular functions were further investigated using PC9, A549, and H460 cell lines. Results indicated that overexpressing IGF1R promoted cell viability and proliferation, while exogenous lactic acid treatment translated into further enhancement of the IGF1R gene effects, and knocking down LDHA reduced the IGF1R-induced malignant behaviors in PC9, A549, and H460 cells (Figure 5a–c, Figure S1a–c). Subsequently, the relationship between IGF1R and glycolysis was investigated, and results showed a higher glucose uptake (Figure 5d, Figure S1d) and extracellular lactate (Figure 5e, Figure S1e) in PC9, A549, and H460 cells as a function of IGF1R over-expression and lactic acid treatment, demonstrating the acceleration of IGF1R lactylation on glycolytic metabolism. Moreover, the seahorse assay results exhibited that over-expression of IGF1R and lactic acid treatment increased the ECAR (Figure 5f, Figure S1f) but decreased the OCR (Figure 5g, Figure S1g), while the effects of IGF1R over-expression on glycolysis index were significantly reversed by LDHA knockdown.

Figure 5 Lactylation of IGF1R promotes glycolysis in LC cells. Under the interference of over-expression of IGF1R, exogenous lactic acid (15 mM) treatment, and LDHA knockdown, (a) the cell viability was accessed by CCK-8 assay, (b) and (c) the cell proliferation was evaluated by EdU staining. Glucose uptake (d) and lactate production (e) in different cells, n = 3. (f) and (g) The effects of IGF1R lactylation on extracellular acidification rate (ECAR) and OCR, as determined by glycolysis stress test in PC9 and A549 cells, n = 3. ** p < 0.01 (vs vector), ## p < 0.01 (vs IGF1R), && p < 0.01 (vs IGF1R + si-NC).
Figure 5

Lactylation of IGF1R promotes glycolysis in LC cells. Under the interference of over-expression of IGF1R, exogenous lactic acid (15 mM) treatment, and LDHA knockdown, (a) the cell viability was accessed by CCK-8 assay, (b) and (c) the cell proliferation was evaluated by EdU staining. Glucose uptake (d) and lactate production (e) in different cells, n = 3. (f) and (g) The effects of IGF1R lactylation on extracellular acidification rate (ECAR) and OCR, as determined by glycolysis stress test in PC9 and A549 cells, n = 3. ** p < 0.01 (vs vector), ## p < 0.01 (vs IGF1R), && p < 0.01 (vs IGF1R + si-NC).

4 Discussion

This study revealed that IGF1R was abnormally highly expressed in LC clinical samples and LC cell lines, along with elevated Pan-Kla levels in LC cells, suggesting lactation of IGF1R. Moreover, exogenous lactic acid enhanced lactated IGF1R, improved protein stability, and reversed the effects of LDHA knockdown on glycolysis (Figure 6).

Figure 6 Graphical abstract.
Figure 6

Graphical abstract.

IGF1R is a transmembrane tyrosine receptor protein that promotes cell division by binding to its ligand IGF1, leading to various regulatory effects on tumor cells, such as proliferation, apoptosis, angiogenesis, invasion, and metastasis [15–17]. IGF1R has been found to be abnormally highly expressed in various tumors and was reported to be closely associated with tumor malignant behaviors [6,18]. Our results demonstrated that both the mRNA and protein levels of IGF1R were significantly upregulated in LC tissues and cell lines. IGF1R is known to play a role in regulating glycolysis [19, 20], and it was reported that glycolysis could be one of the malignant phenotypes of LC cells [21]. Additionally, lactic acid, a byproduct of glycolysis, can influence cell metabolism by regulating gene expression through protein lactylation-mediated LC [8]; hence, it was hypothesized that IGF1R was lactated, which was later verified in subsequent experiments.

Lactylation is a recently identified post-translational protein modification that covalently couples lactate groups to protein lysine residues to aid in gene regulation. Mass spectrometry analysis revealed 451 lysine lactation sites on 724 proteins in the human lung, with 141 of these proteins being lactated [22]. It has been reported that lactic acid modulates glycolysis through lactylation-mediated gene expression of glycolytic enzyme HK-1 in LC; the mRNA level of HK-1 was downregulated by lactic acid, and increased by acylation [8]. Our data also found higher Pan-Kla levels in LC tissues and cells, which could probably be induced by IGF1R lactylation. Moreover, the IGF1R protein stability was enhanced in LC cells; it was hypothesized that the stability of IGF1R protein was regulated by lactic acid due to its ability to provide energy to cancer cells through glycolysis. Our results suggested that exogenous lactic acid dramatically increased the IGF1R protein levels and lactated IGF1R, and more importantly, the degradation of IGF1R protein was significantly delayed by exogenous lactic acid, which was in line with previously reported results [23]. LDHA can catalyze the conversion of pyruvate to lactic acid, while the expressions of LDHA were reported to be significantly upregulated in LC tissues and were associated with poor patient prognosis [8]. LDHA further increases histone lactation and leads to metabolic disorders and tumorigenesis of LC cells [23]. This study’s results demonstrated that LDHA knockdown accelerated the degradation of IGF1R protein, as reported before [24].

The binding of ligands to receptors results in receptor oligomerization, activation of protein tyrosine kinase, intermolecular receptor self-phosphorylation, and phosphorylation of cell substrates, ultimately resulting in gene-activated DNA synthesis and cell proliferation. Thus, promoting the binding of IGF1R and IGF1 contributes to cancer progression, a phenomenon observed in various types of cancer [15,25,26]. Results showed that the tightness of IGF1R binding to IGF1 was also enhanced by exogenous lactic acid but suppressed by LDHA silencing.

Over-expression of IGF1R increased cell viability and proliferation, while exogenous lactic acid enhanced the effects of the IGF1R gene, and LDHA knockdown had the opposite effect. IGF1R regulates cell functions like proliferation, differentiation, survival, metabolism, and migration through the activation of different signaling pathways such as PI3K/AKT/mTOR, Ras/Raf/Mek/Erk, and JAK/STAT [27,28]. One limitation of this study is the lack of investigation into the downstream pathway of IGF1R, which requires additional research. Furthermore, the relationship between IGF1R and glycolysis was investigated, where IGF1R lactylation was found to induce glycolytic metabolism in LC. The exogenous lactic acid enhanced the regulatory effect of IGF1R, while the inhibitory effect of LDHA was reversed. Glycolysis-induced lactic acid enhanced the protein stability of oncogene IGF1R through lactylation and promoted glycolysis to generate more lactic acid, creating a self-sustaining cycle. Therefore, targeting IGF1R offers a novel approach for developing therapeutic agents to combat LC.

5 Conclusion

This study concluded that IGF1R was extensively lactylated in LC cells, and exogenous lactic acid significantly promoted IGF1R lactylation to stabilize the IGF1R protein. Lactic acid enhanced the impact of IGF1R on glycolysis during lactation, leading to increased lactic acid production and establishing a self-sustaining cycle. Therefore, targeting IGF1R may be a promising therapeutic strategy against LC.

  1. Funding information: Authors state no funding involved.

  2. Author contributions: All authors participated in the design, interpretation of the studies and analysis of the data, and review of the manuscript. R.Z. designed the experiments and carried them out. L.L. developed the model code and performed the simulations. J.Y. prepared the manuscript with contributions from all co-authors. The authors applied the SDC approach for the sequence of authors. All authors read and approved the final manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Lin S, Li Y, Wang D, Huang C, Marino D, Bollt O, et al. Fascin promotes lung cancer growth and metastasis by enhancing glycolysis and PFKFB3 expression. Cancer Lett. 2021;518:230–42.10.1016/j.canlet.2021.07.025Search in Google Scholar PubMed PubMed Central

[2] Liu X, Li Z, Wang Z, Liu F, Zhang L, Ke J, et al. Chromatin remodeling induced by ARID1A loss in lung cancer promotes glycolysis and confers JQ1 vulnerabilityCancer Res. 2022;82(5):791–804.10.1158/0008-5472.CAN-21-0763Search in Google Scholar PubMed

[3] Hu L, Xu X, Li Q, Chen X, Yuan X, Qiu S, et al. Caveolin-1 increases glycolysis in pancreatic cancer cells and triggers cachectic states. FASEB J. 2021;35(8):e21826.10.1096/fj.202100121RRRSearch in Google Scholar PubMed

[4] Zheng Y, Wu C, Yang J, Zhao Y, Jia H, Xue M, et al. Insulin-like growth factor 1-induced enolase 2 deacetylation by HDAC3 promotes metastasis of pancreatic cancer. Signal Transduct Tar. 2020;5(1):53.10.1038/s41392-020-0146-6Search in Google Scholar PubMed PubMed Central

[5] Wang Y, Chen X, Yao N, Gong J, Cao Y, Su X, et al. MiR-448 suppresses cell proliferation and glycolysis of hepatocellular carcinoma through inhibiting IGF-1R expression. J Gastrointest Oncol. 2022;13(1):355–67.10.21037/jgo-22-90Search in Google Scholar PubMed PubMed Central

[6] Liu F, Liu Y, Liu X, Mao K, Zhong D, Marcus AI, et al. Inhibition of IGF1R enhances 2-deoxyglucose in the treatment of non-small cell lung cancer. Lung Cancer. 2018;123:36–43.10.1016/j.lungcan.2018.06.026Search in Google Scholar PubMed PubMed Central

[7] Ren JG, Seth P, Ye H, Guo K, Hanai JI, Husain Z, et al. Citrate suppresses tumor growth in multiple models through inhibition of glycolysis, the tricarboxylic acid cycle and the IGF-1R pathway. SCI REP-UK. 2017;7(1):4537.10.1038/s41598-017-04626-4Search in Google Scholar PubMed PubMed Central

[8] Jiang J, Huang D, Jiang Y, Hou J, Tian M, Li J, et al. Lactate modulates cellular metabolism through histone lactylation-mediated gene expression in non-small cell lung cancer. Front Oncol. 2021;11:647559.10.3389/fonc.2021.647559Search in Google Scholar PubMed PubMed Central

[9] Daw CC, Ramachandran K, Enslow BT, Maity S, Bursic B, Novello MJ, et al. Lactate elicits ER-mitochondrial Mg2+ dynamics to integrate cellular metabolism. Cell. 2020;183(2):474–89.10.1016/j.cell.2020.08.049Search in Google Scholar PubMed PubMed Central

[10] Sharma D, Singh M, Rani R. Role of LDH in tumor glycolysis: Regulation of LDHA by small molecules for cancer therapeutics. Semin Cancer Biol. 202;87:184–95.10.1016/j.semcancer.2022.11.007Search in Google Scholar PubMed

[11] Wang C, Li Y, Yan S, Wang H, Shao X, Xiao M, et al. Interactome analysis reveals that lncRNA HULC promotes aerobic glycolysis through LDHA and PKM2. Nat Commun. 2020;11(1):3162.10.1038/s41467-020-16966-3Search in Google Scholar PubMed PubMed Central

[12] Chen M, Cen K, Song Y, Zhang X, Liou YC, Liu P, et al. NUSAP1-LDHA-Glycolysis-Lactate feedforward loop promotes Warburg effect and metastasis in pancreatic ductal adenocarcinoma. Cancer Lett. 2023;567:216285.10.1016/j.canlet.2023.216285Search in Google Scholar PubMed

[13] Kumagai S, Koyama S, Itahashi K, Tanegashima T, Lin Y, Togashi Y, et al. Lactic acid promotes PD-1 expression in regulatory T cells in highly glycolytic tumor microenvironments. Cancer Cell. 2022;40(2):201–18.10.1016/j.ccell.2022.01.001Search in Google Scholar PubMed

[14] Min X, Zhang X, Li Y, Cao X, Cheng H, Li Y, et al. HSPA12A unstabilizes CD147 to inhibit lactate export and migration in human renal cell carcinoma. Theranostics. 2020;10(19):8573–90.10.7150/thno.44321Search in Google Scholar PubMed PubMed Central

[15] Seo SH, Hwang SY, Hwang S, Han S, Park H, Lee YS, et al. Hypoxia-induced ELF3 promotes tumor angiogenesis through IGF1/IGF1R. Embo Rep. 2022;23(8):e52977.10.15252/embr.202152977Search in Google Scholar PubMed PubMed Central

[16] Xia L. Su042 IGF1-mediated HOXA13 overexpression promotes colorectal cancer metastasis through upregulating ACLY and IGF1R. Gastroenterology. 2021;160(6, Supplement):592–3.10.1016/S0016-5085(21)02118-1Search in Google Scholar

[17] Qiao C, Huang W, Chen J, Feng W, Zhang T, Wang Y, et al. IGF1-mediated HOXA13 overexpression promotes colorectal cancer metastasis through upregulating ACLY and IGF1R. Cell Death Dis. 2021;12(6):564.10.1038/s41419-021-03833-2Search in Google Scholar PubMed PubMed Central

[18] Alfaro-Arnedo E, Lopez IP, Pineiro-Hermida S, Canalejo M, Gotera C, Sola JJ, et al. IGF1R acts as a cancer-promoting factor in the tumor microenvironment facilitating lung metastasis implantation and progression. Oncogene. 2022;41(28):3625–39.10.1038/s41388-022-02376-wSearch in Google Scholar PubMed PubMed Central

[19] Stalnecker CA, Grover KR, Edwards AC, Coleman MF, Yang R, DeLiberty JM, et al. Concurrent inhibition of IGF1R and ERK increases pancreatic cancer sensitivity to autophagy inhibitors. Cancer Res. 2022;82(4):586–98.10.1158/0008-5472.CAN-21-1443Search in Google Scholar PubMed PubMed Central

[20] Ma R, Gan L, Guo J, Peng Z, Wu J, Harrison AR, et al. Insights into ferroptosis: targeting glycolysis to treat graves’ orbitopathy. J Clin Endocrinol Metabol. 2022;107(7):1994–2003.10.1210/clinem/dgac163Search in Google Scholar PubMed

[21] Hua Q, Jin M, Mi B, Xu F, Li T, Zhao L, et al. LINC01123, a c-Myc-activated long non-coding RNA, promotes proliferation and aerobic glycolysis of non-small cell lung cancer through miR-199a-5p/c-Myc axis. J Hematol Oncol. 2019;12(1):91.10.1186/s13045-019-0773-ySearch in Google Scholar PubMed PubMed Central

[22] Yang YH, Wang QC, Kong J, Yang JT, Liu JF. Global profiling of lysine lactylation in human lungs. Proteomics. 2023;23(15):e2200437.10.1002/pmic.202200437Search in Google Scholar PubMed

[23] Nian F, Qian Y, Xu F, Yang M, Wang H, Zhang Z. LDHA promotes osteoblast differentiation through histone lactylation. Biochem Biophys Res Commun. 2022;615:31–5.10.1016/j.bbrc.2022.05.028Search in Google Scholar PubMed

[24] Yang W, Wang P, Cao P, Wang S, Yang Y, Su H, et al. Hypoxic in vitro culture reduces histone lactylation and impairs pre-implantation embryonic development in mice. Epigenet Chromatin. 2021;14(1):57.10.1186/s13072-021-00431-6Search in Google Scholar PubMed PubMed Central

[25] Chen WJ, Tsai JH, Hsu LS, Lin CL, Hong HM, Pan MH. Quercetin blocks the aggressive phenotype of triple-negative breast cancer by inhibiting IGF1/IGF1R-mediated EMT program. J Food Drug Anal. 2021;29(1):98–112.10.38212/2224-6614.3090Search in Google Scholar PubMed PubMed Central

[26] Xie L, Zhang J, Yan H, Cai Y, Xu L. β-elemene induced apoptosis and senescence of triple-negative breast cancer cells through IGF1/IGF1R pathway. Tissue and Cell. 2022;79:101914.10.1016/j.tice.2022.101914Search in Google Scholar PubMed

[27] Yoshida T, Delafontaine P. Mechanisms of IGF-1-mediated regulation of skeletal muscle hypertrophy and atrophy. Cells-Basel. 2020;9(9):1970.10.3390/cells9091970Search in Google Scholar PubMed PubMed Central

[28] Wang XW, Yuan LJ, Yang Y, Zhang M, Chen WF. IGF-1 inhibits MPTP/MPP(+)-induced autophagy on dopaminergic neurons through the IGF-1R/PI3K-Akt-mTOR pathway and GPER. Am J Physiol-Endocrinol Metabol. 2020;319(4):E734–43.10.1152/ajpendo.00071.2020Search in Google Scholar PubMed

Received: 2024-01-11
Revised: 2024-03-22
Accepted: 2024-04-20
Published Online: 2024-05-29

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
https://doi.org/10.1515/biol-2022-0874
Keywords for this article
lung cancer; IGF1R; IGF1; lactylation; glycolysis
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 22.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0874/html
Scroll to top button