Home Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
Article Open Access

Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke

  • Likun An , Ziao Wang , Yongmei Cui , Youhua Yao , Yixiong Bai , Yuehai Liu , Xin Li , Xiaohua Yao and Kunlun Wu EMAIL logo
Published/Copyright: April 25, 2024
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 19 Issue 1

Abstract

Allene oxide synthase (AOS) is a key enzyme involved in the jasmonic acid (JA) synthesis pathway in plants. To explore its function on the regulatory mechanism of JA synthesis, we screened and identified two AOS genes HvnAOS1 and HvnAOS2 in qingke. Both HvnAOS1 and HvnAOS2 contained conserved heme-binding motif, which is most closely related to AtsAOS2, indicating controlled dehydration of fatty acid hydroperoxides to allene oxides. Molecular docking simulations identified the key amino acid sites that were important for heme binding and interaction with 13(S)-HPOT, respectively. The expression pattern also indicated that HvnAOS1 and HvnAOS2 were highly induced by JA, abscisic acid, and salicylic acid. Subcellular localization of HvnAOS1 and HvnAOS2 using transient expression of Agrobacterium tumefaciens showed the green fluorescent protein signal in the cell cytoplasm of the N. benthamiana leaves. Overexpression of HvnAOS1 and HvnAOS2 in Arabidopsis aos mutant restored male fertility and plant resistance to Botrytis cinerea, indicating that HvnAOS1 and HvnAOS2 can restore the functions of AOS in Arabidopsis aos mutant.

Keywords: qingke; allene oxide synthase; HvnAOS1 and HvnAOS2 genes; bioinformatics analysis; molecular docking simulation

1 Introduction

Qingke (Hordeum vulgare L. var. nudum Hook. f.) is the most important grain and fodder crop, with the advantages of early maturity, easy cultivation, and tolerance to multiple adversities in the Qinghai-Tibetan Plateau of China [1–3]. Qingke seeds are rich in nutrients and can be processed into a variety of foods, and are also an important raw material for winemaking, which is popular among people in the Qinghai-Tibetan Plateau [4–6]. Due to the extremely harsh environment in the Qinghai-Tibetan Plateau region, such as drought, salinity, low temperature, and strong ultraviolet radiation, the production of qingke is subject to long-term comprehensive adversity stresses [4,7,8]. So, how to improve the resistance to integrated adversities in the plateau region is of great significance for qingke production in the Qinghai-Tibetan Plateau.

As a kind of growth regulator, jasmonic acid (JA) and its derivatives (JAs) play an important role in plant growth and development and various physiological activities [9–12]. In addition, JA can act as the most responsive signaling molecules to be in response to comprehensive stress, such as drought, salinity, high and low temperature, pests and diseases, mechanical damage, strong UV radiation, etc. [13–15]. Allene oxide synthase (AOS) is the key enzymes in the JA synthesis pathway, and its substrate is 13(S)-hydroperoxy-linolenic acid (13(S)-HPOT). The core region of AOS contains a heme molecule, and after 13(S)-HPOT enters the core region of AOS, it is converted to unstable 12(S),13(S)-epoxy-linolenic acid (12(S),13(S)-HPOT) catalyzed by heme and then converted by propylene oxide cyclase (POC) to 12-oxo-phytodienoic acid (12-OPDA) [16]. 12-OPDA eventually produces JA after a series of reactions, which is a key step in the synthesis of JA in plants. Many studies have shown that the AOS in plants is closely related to the regulation of plant resistance to drought, salinity, low temperature, pests and diseases, strong UV radiation, and other adversities [17–20]. Many studies have shown that the expression of AOS genes are induced by various factors such as gibberellin (GA), abscisic acid (ABA), low temperature, salt, and drought stress, and they also play an important role in plant growth and development and in response to adversity stress [21–24]. There are two AOS homologs, AOS1 and AOS2, in some plants, and the functions of AOS1 and AOS2 are the same, and they have different modes of action and different expression patterns [25].

In this study, we performed bioinformatics, expression analysis, and functional verification of AOS genes HvnAOS1 and HvnAOS2. This study provides new sights for the function of HvnAOS1 and HvnAOS2 on the regulation of JA synthesis under integrated stress resistance in qingke.

2 Materials and methods

2.1 Amplification of HvnAOS1 and HvnAOS2 cDNA and promoter region

According to the searched domain of AOS in the plant genome database Gramene (http://www.gramene.org/), we identified HvnAOS1 (HORVU4Hr1G066270) and HvnAOS2 (HORVU4Hr1G066230) in qingke. Due to HvnAOS1 and HvnAOS2 without intron structure, the coding sequence of HvnAOS1 (1,464 bp) and HvnAOS2 (1,443 bp) and the sequence of their promoter regions were isolated from the qingke variety “Kunlun 15” genomic DNA using a KOD-FX high-fidelity PCR enzyme according to primers forward, 5′ AGTTAGATGAACCAGAG 3′ and reverse, 5′ GGATTTAAACAGCGTCTGCCACAC 3′; forward 5′ AGTGTAAGATGAACCAGAGCGC 3′ and reverse, 5′ AGGTTTTAAACAGCCCC 3′, respectively. The promoter region of the HvnAOS1 (2,134 bp) and HvnAOS2 (2,106 bp) were isolated by degenerate primers forward, 5′ TCAATGGTGTGCCATTATCTAC 3′ and reverse, 5′ CTAACTCTGCTGCTAGCTAGGCT 3′; forward, 5′ TAGTACCGCTCTGGCGGTACTGT 3′ and reverse, 5′ CTTACACTTGTTGCTTCAAAAT 3′, respectively. The DNA sequences of HvnAOS1 and HvnAOS2 genes and promoter region were cloned from leaf DNA as template by PCR. The open reading frames in the sequences were translated using DNAMAN (Version: 7.0) to obtain HvnAOS1 and HvnAOS2 protein sequences. The primer sequences used in this study were designed by Genscript (https://www.genscript.com.cn/tools/pcr-primers-designer).

2.2 Bioinformatics analysis

The promoter elements of HvnAOSs genes were predicted using the PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/). The physical and chemical properties were predicted using the Protparam (https://web.expasy.org/protparam/). Secondary structures of HvnAOSs proteins were predicted using the SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html). The alignments of nucleotide sequences and protein sequences were performed using DNAMAN 7.0 and the phylogenetic analysis was inferred with the maximum likelihood estimate method using the MEGA (Version: 7.0). Subcellular localizations of these HvnAOSs proteins were predicted using Cell-PLoc 2.0 (http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/). The protein structures were predicted using the AlphaFold (Version: 2.3.2). The comprehensive analysis of protein binding cavities was predicated by CavityPlus. The 13(S)-HPOT and Heme molecular PDB files were downloaded from the PDB database (https://www.rcsb.org/). Molecular docking simulations of HvnAOS1 and HvnAOS2 with 13(S)-HPOT and heme were performed with AutoDock Vina software (Version: 1.2) according to the study reported by Li et al. [16], respectively, and the conformation with the highest scoring value and default parameters were selected, and the results were analyzed using PyMoL software (Version: 1.7.6).

2.3 Subcellular localization analysis of the HvnAOS1 and HvnAOS2

The primers for vector construction are as follows: HvnAOS1, forward, F:5′-GCTCTAGAAGTTAGATGAACCAGAG-3′ and reverse, R:5′-CGGGTACCCAACAGCGTCTGCCACACC-3′; HvnAOS2 F:5′-GCTCTAGAAGTGTAAGATGAACCAGAGCGC-3′ and reverse, R:5′-CGGGTACCCAACAGCCCCAGGACCGGATGTGGC-3 and the PCR fragment was cloned into the modified vector pBI221-GFP with Basta resistance gene at the Xba Ⅰ and KpnI sites. Then, pBI221:HvnAOS1-GFP, pBI221:HvnAOS2-GFP was transformed into leaf protoplasts of qingke for subcellular localization [26,27]. The qingke seeds were germinated at 25℃ in the dark for 10 days to cut the leaves into minced pieces (<0.5 mm). Protoplast preparation and transient transformation were carried out according to the instruction of Zhongke Terry Plant Protoplast Preparation and Transformation Kit (RTU4072). The green fluorescent protein (GFP) fluorescence signal of HvnAOS1 and HvnAOS2 was observed using the laser confocal scanning microscope (Nikon, C2-ER).

2.4 Expression pattern analysis of HvnAOS1 and HvnAOS2

To analyze the expression levels of HvnAOS1 and HvnAOS2 under different phytohormone treatments, the qingke seeds were planted in soil-based seedling boxes and treated with hormones when they reached the three-leaf stage. A 100 µM solution of ABA, methyl jasmonate (MeJA), GA, salicylic acid (SA), 6-benzyl aminopurine (6-BA), and naphthalene acetic acid (NAA) was prepared and 5 mL of each solution was sprayed with 1‰ Tween-20, while the control plants were sprayed with only 200 mL of pure water with 1‰ Tween-20. The leaves were harvested and flash frozen in liquid nitrogen at 0 (control), 6, 12, 24, and 48 h after treatment and were stored at −80°C for RNA extraction. At least three biological replicates of each sample were performed to analyze the expression patterns of HvnAOS1 and HvnAOS2 [28,29]. Total RNA from the leaves was extracted using the TransGen Transzol Up Plus kit. The cDNA was synthesized using the first-strand cDNA synthesis super mix kit (Transgen Biotech, Catalog No. AE301-02). The pair of specific primers of HvnAOS1 and HvnAOS2 were as follows: HvnAOS1: forward, TTCGTCGGCGACCGGTTC and reverse, CTGCCACACCGGACG; HvnAOS2: forward, ACCGGTTTGTCGGGG and reverse, CCCCAGGACCGGAT. The primers of reference gene 18SrRNA were as follows: forward, CGGCTACCACATCCAAGGAA and reverse, GCTGGAATTACCGCGGCT. The qRT-PCR reaction system consisted of 1.0 μL primers (10 μM), 2.0 μL cDNA, 10 μL Thunderbird SYBR qPCR Mix, and 6.0 μL ddH2O. The formula 2−ΔΔCt was used for qRT-PCR analysis and each reaction was repeated three times.

2.5 Transformation of Arabidopsis and identification of transgenic plants

To efficiently test whether the HvnAOS1 and HvnAOS2 are functionally similar to Arabidopsis AOS, we transformed HvnAOS1 and HvnAOS2 into the Arabidopsis aos mutant to test whether HvnAOS1 and HvnAOS2 can complement the JA-synthase-related phenotypes of aos, respectively. Recombinant vectors pBI221:HvnAOS1-GFP and pBI221:HvnAOS2-GFP were transformed into Agrobacteria strain GV3101 and then infected inflorescence of Arabidopsis, respectively. Since Arabidopsis aos is male-sterile [30,31], we sprayed aos with 100 µM MeJA every 3 days to restore fertility for Agrobacterium (GV3101)-mediated floral dip genetic transformation. Arabidopsis was cultured as described by An et al. [17]. Harvested Arabidopsis seeds were sterilized with bleach for 5 min and then washed 5–6 times with sterilized water. These seeds were selected on Basta (20 mg L−1) medium for the positive transgenic seedlings. The first generation of transgenic plants (T1) was confirmed by PCR amplification using HvnAOS1 and HvnAOS2-specific primers, and T2 or T3 seeds were used for further research.

2.6 Identification of male fertility and Botrytis cinerea resistance in transgenic plant

Transgenic seedlings were grown on 1/2 MS medium containing 0.8% agar, 1% sucrose, and 20 mg L−1 Basta, wild-type (WT) seedlings were grown on same medium without Basta. After germination, the WT and transgenic Arabidopsis seedlings of similar size were selected and transferred to plant in 0.35-L pots with artificial mixed soil (pindstrup substrate: organic substrate: vermiculite = 5:4:1). The pots were placed under 12 h day and 12 h night cycles at 22°C for 25 days for the identification of male fertility and resistance. Arabidopsis and B. cinerea culture and spore suspension preparation were conducted as described by An et al. [17]. Three leaves of similar size were taken from WT, aos, aos/HvnAOS1, and aos/HvnAOS2. The leaves were inoculated with 10 μL of 107 mL−1 spore suspension solution (0.025% Tween-20) and 15 μL control solution (autoclaved water and 0.025% Tween-20). The leaves were placed in a 90 mm diameter petri dish lined with moistened filter paper and sealed to keep the moisture in. Petri dishes were stored at 22°C. The diameter of the spots was counted after 2 days post-infection.

3 Results

3.1 Bioinformatics analysis of HvnAOS1 and HvnAOS2 genes

3.1.1 Cis-acting elements analysis of the promoter region

The amplified promoter region sequences of HvnAOS1 and HvnAOS2 gene were analyzed by the PlantCARE software. A large number of TATA-box and CAAT-box promoter core elements as well as light-responsive cis-acting elements were found in the promoter regions. Only three ABA, one growth hormone, and one gibberellin responsive cis-acting elements were found in HvnAOS1 promoter region (Table 1). In addition to cis-regulatory elements of anaerobic induction, fenestra cell differentiation, seed-specific regulation, and circadian rhythm control were also found in the promoter of HvnAOS2 genes (Table 1).

Table 1

Analysis of cis-acting elements in HvnAOS1 and HvnAOS2 promoter region

Element Motif Function Number
HvnAOS1 HvnAOS2
ABRE ACGTG; GCCGCGTGGC; CGCACGTGTC Cis-acting element involved in the ABA responsiveness 6 3
G-box CACGTC; TACGTG Cis-acting element involved in light responsiveness 11 11
AuxRR-core GGTCCAT Cis-acting regulatory element involved in auxin responsiveness 2 1
Box 4 ATTAAT Cis-acting element conserved DNA module involved in light responsiveness 2
CAAT-box CAAAT; CCAAT Common cis-acting element in promoter and enhancer regions 12 16
CAT-box GCCACT Cis-acting regulatory element related to meristem expression 1 2
CGTCA-motif CGTCA; TGACG Cis-acting regulatory element involved in the MeJA-responsiveness 6
MRE AACCTAA MYB binding site involved in light responsiveness 1
O2-site GATGATGTGG Cis-acting regulatory element involved in zein metabolism regulation 2
TATA-box TATA; TATAA; ATATAA; TATATA; TATATAAATC Common cis-acting element in promoter and enhancer regions 29 23
TC-rich repeats ATTCTCTAAC Cis-acting element involved in defense and stress responsiveness 1
TCA-element CCATCTTTTT Cis-acting element involved in SA responsiveness 1
ARE AAACCA Cis-acting regulatory element essential for the anaerobic induction 1
P-box TCTGTTG Gibberellin-responsive element 1
HD-Zip 1 CAAT(A/T) ATTG Element involved in differentiation of the palisade mesophyll cells 1
RY-element CATGCATG Cis-acting regulatory element involved in seed-specific regulation 1
Circadian CAAAGATATC Cis-acting regulatory element involved in circadian control 1

3.1.2 Physicochemical properties and structure analysis of HvnAOS1 and HvnAOS2 protein

HvnAOS1 and HvnAOS2 proteins are composed of 487 and 480 amino acids, with molecular masses of 53,520.79 and 52,729.72 u, total atomic number of 7,602 and 7,464, hydrophilic coefficients of −0.015 for hydrophilic proteins and 0.028 for hydrophobic proteins, theoretical isoelectric points of 8.93 and 7.65, and instability indices of 33.75 and 32.20, respectively. The α-helix, extended strand, β-turn, and random coil of HvnAOS1 and HvnAOS2 proteins accounted for 39.43, 15.61, 5.43, 39.36, and 40.62% of the total amino acids, respectively, and 39.36, 40.62, 15.62, 4.38, 39.38%, respectively. Subcellular localization prediction revealed that HvnAOS1 and HvnAOS2 were localized in the endoplasmic reticulum (Table 2).

Table 2

Physicochemical properties and structural analysis of HvnAOS1 and HvnAOS2

Protein name HvnAOS1 HvnAOS2
Molecular weight 53520.79 52729.72
Total number of atoms 7,602 7,464
Formula C2447H3821N631O691S12 C2410H3739N619O683S13
GRAVY −0.015 0.028
Theoretical pI 8.93 7.65
Instability index (II) 33.75 32.20
Aliphatic index 89.28 88.96
The proportions of α helix 39.43% 40.62%
The proportions of extended strand 15.61% 15.62%
The proportions of β turn 5.43% 4.38%
The proportions of random coil 39.36% 39.38%
Prediction of subcellular localization Endoplasmic reticulum Endoplasmic reticulum

3.1.3 Phylogenetic tree construction

The homologous protein sequences of HvnAOS1 and HvnAOS2 from qingke and 17 other plants were analyzed and their phylogenetic tree was constructed [32,33]. The results of phylogenetic tree showed that HvnAOS1 and HvnAOS2 had the highest similarity to AtsAOS2 from Aegilops tauschii subsp. strangulata (Figure 1).

Figure 1 Phylogenetic tree of HvnAOS1 and HvnAOS2 with other species. Phylogenetic analysis of HvnAOS1 and HvnAOS2 with its homologs from other species. Phylogenetic analysis of AOS from dicotyledon and monocotyledon plants using MEGA7. Branches are labeled with GenBank accession numbers and the organisms.
Figure 1

Phylogenetic tree of HvnAOS1 and HvnAOS2 with other species. Phylogenetic analysis of HvnAOS1 and HvnAOS2 with its homologs from other species. Phylogenetic analysis of AOS from dicotyledon and monocotyledon plants using MEGA7. Branches are labeled with GenBank accession numbers and the organisms.

3.1.4 Amino acid sequence alignment and molecular docking simulation

The protein sequence alignment of HvnAOS1, HvnAOS2, and other plant AOS homologs were performed using DNAMAN 7.0. The results showed that all AOS proteins have the conserved heme binding key region (Figures 2 and 3, red region), the substrate catalysis key site, and heme Fe3+ interactions key site (Figure 2). Protein binding cavity analyses revealed that the binding cavities of both HvnAOS1 and HvnAOS2 were located within the protein’s internal structure (Figure 4a and b [brown zone]).

Figure 2 Protein sequence alignment of HvnAOS1 and HvnAOS2. *: The heme Fe3+ interactions key site for HvnAOS1 and HvnAOS2; ●: The key amino acid site for substrate catalytic.
Figure 2

Protein sequence alignment of HvnAOS1 and HvnAOS2. *: The heme Fe3+ interactions key site for HvnAOS1 and HvnAOS2; ●: The key amino acid site for substrate catalytic.

Figure 3 Molecular docking simulations of HvnAOS1 and HvnAOS2. (a) Model of HvnAOS1 (green molecule) docking with heme (blue molecule) and 13(S)-HPOT (yellow molecule). (b) Model of HvnAOS2 (green molecule) docking with heme (blue molecule) and 13(S)-HPOT (yellow molecule).
Figure 3

Molecular docking simulations of HvnAOS1 and HvnAOS2. (a) Model of HvnAOS1 (green molecule) docking with heme (blue molecule) and 13(S)-HPOT (yellow molecule). (b) Model of HvnAOS2 (green molecule) docking with heme (blue molecule) and 13(S)-HPOT (yellow molecule).

Figure 4 Protein binding cavities analysis of HvnAOS1 and HvnAOS2. (a) Protein binding cavities of HvnAOS1 (brown zone). (b) Protein binding cavities of HvnAOS2 (brown zone).
Figure 4

Protein binding cavities analysis of HvnAOS1 and HvnAOS2. (a) Protein binding cavities of HvnAOS1 (brown zone). (b) Protein binding cavities of HvnAOS2 (brown zone).

Molecular docking simulations revealed that one carboxyl group on heme in HvnAOS1 forms 2.0 Å hydrogen bonds with residues ASN420 and GLN353, respectively, and another carboxyl group on heme forms 2.2 Å hydrogen bonds with residue LYS432. The 13(S)-HPOT hydroxyl atom in HvnAOS1 forms 2.7 Å hydrogen bonds with residue ASN283 and 2.0 Å with residue and the Fe3+ in heme in HvnAOS1 forms a 2.2 Å covalent bond with the sulfhydryl sulfur atom of residue CYS434. However, a carboxyl group on heme in HvnAOS2 forms a 2.3 Å hydrogen bond with residue ASN414, and another carboxyl group on heme forms a 2.0 Å hydrogen bond with residue VAL345. The 13(S)-HPOT hydrogen atom in HvnAOS2 (S)-HPOT hydroxyl hydrogen atom forms a 3.4 Å hydrogen bond with residue ASN278 and a 1.9 Å hydrogen bond with residue LYS284. The Fe3+ in heme forms a 2.8 Å covalent bond with the sulfhydryl sulfur atom of residue CYS428. These interactions are essential for HvnAOS1 and HvnAOS2 to bind the substrate 13(S)-HPOT and the catalytic factor heme (Figures 3 and 5).

Figure 5 Key amino acid sites analysis of the HvnAOS1 and HvnAOS2 interact with heme and 13(S)-HPOT. (a) Key amino acid sites analysis of the HvnAOS1 interact with heme and 13(S)-HPOT. (b) Key amino acid sites analysis of the HvnAOS2 interact with heme and 13(S)-HPOT.
Figure 5

Key amino acid sites analysis of the HvnAOS1 and HvnAOS2 interact with heme and 13(S)-HPOT. (a) Key amino acid sites analysis of the HvnAOS1 interact with heme and 13(S)-HPOT. (b) Key amino acid sites analysis of the HvnAOS2 interact with heme and 13(S)-HPOT.

3.2 Subcellular localization of HvnAOS1 and HvnAOS2

To understand the localization of HvnAOS1 and HvnAOS2 in plant, HvnAOS1:GFP and HvnAOS2:GFP were transiently expressed in protoplast. Subcellular localization of HvnAOS1 and HvnAOS2 revealed that the GFP signal was observed in cytoplasm and fibrillary. In summary, these results suggested that HvnAOS1 and HvnAOS2 were accumulated in the endoplasmic reticulum in combination with the results of prediction (Figure 6).

Figure 6 Subcellular localization of HvnAOS1 and HvnAOS2 in leaf protoplasts of qingke. HvnAOS1-GFP and HvnAOS2-GFP or GFP alone were transiently expressed in leaf protoplasts of qingke and GFP signals were examined by Laser Scanning Confocal Microscopy (Nikon C2-ER). GFP (a)–(e) the GFP fluorescence, chlorophyll autofluorescence, bright field, bright field merged, and dark field merged of 35S: GFP. (f)–(j) GFP fluorescence, chlorophyll autofluorescence, bright field, bright field merged, and dark field merged of 35S: HvnAOS1-GFP. (k)–(o). GFP fluorescence, chlorophyll autofluorescence, bright field, bright field merged, and dark field merged of 35: HvnAOS2-GFP.
Figure 6

Subcellular localization of HvnAOS1 and HvnAOS2 in leaf protoplasts of qingke. HvnAOS1-GFP and HvnAOS2-GFP or GFP alone were transiently expressed in leaf protoplasts of qingke and GFP signals were examined by Laser Scanning Confocal Microscopy (Nikon C2-ER). GFP (a)–(e) the GFP fluorescence, chlorophyll autofluorescence, bright field, bright field merged, and dark field merged of 35S: GFP. (f)–(j) GFP fluorescence, chlorophyll autofluorescence, bright field, bright field merged, and dark field merged of 35S: HvnAOS1-GFP. (k)–(o). GFP fluorescence, chlorophyll autofluorescence, bright field, bright field merged, and dark field merged of 35: HvnAOS2-GFP.

3.3 Expression pattern analysis of HvnAOS1 and HvnAOS2 by plant hormone treatment

In view of many cis-acting elements related to plant hormones in HvnAOS1 and HvnAOS2 promoter region, we tested whether HvnAOS1 and HvnAOS2 were induced by plant hormones in the leaves. The results showed that HvnAOS1 and HvnAOS2 genes were strongly induced in the leaves with JA, ABA, and SA treatments, but there was no significant induction in the leaves with GA, NAA, and 6-BA treatments (Figure 7).

Figure 7 Expression profile of HvnAOS1 and HvnAOS2 in response to exogenous hormones: (a)–(f) MeJA, methyl jasmonate; ABA, abscisic acid; SA, salicylic acid; GA, gibberellin; NAA, naphthalene acetic acid; 6-BA, 6-benzyl aminopurine. Real-time PCR data were analyzed using the comparative 2−ΔΔCt method to quantify relative gene expression.
Figure 7

Expression profile of HvnAOS1 and HvnAOS2 in response to exogenous hormones: (a)–(f) MeJA, methyl jasmonate; ABA, abscisic acid; SA, salicylic acid; GA, gibberellin; NAA, naphthalene acetic acid; 6-BA, 6-benzyl aminopurine. Real-time PCR data were analyzed using the comparative 2−ΔΔCt method to quantify relative gene expression.

3.4 Over-expression of HvnAOS1 and HvnAOS2 in Arabidopsis aos mutant restores male fertility and causes immunity recovery against B. cinerea

To efficiently test whether HvnAOS1 and HvnAOS2 are functional as AOS, we transformed HvnAOS1 and HvnAOS2 gene into the Arabidopsis aos mutant, respectively, and tested whether HvnAOS1 and HvnAOS2 can complement the JA-insensitivity-related phenotypes of aos. As described earlier, Arabidopsis aos mutant exhibited male sterility (Figure 8). However, over-expression of HvnAOS1 and HvnAOS2 in Arabidopsis aos mutant restored its male fertility, indicating that HvnAOS1 and HvnAOS2 are capable of the function on male fertility.

Figure 8 Flower morphological phenotypes of aos mutants transformed with HvnAOS1 and HvnAOS2, respectively, at the T1 generation. (a) Inflorescences of WT, aos, and transformants. (b) Flowers of WT, aos, and transformants. (c) Fully developed siliques of WT, aos, and transformants.
Figure 8

Flower morphological phenotypes of aos mutants transformed with HvnAOS1 and HvnAOS2, respectively, at the T1 generation. (a) Inflorescences of WT, aos, and transformants. (b) Flowers of WT, aos, and transformants. (c) Fully developed siliques of WT, aos, and transformants.

JA is one of the major defense hormones in plants, and the Arabidopsis JA biosynthesis mutant aos are highly susceptible to the necrotrophic pathogen B. cinerea. In this study, we tested whether HvnAOS1 and HvnAOS2 are able to complement the function on defense against B. cinerea in the aos mutant. When inoculated B. cinerea on Arabidopsis leaves, the aos mutant exhibited high susceptibility to B. cinerea (Figure 9). However, the HvnAOS1 and HvnAOS2 complementation on the aos mutant were similar to the wild type Arabidopsis in terms of resistance (Figure 9). Taken together, HvnAOS1 and HvnAOS2 share the similar function with Arabidopsis AOS gene on male fertility and plant resistance to B. cinerea.

Figure 9 Susceptibility of aos transformants with HvnAOS1 and HvnAOS2, respectively, to B. cenerea: (a) WT control, (b) aos control, (c) WT inoculated with B. cenerea, (d) aos inoculated with B. cenerea, (e) aos/HvnAOS1, and (f) aos/HvnAOS2 inoculated with B. cenerea.
Figure 9

Susceptibility of aos transformants with HvnAOS1 and HvnAOS2, respectively, to B. cenerea: (a) WT control, (b) aos control, (c) WT inoculated with B. cenerea, (d) aos inoculated with B. cenerea, (e) aos/HvnAOS1, and (f) aos/HvnAOS2 inoculated with B. cenerea.

4 Discussion

AOS is one of the crucial synthase enzymes in the JA biosynthesis pathway in plants, belonging to the CYP74A family within the cytochrome P450 supergene family [34–37]. Due to its involvement in the JA-related stress responses, growth developmental regulation, and hormone signaling pathways in plants, AOS genes have been a prominent subject of research in different plant species. Additionally, AOS plays distinct physiological roles in plants, further highlighting its significance. As a result, AOS remains a focal point of investigation, with numerous unknown functions awaiting discovery [38]. There are currently very few studies on the structure, expression pattern, and function of AOS, and only a few studies have been reported in Arabidopsis and rice, so it is particularly important to study the structure, expression pattern, and function of HvnAOS1 and HvnAOS2.

In this study, we cloned HvnAOS1 and HvnAOS2 genes and their promoter regions, and analyzed their bioinformatics, expression patterns, and functions. The elements in the promoter regions of HvnAOS1 and HvnAOS2 are significantly different. They are likely to have different expression patterns and functions under different conditions. The HvnAOS1 promoter region contains a number of phytohormone-responsive cis-elements, whereas the promoter region of HvnAOS2 lacks phytohormone-responsive elements. Instead, it contains specific cis-regulatory elements related to anaerobic induction, mesophyll cell differentiation, seed-specific regulation, and diurnal rhythm control. HvnAOS1 is likely to be involved in JA synthesis under normal barley conditions or in common stress responses. On the other hand, HvnAOS2 may play a role in JA synthesis in specific tissues or under specific conditions. HvnAOS1 and HvnAOS2 have similar physicochemical properties, but HvnAOS1 is hydrophilic whereas HvnAOS2 is hydrophobic.

The predication results indicated that HvnAOS1 and HvnAOS2 were found to be located in the endoplasmic reticulum. However, some studies have found that the subcellular localization of AOS were different among different plants. Most plant AOS possess typical chloroplast transit peptides and are primarily located in chloroplasts. However, recent studies indicate that barley AOSs does not have chloroplast transit peptides, and AOSs in some plants can be detected within specific organelles such as PhAOS from Parthenium hysterophorus L. which is localized in intracellular rubber particles [39,40].

Molecular docking simulation of the key residues in the different interaction patterns of HvnAOS1 and HvnAOS2 indicated that HvnAOS1 interacts with 13(S)-HPOT at residue ASN283 and with heme Fe3+ at residue CYS434. HvnAOS2 interacts with 13(S)-HPOT at residue ASN278 and with heme Fe3+ at residue CYS428. Interestingly, these two key interaction sites are the same amino acid residues in both HvnAOS1 and HvnAOS2. Li et al. [16] investigated the crystal structure of PaAOS and iron porphyrin from Parthenium argentatum and its complex with the substrate analogue 13(S)-HODE and its intermolecular interactions, and found that the ASN-276 residue in PaAOS is in the active site and very close to heme, and that this amino acid site is highly conserved among AOS from different species, ASN-276 is thought to play an important role in substrate catalysis, and the CYS-426 residue forms a covalent bond with Fe3+ in the center of heme, which is thought to play an important role in the binding to heme. The results in this study are consistent with the reports, which suggest that these interactions are highly conserved in AOS and are important sites of action for AOS function. In addition, HvnAOS1 and HvnAOS2 are capable of complementing the Arabidopsis aos mutant, suggesting that HvnAOS1 and HvnAOS2 have similar functions as the Arabidopsis AOS gene.

In conclusion, we have identified two AOS genes HvnAOS1 and HvnAOS2 from hulless barley “Kunlun 15” that controlled the dehydration of fatty acid hydroperoxides to allene oxides. HvnAOS1 and HvnAOS2 were highly induced by JA, ABA, and SA. HvnAOS1 and HvnAOS2 mainly accumulated in the cell cytoplasm of the N. benthamiana leaves. Overexpression of HvnAOS1 and HvnAOS2 in Arabidopsis aos mutant restored male fertility and plant resistance to B. cinerea, indicating that HvnAOS1 and HvnAOS2 can restore the functions of AOS in Arabidopsis aos mutant. This study will provide a reference for research on the acid oxydase synthase and regulation of JA synthesis in qingke. It is important to note that the specific AOS genes and their functions can vary among different plant species, and further research is needed to explore the diversity and functional significance of AOS genes in various plants.

  1. Funding information: This study was financially supported by National Natural Science Foundation of China (NSFC) (32060423), National Natural Science Foundation of China (NSFC), Key Program of Regional Innovation and Development Joint Fund (U22A20453), and China Agriculture Research System (CARS-05-01A-05).

  2. Author contributions: Likun An: methodology, software, formal analysis, and writing – original draft preparation editing and review; Ziao Wang: formal analysis, software, writing, data curation, investigation, and writing – original draft; Yongmei Cui: investigation, resources, and data curation; Xiaohua Yao: formal analysis; Youhua Yao: data curation; Yuehai Liu: software; Yixiong Bai: investigation; Xin Li: supervision; Wu Kunlun: project administration, funding acquisition, and resources.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Li J, Yao X, Yao Y, An L, Feng Z, Wu K. Genome-wide association mapping of hulless barely phenotypes in drought environment. Front Plant Sci. 2022;13(13):924892–903.10.3389/fpls.2022.924892Search in Google Scholar PubMed PubMed Central

[2] An LK, Yao XH, Yao YH, Cui YM, Bai YX, Li X, et al. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley. Open Life Sci. 2023;18(1):1–14.10.1515/biol-2022-0543Search in Google Scholar PubMed PubMed Central

[3] Wang YL, Yuan HJ, Zha S, Jabu T, Xu QJ. Comparative proteomic based analysis of grain nutrients in two hulless barley cultivars. Agron J. 2021;113(5):3886–99.Search in Google Scholar

[4] Yu L, Ma Y, Zhao Y, Pan Y, Tian R, Yao X, et al. Effect of hulless barley flours on dough rheological properties, baking quality, and starch digestibility of wheat bread. Front Nutr. 2021;8(8):785847–60.10.3389/fnut.2021.785847Search in Google Scholar PubMed PubMed Central

[5] Sang Z, Zhang MJ, Mu W, Yang HZ, Yang CB, Xu QJ. Phytohormonal and transcriptomic response of hulless barley leaf in response to powdery mildew infection. Agronomy. 2021;11(6):2–24.10.3390/agronomy11061248Search in Google Scholar

[6] Wu KL, Yao XH, Yao YH, Chi DZ, Feng ZY. Analysis of the relationship between Wx gene polymorphisms and amylose content in hulless barley. Czech J Genet Plant Breed. 2017;4:144–52.10.17221/105/2016-CJGPBSearch in Google Scholar

[7] Wang Y, Yuan H, Zha S, Jabu T, Xu Q. Comparative proteomic based analysis of grain nutrients in two hulless barley varieties (Hordeum vulgare L.). Agron J. 2021;113:3886–99.10.1002/agj2.20804Search in Google Scholar

[8] Gan LP, Wu XL, Zhong Y. Exogenously applied nitric oxide enhances the drought tolerance in hulless barley. Plant Prod Sci. 2015;18(1):52–6.10.1626/pps.18.52Search in Google Scholar

[9] An LK. Function of maize jasmonic acid signaling receptor gene family ZmCOIs. Nanjing: Nanjing Agricultural University; 2018.Search in Google Scholar

[10] Yan Y, Borrego E, Kolomiets MV. Jasmonate biosynthesis, perception and function in plant development and stress responses. Lipid Metab. 2013;16:394–442.10.5772/52675Search in Google Scholar

[11] Yang L, Sun QG, Geng BH, Shi J, Zhu HF, Sun YM, et al. Jasmonate biosynthesis enzyme allene oxide cyclase 2 mediates cold tolerance and pathogen resistance. Plant Physiol. 2023;00:1–14.10.1093/plphys/kiad362Search in Google Scholar PubMed

[12] Wu H, Ye HY, Yao RF, Zhang T, Xiong LZ. OsJAZ9 acts as a transcriptional regulator in jasmonate signaling and modulates salt stress tolerance in rice. Plant Sci. 2015;232:1–12.10.1016/j.plantsci.2014.12.010Search in Google Scholar PubMed

[13] Ramala MA, Cheng C, Jia S, Wei W, Hong R, Muhammad A, et al. Interruption of jasmonic acid biosynthesis causes differential responses in the roots and shoots of maize seedlings against salt stress. Int J Mol Sci. 2019;20(24):6202.10.3390/ijms20246202Search in Google Scholar PubMed PubMed Central

[14] Yan YX, Shawn C, Tom I, Jurgen E, Robert M, Allison H, et al. Disruption of OPR7 and OPR8 reveals the versatile functions of jasmonic acid in maize development and defense. Plant Cell. 2012;24(4):1420–36.10.1105/tpc.111.094151Search in Google Scholar PubMed PubMed Central

[15] Yang DL, Yao J, Mei CS, Tong XH, Zeng LJ, Li Q, et al. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc Natl Acad Sci U S A. 2012;109(19):1192.10.1073/pnas.1201616109Search in Google Scholar PubMed PubMed Central

[16] Li LN, Chang ZZ, Pan ZQ, Fu ZQ, Wang XQ. Modes of heme binding and substrate access forcytochrome P450 CYP74A revealed by crystalstructures of allene oxide synthase. PNAS. 2008;105(37):13883–8.10.1073/pnas.0804099105Search in Google Scholar PubMed PubMed Central

[17] An LK, Ahmad M, Ren H, Qin J, Yan YX. Asmonate signal receptor gene family ZmCOIs restore male fertility and defense response of Arabidopsis mutant coi1-1. J Plant Growth Regul. 2019;38(2):479–93.10.1007/s00344-018-9863-2Search in Google Scholar

[18] Zhang TF. The role of allene oxidizing synthase genes OsAOS1 and OsAOS2 in regulation of jasmonic acid synthesis and insect resistance induced by insect pests in rice. Hangzhou: Zhejiang University; 2013.Search in Google Scholar

[19] Ziegler J, Keinnen M, Baldwin IT. Herbivore-induced allene oxide synthase transcripts and jasmonic acid in nicotiana attenuata. Phytochemistry. 2001;58(5):729–38.10.1016/S0031-9422(01)00284-9Search in Google Scholar

[20] Xiong J, Liu L, Ma X, Li F, Tang C, Li Z, et al. Characterization of PtAOS1 promoter and three novel interacting proteins responding to drought in Poncirus trifoliata. Int J Mol Sci. 2020;21(13):2–15.10.3390/ijms21134705Search in Google Scholar PubMed PubMed Central

[21] Hilda P, Graciela R, Sergio A, Otto M, Ingrid R, Hugo P, et al. Salt tolerant tomato plants show increased levels of jasmonic acid. Plant Growth Regul. 2003;41(2):149–58.10.1023/A:1027311319940Search in Google Scholar

[22] Serrazina S, Machado H, Costa R, Duque P, Rui M. Expression of castanea crenata allene oxide synthase in arabidopsis improves the defense to Phytophthora cinnamomi. Vol. 12. New York, United States: Cold Spring Harbor Laboratory; 2021. p. 628697.10.3389/fpls.2021.628697Search in Google Scholar PubMed PubMed Central

[23] Karsten K, Ingrid R, Hugo PC. Inhibition of wound-induced accumulation of allene oxide synthase transcripts in flax leaves by aspirin and salicylic acid. Plant Physiol. 1998;118(3):1057–65.10.1104/pp.118.3.1057Search in Google Scholar PubMed PubMed Central

[24] Wu JJ, Wu Q, Wu QJ, Gai JY, Yu DY. Constitutive overexpression of AOS-like gene from soybean enhanced tolerance to insect attack in transgenic tobacco. Biotechnol Lett. 2008;30(9):1693–8.10.1007/s10529-008-9742-1Search in Google Scholar PubMed

[25] Liu CH, Liang NS, Yu L, Zhao XT, Cao Y, Zhan YG. Sequence and expression analyses of allene oxide synthase gene FmAOS in Fraxinus mandschurica. Plant Physiol. 2018;54(5):855–62.Search in Google Scholar

[26] Ayaz A, Huang H, Zheng M, Zaman W, Li D, Saqib S, et al. Molecular Cloning and functional analysis of gmlacs2-3 reveals its involvement in cutin and suberin biosynthesis along with abiotic stress tolerance. Int J Mol Sci. 2021;22:9175.10.3390/ijms22179175Search in Google Scholar PubMed PubMed Central

[27] Ayaz A, Saqib S, Huang H, Zaman W, Lü S, Zhao H. Genome-wide comparative analysis of long-chain acyl-CoA synthetases (LACSs) gene family: a focus on identification, evolution and expression profiling related to lipid synthesis. Plant Physiol Biochem. 2021;161:1–11.10.1016/j.plaphy.2021.01.042Search in Google Scholar PubMed

[28] Naeem M, Shahzad K, Saqib S, et al. The Solanum melongena COP1LIKE manipulates fruit ripening and flowering time in tomato (Solanum lycopersicum). Plant Growth Regul. 2022;96:369–82.10.1007/s10725-021-00785-7Search in Google Scholar

[29] Chen Y, Chen L, Zhou Q. Genetic association between eNOS gene polymorphisms and risk of carotid atherosclerosis. Herz. 2021;46:253–64.10.1007/s00059-020-04995-zSearch in Google Scholar PubMed

[30] Farmer EE, Goossens A. Jasmonates: what allene oxide synthase does for plants. J Exp Botany. 2019;70(13):3373–8.10.1093/jxb/erz254Search in Google Scholar PubMed PubMed Central

[31] Malek VB, Graaff EV, Schneitz K, Keller B. The arabidopsis male-sterile mutant dde2-2 is defective in the allene oxide synthase gene encoding one of the key enzymes of the jasmonic acid biosynthesis pathway. Planta. 2002;216:187–92.10.1007/s00425-002-0906-2Search in Google Scholar PubMed

[32] Sunera A, Saqib S, Uddin S, Zaman W, Ullah F, Ayaz A, et al. Characterization and phytostimulatory activity of bacteria isolated from tomato (Lycopersicon esculentum Mill.) rhizosphere. Microb Pathog. 2020;140:103966.10.1016/j.micpath.2020.103966Search in Google Scholar PubMed

[33] Saqib S, Zaman W, Ayaz A, Habib S, Ullah F. Postharvest disease inhibition in fruit by synthesis and characterization of chitosan iron oxide nanoparticles. Biocatal Agric Biotechnol. 2020;28:101729.10.1016/j.bcab.2020.101729Search in Google Scholar

[34] Ruan J, Zhou Y, Zhou M, Yan J, Khurshid M, Weng W, et al. Jasmonic acid signaling pathway in plants. Int J Mol Sci. 2019;20:2479.10.3390/ijms20102479Search in Google Scholar PubMed PubMed Central

[35] Wang J, Song L, Gong X, Xu J, Li M. Functions of jasmonic acid in plant regulation and response to abiotic stress. Int J Mol Sci. 2020;21(4):1446.10.3390/ijms21041446Search in Google Scholar PubMed PubMed Central

[36] Ghorbel M, Brini F, Sharma A, Landi M. Role of jasmonic acid in plants: the molecular point of view. Plant Cell Rep. 2021;40:1471–94.10.1007/s00299-021-02687-4Search in Google Scholar PubMed

[37] Sood M. Jasmonates: “The master switch” for regulation of developmental and stress responses in plants. J Plant Growth Regul. 2023;42:5247–65.10.1007/s00344-023-11047-3Search in Google Scholar

[38] Zeng JM, Zhang TF, Huangfu JY, Li R, Lou YG. Both allene oxide synthases genes are involved in the biosynthesis of herbivore-induced jasmonic acid and herbivore resistance in rice. Plants. 2021;10(3):442.10.3390/plants10030442Search in Google Scholar PubMed PubMed Central

[39] Pan Z, Durst F, Werck RD, Gardner HW, Camara B, Cornish K, et al. The major protein of guayule rubber particles is a cytochrome P450 characterization based on CDNA cloning and spectroscopic analysis of the solubilized enzyme and its reaction products. J Biol Chem. 1995;270(15):8487–94.10.1074/jbc.270.15.8487Search in Google Scholar PubMed

[40] Wu JJ, Chen GT, Li YQ. Expression analysis of allylene oxide synthase gene LjAOS in Flos Lonicera L. Lishizhen Med Mater Med Res. 2012;23(4):945–7.Search in Google Scholar
Received: 2023-10-17
Revised: 2024-02-06
Accepted: 2024-03-13
Published Online: 2024-04-25

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
https://doi.org/10.1515/biol-2022-0855
Keywords for this article
qingke; allene oxide synthase; HvnAOS1 and HvnAOS2 genes; bioinformatics analysis; molecular docking simulation
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 25.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0855/html
Scroll to top button