Startseite Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
Artikel Open Access

Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease

  • Fen Wang , Xiao-Yu Cheng , Yu-Ting Zhang , Qing-Ran Bai , Xiao-Qi Zhang , Xi-Cai Sun , Quan-Hong Ma , Xiong-Fei Zhao EMAIL logo und Chun-Feng Liu EMAIL logo
Veröffentlicht/Copyright: 24. Februar 2024
Artikel downloaden (PDF)
Open Life Sciences
Aus der Zeitschrift Open Life Sciences Band 19 Heft 1

Abstract

Parkinson’s disease (PD) is a ubiquitous brain cell degeneration disease and presents a significant therapeutic challenge. By injecting 6-hydroxydopamine (6-OHDA) into the left medial forebrain bundle, rats were made to exhibit PD-like symptoms and treated by intranasal administration of a low-dose (2 × 105) or high-dose (1 × 106) human neural stem cells (hNSCs). Apomorphine-induced rotation test, stepping test, and open field test were implemented to evaluate the motor behavior and high-performance liquid chromatography was carried out to detect dopamine (DA), 3,4-dihydroxyphenylacetic acid (DOPAC), serotonin, and 5-hydroxyindole-3-acetic acid in the striatum of rats. Animals injected with 6-OHDA showed significant motor function deficits and damaged dopaminergic system compared to the control group, which can be restored by hNSCs treatment. Treatment with hNSCs significantly increased the tyrosine hydroxylase-immunoreactive cell count in the substantia nigra of PD animals. Moreover, the levels of neurotransmitters exhibited a significant decline in the striatum tissue of animals injected with 6-OHDA when compared to that of the control group. However, transplantation of hNSCs significantly elevated the concentration of DA and DOPAC in the injured side of the striatum. Our study offered experimental evidence to support prospects of hNSCs for clinical application as a cell-based therapy for PD.

Keywords: neural stem cell; motor behavior; dopamine; Parkinson’s disease; neurodegenerative disease; stem cell transplantation

1 Introduction

Parkinson’s disease (PD) is a chronic neurological disease caused by the decay or breakdown of the neurons in the brain that are responsible for producing dopamine [1,2]. PD exhibits a variety of clinical manifestations, encompassing both motor and non-motor symptoms, compared with other motor deficit diseases [3–7]. Neural stem cells (NSCs) have shown potential as a therapeutic option for PD due to their ability to replace damaged or lost neurons [8]. In 1992, Weiss and Reynolds [9] separated NSCs from the striatum of adult mice and first employed epidermal growth factor (EGF) to stimulate the growth and division of NSCs in vitro. Subsequently, studies have shown that the joint application of EGF and basic fibroblast growth factor (bFGF) can effectively promote the proliferation and self-renewal of NSCs, leading to the development of neurospheres derived from mammalian tissues [10,11]. However, to advance cell therapies, specifically those utilizing human NSCs (hNSCs), from the experimental stage to clinical application, it is necessary to establish stringent protocols for cell production and preservation following the regulations of good manufacturing practice (GMP).

To assess the feasibility of using hNSCs in a clinical study aiming at PD patients, we conducted a preclinical study to evaluate the efficacy of hNSCs in reducing neurological deficits in a rodent model of PD.

2 Methods and materials

2.1 Generation of hNSCs

hNSCs were derived from aborted fetal brain tissue (8–12 gestational week), which was obtained with full parental permission and approval from the Institutional Ethics Committee (2011 NO.103). Fetal midbrain tissue was separated and dissected at GMP facilities (Angecon Biotech, China), and then digested with papain (200 U/10 mL, Worthington, USA) for 30 min. The prepared single cell concentration was 1.0 × 105 cells/mL and cultured with serum-free NSCs medium (Angecon Biotech, China), which consisted of a 1:1 mixture of Dulbecco’s modified Eagle’s medium and Ham’s F12 (Invitrogen), supplemented with B27 (2% v/v; Invitrogen), GlutaMAX (2% v/v; Invitrogen), MEM sodium pyruvate (2% v/v; Invitrogen), N2 formulation (1% v/v; Invitrogen), NAC (1.63 mg/mL; Sigma), bFGF (20 ng/mL; PEPROTECH), EGF (20 ng/mL; PEPROTECH), and LIF (10 ng/mL; PEPROTECH). The primary cells were grown for a period of 12–14 days in a humidified incubator at 37°C and 5% CO2. Then the neurospheres were dissociated with TrypLETM Express (Invitrogen, USA) to single cells, and seeded into the new T75 flasks at a concentration of 1 × 105 cells/mL. Under the same culture conditions, hNSCs were further cultured and passaged, then frozen and stored in the three-level cell banks: the Seed Cell Bank (SCB, P3), the Master Cell Bank (MCB, P5), and the Working Cell Bank (WCB, P8).

Cell preparation: Cells in WCB were thawed and cultured for 14 days, then digested into single cells and washed with normal saline twice, then adjusted to the final concentrations of 2 × 105 cells/10 µL and 1 × 106 cells/10 µL, and packed.

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance with the tenets of the Helsinki Declaration, and has been approved by the Institutional Ethics Committee (2011 NO.103). The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals, and has been approved by the Institutional Ethics Committee of the Second Affiliated Hospital of Soochow University (201511A113).

2.2 Identification of hNSCs

2.2.1 Phenotype detection

The cell samples were subjected to centrifugation (500×g, 3 min), and the resulting supernatant was removed. Cells were fixed using a fixation/permeabilization kit (BD, USA) and then incubated at 4°C for 15 min. Next, 400 μL cleaning solution was added, and the cells were centrifuged again (500×g, 3 min). The cells were buffered in PBS for intracellular staining and incubated with Alexa Fluor® 647 Mouse Nestin (560393, BD) and Alexa Fluor® 488 Mouse anti-Sox2 (560301, BD), and then washed twice. Finally, 500 μL PBS was added to resuspend the cells, and detection was performed using flow cytometry (Cytoflex, Beckman) [12].

2.2.2 Differentiation potential

The 12-well plates were coated with poly-l-lysine (P4707, Sigma, Germany) and hNSC neurospheres were inoculated together with the medium into the well-coated plates for adherent culture. After 5–8 h of culture, the neurospheres were fully adhered to the plates, and then the medium without cytokines was added in place of the original medium. After 2 weeks of culture, the cells were dispersed and adhered to the bottom, and spontaneously differentiated. The fixed differentiated cells were then exposed to a permeabilization mixture containing 10% normal donkey serum, 0.1% Triton, and PBS for 1 h. Then the cells were treated with primary antibodies (B-tubulin [T8860 sigma, Germany], GFAP [Z0334 DAKO, Denmark], and O4 [MAB345 Millipore, USA]) and incubated to allow for binding at 4°C overnight. After that, the cells were rinsed to remove any unbound primary antibodies and then incubated with secondary antibodies and DAPI. Images were taken using a fluorescence microscope (DMI 3000, Laica, Germany).

2.2.3 Genetic test

Cells were lysed with Rneasy Mini Kit (Qiagen, Germany) and RNA was separated based on the manufacturer’s specified guidelines. RNA quantity was determined by QubitTM RNA HS Assay Kit using a Qubit Fluorometer (Life Technology, USA). RNAs were converted into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Switzerland). Light Cycler 480 SYBR Green I Master was used for qRT-PCR on a Light cycler 96 system (Roche, Switzerland). The specific primer sequences are outlined below: NCAM (Forward: GGCATTTACAAGTGTGTGGTTAC; Reverse: TTGGCGCATTCTTGAACATGA), NGFR (Forward: CCTACGGCTACTACCAGGATG; Reverse: CACACGGTGTTCTGCTTGT), Sox2 (Forward: TACAGCATGTCCT ACTCGCAG; Reverse: GAGGAAGAGGTAACCACAGGG), Pax6 (Forward: TGGGCAGGTATTACGAGACTG; Reverse: ACTCCCGCTTATACTGGGCTA), and GAPDH (Forward: GTGGACCTGACCTGCCGTCT; Reverse: GGAGGAGTGGGTGTCGCTGT).

2.2.4 Karyotype test

Standard G-Band analysis was used for sample processing, and BX53 microscope (Olympus) was used to take photos. Chromosome numbers were calculated, and its characteristics were observed through images, and chromosome karyotype matching was carried out. At least 20 cell groups were selected from each sample for observation and counting to check whether there were abnormal conditions such as chromosome deletion and ectopic.

2.3 Animals

The animal protocol was approved by the Institutional Ethics Committee of the Second Affiliated Hospital of Soochow University (201511A113). Adult Sprague Dawley rats of both genders (180 ± 10 g) were sourced from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China). The rats were accommodated (five rats per cage) in a temperature-controlled room (22–25°C) with 12 h light/dark cycle. Food and water were offered to the rats without limitation. All animal procedures adhered to the established guidelines of the Animal Use and Care Committee of Soochow University. Fifty-six rats were used to build PD models by 6-hydroxydopamine (6-OHDA, H116, Sigma, USA) injection and 42 rats were successfully modeled. The rats were allocated to four groups at random: (1) sham group (n = 10), (2) PD model group (6-OHDA, n = 14, male, 7; female, 7), (3) low-dose hNSCs group (2 × 105 hNSCs, n = 9, male, 4; female, 5), and (4) high-dose hNSCs group (1 × 106 hNSCs, n = 19, male, 9; female, 10). All rats in (2), (3), and (4) groups were given saline or hNSCs suspension intranasally once a week for 4 weeks. After the first hNSCs/saline treatment, apomorphine (APO)-induced rotation test, stepping test, and open field test were performed every 2 weeks for 12 weeks.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals, and was approved by the Institutional Ethics Committee of the Second Affiliated Hospital of SoochowUniversity (201511A113).

2.4 Establishment of 6-OHDA-induced PD rat model

The rats were administered 3% isoflurane until the loss of righting reflex was observed, following which anesthesia was maintained using 1.5% isoflurane, and the rats were secured in a stoelting stereotaxic apparatus (RWD Co., Shenzhen, China). The rat brain atlas was consulted to determine the location [13]. 6-OHDA in saline (16 μg/8 μL) was administered via injection into the left medial forebrain bundle (MFB) through a 10 μL Hamilton syringe at a speed of 0.5 μL/min. The left MFB’s coordinates (two spots) were as follows: (1) −1.8 mm anteroposterior, −2.5 mm mediolateral, and −7.5 mm dorsoventral; (2) −1.8 mm anteroposterior, −2.5 mm mediolateral, and −8.0 mm dorsoventral (from the dura) from the bregma. The syringe was slowly extracted from the MFB after remaining in place for a duration of 4 min. Following a 3-week healing period after the surgery, apomorphine hydrochloride (APO, 013-18313, Wako, Japan)-induced rotation tests were performed. Only rats that displayed a rotational frequency above 210 turns per 30 min during rotation tests were deemed eligible for inclusion in the PD model [14].

2.5 Intranasal administration of hNSCs

Rats were anesthetized via inhalation of isoflurane gas delivered in a flow of oxygen, with a concentration of 3.0% for induction and 1.5% for maintenance. The rats were then positioned in the supine position. Each rat was given 10 μL (5 μL/side) of hNSCs cell suspension or saline bilaterally. A thin hose of 0.5–0.7 cm in length was placed at the needle of the microsyringe. The cells suspension was absorbed and extended into the left nasal cavity, and slowly injected into the nasal cavity and maintained its posture for 5 min. After 15 min, the cell suspension was given to the right nostril in the same way. After administration, the rats were kept in supine position for 5 min. Anesthesia was discontinued and the rats were returned to their cages when aroused [12,15].

2.6 Behavioral experiments

2.6.1 APO-induced rotation test

Using a video camera, the contralateral rotations caused by APO (0.25 mg/kg, subcutaneous) were measured and documented for a period of 30 min during each recording session [16].

2.6.2 Stepping test

While securing the hindlimbs of the rat with one hand, the experimenter ensured that the forelimbs of rats were unconstrained but kept in touch with the table. The rat was repositioned to the side (90 cm in 5 s) in the forehand direction, and the frequency of steps to both forelimbs was counted and documented [17].

2.6.3 Open field test

The rat was placed in the middle of a cubic container (80 × 80 × 40 cm3) that was equipped with a camera. The behavioral box had a black-colored interior and bottom surface, which contrasted with the rats’ coloring. Using a Flex field/Open Field Activity System (ANY-maze; Stoelting, Wood Dale, IL, USA), the locomotor tracks of the rats were continually recorded. The observations of each rat were conducted and recorded for 300 s, and the process was repeated three times at 10 min intervals.

2.7 Immunostaining of tyrosine hydroxylase (TH)

To determine the viability of the TH neurons in the substantia nigra (SN), we performed immunostaining as described previously [18].

2.8 High-performance liquid chromatography (HPLC)

At the 12th week, after behavioral determination, dopamine (DA), 3,4-dihydroxyphenylacetic acid (DOPAC), 5-hydroxyindole-3-acetic acid (5-HIAA), and serotonin (5-HT) in the striatum were detected by HPLC with an electrochemical detector (Antec, Zoeterwoude, Netherlands). The striatal tissues were lysed and centrifuged at 12,000 rpm for 20 min at 4°C in 4% perchloric acid. The supernatants were filtered through a 0.22 μm syringe filter before applying to the HPLC system. A mobile phase contained NaH2PO4 100 mM, sodium octanesulfonate 0.74 mM, EDTA-Na2 0.027 mM, KCl 2 mM, and 15% (vol/vol) methanol. A C18 chromatographic column (2.1 mm, 100 mm, 3 mm, Antec) was used to analyze the qualitative and quantitative content of neurotransmitter. The standard substances (DA, H8502; DOPAC, 11569; 5-HT, H7877; 5-HIAA, H8876, purchased from Sigma) were used for quantitative analysis, and the neurotransmitter was analyzed at a speed of 0.20 mL/min by the HPLC pump.

2.9 Statistical analysis

Data gathered from behavioral tests and HPLC were checked for normality of distribution and homogeneity of variance and displayed as mean ± SEM. Data of behavioral tests were analyzed using the repeated measurement ANOVA followed by multiple comparisons performed by SPSS 22.0 statistical software. Data of HPLC were analyzed with Kruskal–Wallis test and Dunnett non-parametric test for further multiple comparison test. Differences with p-values less than 0.05 (two sided) were deemed to be statistically significant.

3 Results

3.1 Characteristics of hNSCs

Flow cytometry was used to monitor the phenotype of NSCs. The expressions of Nestin and SOX2 were higher than 90% (Figure 1a). Fluorescence photomicrograph showed that NSCs could different into neurons (B-tubulin positive), astrocyte (GFAP positive), and oligogendrocyte (O4 positive) (Figure 1b). qRT-PCR indicated that the expressions of specific genes of NSCs (SOX2, NCAM, NGFR, and Pax6) were significantly higher than that of peripheral blood mononuclear cells (Figure 1c). The karyotype of the cell line was normal (46, XX) (Figure 1d). As a summary, these results signify that the quality of NSCs meets the requirements.

Figure 1 Characteristics of hNSCs: (a) phenotype detection, (b) differentiation potential, (c) specific gene expression, and (d) karyotype test. Scale bar: 100 μm, TUB: B-tubulin; GFAP: glial fibrillary acidic protein.
Figure 1

Characteristics of hNSCs: (a) phenotype detection, (b) differentiation potential, (c) specific gene expression, and (d) karyotype test. Scale bar: 100 μm, TUB: B-tubulin; GFAP: glial fibrillary acidic protein.

3.2 APO-induced rotation test

After the 6-OHDA injection, the statistical analysis demonstrated a significant difference in the count of rotations induced by APO between the animals that received the injections and the sham group (Figure 2a). In addition, we observed that the 6-OHDA injections resulted in alterations in the motor function of the animals. At the 10th and 12th week, the number of APO-induced rotation in both 2 × 105 and 1 × 106 hNSCs group was significantly lower than that in 6-OHDA model group, respectively (p < 0.01 and p < 0.05) (Figure 2a). The rotations did not exhibit any significant differences between low-dose and high-dose hNSCs treatment group.

Figure 2 Behavior test of rats in all groups: (a) APO rotation test, (b) stepping test, and (c) open field test. **: p < 0.01, 6-OHDA group vs sham group; +: p < 0.05, 6-OHDA + 2 × 105 hNSCs group vs 6-OHDA group; ++: p < 0.01, 6-OHDA + 2 × 105 hNSCs group vs 6-OHDA group; #: p < 0.05, 6-OHDA + 1 × 106 hNSCs group vs 6-OHDA group; ##: p < 0.01, 6-OHDA + 1 × 106 hNSCs group vs 6-OHDA group.
Figure 2

Behavior test of rats in all groups: (a) APO rotation test, (b) stepping test, and (c) open field test. **: p < 0.01, 6-OHDA group vs sham group; +: p < 0.05, 6-OHDA + 2 × 105 hNSCs group vs 6-OHDA group; ++: p < 0.01, 6-OHDA + 2 × 105 hNSCs group vs 6-OHDA group; #: p < 0.05, 6-OHDA + 1 × 106 hNSCs group vs 6-OHDA group; ##: p < 0.01, 6-OHDA + 1 × 106 hNSCs group vs 6-OHDA group.

3.3 Stepping test

There was a statistically significant difference observed in the number of steps between the PD model group and the sham group, with the former showing a lower count. At the 10th week, the number of steps observed in the 2 × 105 hNSCs treatment group was significantly greater than that in the 6-OHDA model group (p < 0.05). Moreover, there were also significant differences between 1 × 106 hNSCs treatment group and 6-OHDA model group at the 10th and 12th week after hNSCs administration (p < 0.05). At other time points, the differences were not significant (Figure 2b).

3.4 Open field test

Rats were filmed while freely moving in a square flat arena for 300 s and the path followed by the animals was tracked and analyzed. The total traveled distance of rats in the 6-OHDA group showed a trend of reduction compared to the sham group, but the difference did not reach statistical significance. The results did not show any significant differences in the traveled distance between hNSCs treatment group and 6-OHDA model group at all time points (Figure 2c).

3.5 Immunostaining of TH in the SN

Following the motor function test, we conducted immunohistochemical analysis to investigate the recovery of dopaminergic neurons in the SN using the TH antibody. The 6-OHDA injected animals showed significantly reduced TH intensity both in the injured and contralateral side of SN in comparison to the control rats. However, TH intensity was restored in the PD rats treated with 1 × 106 hNSCs (Figure 3).

Figure 3 Representative images of TH immunoreactivity in the SN from rats. The right side of each panel shows the injected effect of 6-OHDA. TH signal was not significantly different between the 6-OHDA + 2 × 105 hNSCs group and the 6-OHDA group (7.19 ± 1.35 vs 4.94 ± 0.67, p = 0.15), but was significantly higher in the 6-OHDA + 1 × 106 hNSCs group compared to that of the 6-OHDA group (25.19 ± 8.02 vs 4.94 ± 0.67, p < 0.05). n ≥ 3 in each group.
Figure 3

Representative images of TH immunoreactivity in the SN from rats. The right side of each panel shows the injected effect of 6-OHDA. TH signal was not significantly different between the 6-OHDA + 2 × 105 hNSCs group and the 6-OHDA group (7.19 ± 1.35 vs 4.94 ± 0.67, p = 0.15), but was significantly higher in the 6-OHDA + 1 × 106 hNSCs group compared to that of the 6-OHDA group (25.19 ± 8.02 vs 4.94 ± 0.67, p < 0.05). n ≥ 3 in each group.

3.6 Levels of DA, DOPAC, 5-HIAA, and 5-HT in the striatum

HPLC was utilized to measure the contents of DA, DOPAC, 5-HIAA, and 5-HT in the injured side of striatum at the 12th week in all groups. As shown in Figure 4, the contents of DA, DOPAC, and 5-HT in the injured side of striatum in the 6-OHDA group exhibited a statistically significant reduction contrasted with the sham group (p < 0.01). The content of 5-HIAA showed a decreased trend but the difference did not meet the threshold for statistical significance. After hNSCs administration, the content of DA and DOPAC in the injured side were significantly increased in 1 × 106 hNSCs group, respectively, compared to those of the 6-OHDA group (p < 0.05). The content of 5-HIAA was significantly increased in the 2 × 105 hNSCs group, compared to that of the 6-OHDA group (p < 0.05).

Figure 4 Concentration of DA (a), DOPAC (b), 5-HIAA (c), and 5-HT (d) in the injured side of striatum. 6-OHDA: 6-hydroxydopamine; hNSCs: human neural stem cells; DA: dopamine; DOPAC: dihydroxyphenyl acetic acid; 5-HT: serotonin; 5-HIAA: 5-hydroxyindole-3-acetic acid. *: p < 0.05; **: p < 0.01.
Figure 4

Concentration of DA (a), DOPAC (b), 5-HIAA (c), and 5-HT (d) in the injured side of striatum. 6-OHDA: 6-hydroxydopamine; hNSCs: human neural stem cells; DA: dopamine; DOPAC: dihydroxyphenyl acetic acid; 5-HT: serotonin; 5-HIAA: 5-hydroxyindole-3-acetic acid. *: p < 0.05; **: p < 0.01.

4 Discussion

Recent studies have confirmed the feasibility and safety of employing NSCs clinically to manage various neurodegenerative conditions, including amyotrophic lateral sclerosis [19,20], spinal cord injury [21], Alzheimer’s disease [22,23], and Huntington’s disease [24,25]. Some studies have offered evidence to support the idea that the replacement of cells could have the ability to reverse the neurobehavioral symptoms in certain patients with neurodegenerative diseases [6,10,26,27]

In order to establish a stringent protocol before the clinical application of hNSCs, a clearly defined animal model of PD was employed in this study. The results of the APO-induced rotation test (Figure 2a) demonstrated that the rats injected with 6-OHDA had a pronounced turning behavior, indicating a significant impairment in the proper functioning of the brain’s dopamine-producing system in contrast to that of the sham group. Furthermore, the animals’ movement was also found to be impaired, as determined by the stepping test. As evaluated through neurobehavioral tests, significant enhancements in motor performance were observed in the PD animals following hNSCs treatment in comparison to the untreated PD group (Figure 2). In addition, treatment with hNSCs significantly increased the quantity of cells expressing TH in the SN of PD animals. Moreover, we found animals receiving 6-OHDA injection showed a significant reduction in the levels of DA, DOPAC, 5-HIAA, and 5-HT in the injured side of striatum when contrasted with sham group. However, administration of hNSCs led to a significant increase in levels of the neurotransmitter dopamine and its metabolite DOPAC in the injured side of the striatum (Figures 3 and 4). These results in the present study indicated that hNSCs significantly improve the motor behavior and increase the striatal dopamine in the rat model of PD.

There have been several preclinical studies that have demonstrated the potential of NSCs as a therapeutic option for PD [28–34]. The level of DA transporter immunoreactivity in the host brain tissue was found to be positively linked to the degree of functional recovery observed [35]. Simultaneous transplantation of NSCs overexpressing glial cell line-derived neurotrophic factor and fetal dopaminergic neurons was found to mitigate motor symptoms in a rat model of PD in one study [28]. The secretome of human NSCs was characterized in another study, which revealed that its application partially modulated DA neurons cell survival and improved the motor deficits of PD animals [30]. Qian et al. observed an increase in the suitability of host brain environments following the co-transplantation of NSCs overexpressing Nurr1 and microglia [32]. Using a high-throughput quantitative proteomic approach, Zuo et al. characterized the protein profiles of brain regions associated with PD in 6-OHDA-injected Parkinsonian mice, including the striatum, SN, olfactory bulb, and subventricular zone [33]. Human NSC-derived extracellular vesicles exhibited neuroprotective properties by decreasing reactive oxygen species and pro-inflammatory cytokines in an in vitro transwell system and a PD model [36]. Consistent with these findings, our current study validated that hNSCs significantly improved motor behavior and increased striatal dopamine levels in PD rats. Additionally, we evaluated the efficiency of varying doses of hNSCs and found that the impact of hNSCs on motor function was dependent on the dosage.

The underlying mechanisms of the hNSCs’ effects on PD are not fully understood. By replacing the lost dopaminergic neurons in the SN, hNSCs may restore the production of dopamine and improve the symptoms of PD [37–42]. hNSCs may also secrete neurotrophic factors, which are proteins that support the survival and expansion of neurons [43–45]. Neurotrophic factors may help protect and promote the growth of dopaminergic neurons in the SN, potentially slowing or halting the advancement of PD [33]. In addition, hNSCs may have immunomodulatory effects, meaning they can regulate the immune response in the brain [43]. PD is associated with inflammation in the brain, and hNSCs may be able to reduce this inflammation, leading to a reduction in the symptoms of the disease [46]. Finally, hNSCs may also have a neuroprotective effect. They may be able to protect existing neurons from further damage, potentially slowing the progression of the disease [30,47]. Human embryonic stem cell transplantation clinical trials for PD treatment are presently ongoing in Australia < NCT02452723 > [48] and China < NCT03119636 (Chinese ASZQ-003) > [49], and other trials are set to commence soon [50,51].

5 Conclusions

In conclusion, transplantation of hNSCs improves symptomatic motor behavior, prevents symptom progress, and increases striatal dopamine in a rat model of PD, which indicates that hNSCs have the possibility of being a preventive and therapeutic method for PD. Our study offers experimental evidence for the potential use of hNSCs in cell-based therapy for PD in clinical settings.

  1. Funding information: This project was supported by the funding of National Key R&D Program of China (2019YFA 0110102) and Jiangsu Provincial Medical Key Discipline (ZDXK202217).

  2. Author contributions: Fen Wang, Xiao-Yu Cheng, and Yu-Ting Zhang performed the experiments and analyzed the data. Fen Wang drafted the manuscript. Chun-Feng Liu, Quan-Hong Ma, and Qing-Ran Bai designed the experiments and supervised the project. Xiong-Fei Zhao, Xiao-Qi Zhang, and Xi-Cai Sun isolated and cultured the hNSCs. All authors were involved in data quantification and contributed to the manuscript revision.

  3. Conflict of interest Xiong-Fei Zhao, Xiao-Qi Zhang, and Xi-Cai Sun are employees of Shanghai Angecon Biotechnology Co., Ltd, Shanghai, China. They provided hNSCs, and are responsible for identifying the characteristics, purity, and differentiation of hNSCs in vitro. Remaining authors declare no conflicts of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Elsworth JD. Parkinson’s disease treatment: past, present, and future. J Neural Transm (Vienna). 2020;127:785–91.10.1007/s00702-020-02167-1Suche in Google Scholar PubMed PubMed Central

[2] Abeliovich A, Gitler AD. Defects in trafficking bridge Parkinson’s disease pathology and genetics. Nature. 2016;539:207–16.10.1038/nature20414Suche in Google Scholar PubMed

[3] Deweerdt S. Parkinson’s disease: 4 big questions. Nature. 2016;538:S17.10.1038/538S17aSuche in Google Scholar PubMed

[4] Shi Z, Luo K, Jani S, February M, Fernandes N, Venkatesh N, et al. Mimicking partial to total placental insufficiency in a rabbit model of cerebral palsy. J Neurosci Res. 2022;100(12):2138–53.10.1002/jnr.24901Suche in Google Scholar PubMed PubMed Central

[5] Vasquez-Vivar J, Shi Z, Jeong JW, Luo K, Sharma A, Thirugnanam K, et al. Neuronal vulnerability to fetal hypoxia-reoxygenation injury and motor deficit development relies on regional brain tetrahydrobiopterin levels. Redox Biol. 2020;29:101407.10.1016/j.redox.2019.101407Suche in Google Scholar PubMed PubMed Central

[6] Shi Z, Luo K, Deol S, Tan S. A systematic review of noninflammatory cerebrospinal fluid biomarkers for clinical outcome in neonates with perinatal hypoxic brain injury that could be biologically significant. J Neurosci Res. 2022;100(12):2154–73.10.1002/jnr.24801Suche in Google Scholar PubMed PubMed Central

[7] Shi Z, Vasquez-Vivar J, Luo K, Yan Y, Northington F, Mehrmohammadi M, et al. Ascending lipopolysaccharide-induced intrauterine inflammation in near-term rabbits leading to newborn neurobehavioral deficits. Dev Neurosci. 2018;40(5–6):534–46.10.1159/000499960Suche in Google Scholar PubMed PubMed Central

[8] Harrower TP, Tyers P, Hooks Y, Barker RA. Long-term survival and integration of porcine expanded neural precursor cell grafts in a rat model of Parkinson’s disease. Exp Neurol. 2006;197:56–69.10.1016/j.expneurol.2005.07.026Suche in Google Scholar PubMed

[9] Reynolds BA, Weiss S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 1992;255:1707–10.10.1126/science.1553558Suche in Google Scholar PubMed

[10] Profico DC, Gelati M, Ferrari D, Sgaravizzi G, Ricciolini C, Projetti Pensi M, et al. Human neural stem cell-based drug product: clinical and nonclinical characterization. Int J Mol Sci. 2022;23(21):13425.10.3390/ijms232113425Suche in Google Scholar PubMed PubMed Central

[11] Lindvall O, Odin P. Clinical application of cell transplantation and neurotrophic factors in CNS disorders. Curr Opin Neurobiol. 1994;4:752–7.10.1016/0959-4388(94)90019-1Suche in Google Scholar PubMed

[12] Lu MH, Ji WL, Chen H, Sun YY, Zhao XY, Wang F, et al. Intranasal transplantation of human neural stem cells ameliorates Alzheimer’s disease-like pathology in a mouse model. Front Aging Neurosci. 2021;13:650103.10.3389/fnagi.2021.650103Suche in Google Scholar PubMed PubMed Central

[13] Johnson GA, Calabrese E, Badea A, Paxinos G, Watson C. A multidimensional magnetic resonance histology atlas of the Wistar rat brain. Neuroimage. 2012;62:1848–56.10.1016/j.neuroimage.2012.05.041Suche in Google Scholar PubMed PubMed Central

[14] Huang YX, Luo WF, Li D, Hu WD, Liu CF. CSC counteracts l-DOPA-induced overactivity of the corticostriatal synaptic ultrastructure and function in 6-OHDA-lesioned rats. Brain Res. 2011;1376:113–21.10.1016/j.brainres.2010.12.070Suche in Google Scholar PubMed

[15] Ji G, Liu M, Zhao XF, Liu XY, Guo QL, Guan ZF, et al. NF-κB signaling is involved in the effects of intranasally engrafted human neural stem cells on neurofunctional improvements in neonatal rat hypoxic-ischemic encephalopathy. CNS Neurosci Ther. 2015;21(12):926–35.10.1111/cns.12441Suche in Google Scholar PubMed PubMed Central

[16] Gu XS, Wang F, Zhang CY, Mao CJ, Yang J, Yang YP, et al. Neuroprotective effects of paeoniflorin on 6-ohda-lesioned rat model of Parkinson’s disease. Neurochem Res. 2016;41(11):2923–6.10.1007/s11064-016-2011-0Suche in Google Scholar PubMed

[17] Kirik D, Rosenblad C, Björklund A. Characterization of behavioral and neurodegenerative changes following partial lesions of the nigrostriatal dopamine system induced by intrastriatal 6-hydroxydopamine in the rat. Exp Neurol. 1998;152(2):259–77.10.1006/exnr.1998.6848Suche in Google Scholar PubMed

[18] Ardah MT, Bharathan G, Kitada T, Haque ME. Ellagic acid prevents dopamine neuron degeneration from oxidative stress and neuroinflammation in MPTP model of Parkinson’s disease. Biomolecules. 2020;10(11):1519.10.3390/biom10111519Suche in Google Scholar PubMed PubMed Central

[19] Morata-Tarifa C, Azkona G, Glass J, Mazzini L, Sanchez-Pernaute R. Looking backward to move forward: a meta-analysis of stem cell therapy in amyotrophic lateral sclerosis. NPJ Regen Med. 2021;6:20.10.1038/s41536-021-00131-5Suche in Google Scholar PubMed PubMed Central

[20] Wang J, Hu W, Feng Z, Feng M. BDNF-overexpressing human umbilical cord mesenchymal stem cell-derived motor neurons improve motor function and prolong survival in amyotrophic lateral sclerosis mice. Neurol Res. 2021;43:199–209.10.1080/01616412.2020.1834775Suche in Google Scholar PubMed

[21] Chen WC, Liu WF, Bai YY, Zhou YY, Zhang Y, Wang CM, et al. Transplantation of mesenchymal stem cells for spinal cord injury: a systematic review and network meta-analysis. J Transl Med. 2021;19(1):178.10.1186/s12967-021-02843-0Suche in Google Scholar PubMed PubMed Central

[22] Karvelas N, Bennett S, Politis G, Kouris NI, Kole C. Advances in stem cell therapy in Alzheimer’s disease: a comprehensive clinical trial review. Stem Cell Investig. 2022;9:2.10.21037/sci-2021-063Suche in Google Scholar PubMed PubMed Central

[23] Hu J, Wang X. Alzheimer’s disease: from pathogenesis to mesenchymal stem cell therapy – bridging the missing link. Front Cell Neurosci. 2021;15:811852.10.3389/fncel.2021.811852Suche in Google Scholar PubMed PubMed Central

[24] Dunnett SB, Rosser AE. Stem cell transplantation for Huntington’s disease. Exp Neurol. 2007;203:279–92.10.1016/j.expneurol.2006.11.007Suche in Google Scholar PubMed

[25] Li M, Rosser AE. Pluripotent stem cell-derived neurons for transplantation in Huntington’s disease. Prog Brain Res. 2017;230:263–81.10.1016/bs.pbr.2017.02.009Suche in Google Scholar PubMed

[26] Mazzini L, Gelati M, Profico DC, Sgaravizzi G, Projetti Pensi M, Muzi G, et al. Human neural stem cell transplantation in ALS: initial results from a phase I trial. J Transl Med. 2015;13:17.10.1186/s12967-014-0371-2Suche in Google Scholar PubMed PubMed Central

[27] Mazzini L, Gelati M, Profico DC, Sorarù G, Ferrari D, Copetti M, et al. Results from Phase I clinical trial with intraspinal injection of neural stem cells in amyotrophic lateral sclerosis: a long-term outcome. Stem Cell Transl Med. 2019;8(9):887–97.10.1002/sctm.18-0154Suche in Google Scholar PubMed PubMed Central

[28] Deng X, Liang Y, Lu H, Yang Z, Liu R, Wang J, et al. Co-transplantation of GDNF-overexpressing neural stem cells and fetal dopaminergic neurons mitigates motor symptoms in a rat model of Parkinson’s disease. PLoS One. 2013;8(12):e80880.10.1371/journal.pone.0080880Suche in Google Scholar PubMed PubMed Central

[29] Madhavan L, Daley BF, Paumier KL, Collier TJ. Transplantation of subventricular zone neural precursors induces an endogenous precursor cell response in a rat model of Parkinson’s disease. J Comp Neurol. 2009;515:102–15.10.1002/cne.22033Suche in Google Scholar PubMed PubMed Central

[30] Mendes-Pinheiro B, Teixeira FG, Anjo SI, Manadas B, Behie LA, Salgado AJ. Secretome of undifferentiated neural progenitor cells induces histological and motor improvements in a rat model of Parkinson’s disease. Stem Cell Transl Med. 2018;7(11):829–38.10.1002/sctm.18-0009Suche in Google Scholar PubMed PubMed Central

[31] Moon J, Schwarz SC, Lee HS, Kang JM, Lee YE, Kim B, et al. Preclinical analysis of fetal human mesencephalic neural progenitor cell lines: characterization and safety in vitro and in vivo. Stem Cell Transl Med. 2017;6(2):576–88.10.5966/sctm.2015-0228Suche in Google Scholar PubMed PubMed Central

[32] Qian Y, Chen XX, Wang W, Li JJ, Wang XP, Tang ZW, et al. Transplantation of Nurr1-overexpressing neural stem cells and microglia for treating Parkinsonian rats. CNS Neurosci Ther. 2020;26(1):55–65.10.1111/cns.13149Suche in Google Scholar PubMed PubMed Central

[33] Zuo F, Xiong F, Wang X, Li X, Wang R, Ge W, et al. Intrastriatal transplantation of human neural stem cells restores the impaired subventricular zone in Parkinsonian mice. Stem Cell. 2017;35(6):1519–31.10.1002/stem.2616Suche in Google Scholar PubMed

[34] Zheng Y, Zhou J, Wang Y, Fan F, Liu S, Wang Y. Neural stem/progenitor cell transplantation in Parkinson’s rodent animals: a meta-analysis and systematic review. Stem Cell Transl Med. 2022;11(4):383–93.10.1093/stcltm/szac006Suche in Google Scholar PubMed PubMed Central

[35] Richardson RM, Broaddus WC, Holloway KL, Fillmore HL. Grafts of adult subependymal zone neuronal progenitor cells rescue hemiparkinsonian behavioral decline. Brain Res. 2005;1032:11–22.10.1016/j.brainres.2004.10.043Suche in Google Scholar PubMed

[36] Lee EJ, Choi Y, Lee HJ, Hwang DW, Lee DS. Human neural stem cell-derived extracellular vesicles protect against Parkinson’s disease pathologies. J Nanobiotechnol. 2022;20:198.10.1186/s12951-022-01356-2Suche in Google Scholar PubMed PubMed Central

[37] Zhu Q, Ma J, Yu L, Yuan C. Grafted neural stem cells migrate to substantia nigra and improve behavior in Parkinsonian rats. Neurosci Lett. 2009;462:213–8.10.1016/j.neulet.2009.07.008Suche in Google Scholar PubMed

[38] Yoon HH, Min J, Shin N, Kim YH, Kim JM, Hwang YS, et al. Are human dental papilla-derived stem cell and human brain-derived neural stem cell transplantations suitable for treatment of Parkinson’s disease? Neural Regen Res. 2013;8(13):1190–200.10.4103/1673-5374.112856Suche in Google Scholar

[39] Shin ES, Hwang O, Hwang YS, Suh JK, Chun YI, Jeon SR. Enhanced efficacy of human brain-derived neural stem cells by transplantation of cell aggregates in a rat model of Parkinson’s disease. J Korean Neurosurg Soc. 2014;56(5):383–9.10.3340/jkns.2014.56.5.383Suche in Google Scholar PubMed PubMed Central

[40] Mine Y, Momiyama T, Hayashi T, Kawase T. Grafted miniature-swine neural stem cells of early embryonic mesencephalic neuroepithelial origin can repair the damaged neural circuitry of Parkinson’s disease model rats. Neuroscience. 2018;386:51–67.10.1016/j.neuroscience.2018.06.007Suche in Google Scholar PubMed

[41] Kim HW, Lee HS, Kang JM, Bae SH, Kim C, Lee SH, et al. Dual effects of human placenta-derived neural cells on neuroprotection and the inhibition of neuroinflammation in a rodent model of Parkinson’s disease. Cell Transpl. 2018;27(5):814830.10.1177/0963689718766324Suche in Google Scholar PubMed PubMed Central

[42] Han F, Wang W, Chen B, Chen C, Li S, Lu X, et al. Human induced pluripotent stem cell-derived neurons improve motor asymmetry in a 6-hydroxydopamine-induced rat model of Parkinson’s disease. Cytotherapy. 2015;17(5):665–79.10.1016/j.jcyt.2015.02.001Suche in Google Scholar PubMed

[43] Song JJ, Oh SM, Kwon OC, Wulansari N, Lee HS, Chang MY, et al. Cografting astrocytes improves cell therapeutic outcomes in a Parkinson’s disease model. J Clin Invest. 2018;128(1):463–82.10.1172/JCI93924Suche in Google Scholar PubMed PubMed Central

[44] Novosadova EV, Nenasheva VV, Makarova IV, Dolotov OV, Inozemtseva LS, Arsenyeva EL, et al. Parkinson’s disease-associated changes in the expression of neurotrophic factors and their receptors upon neuronal differentiation of human induced pluripotent stem cells. J Mol Neurosci. 2020;70(4):514–21.10.1007/s12031-019-01450-5Suche in Google Scholar PubMed

[45] Conese M, Cassano R, Gavini E, Trapani G, Rassu G, Sanna E, et al. Harnessing stem cells and neurotrophic factors with novel technologies in the treatment of Parkinson’s disease. Curr Stem Cell Res Ther. 2019;14(7):549–69.10.2174/1574888X14666190301150210Suche in Google Scholar PubMed

[46] Hoban DB, Howard L, Dowd E. GDNF-secreting mesenchymal stem cells provide localized neuroprotection in an inflammation-driven rat model of Parkinson’s disease. Neuroscience. 2015;303:402–11.10.1016/j.neuroscience.2015.07.014Suche in Google Scholar PubMed

[47] Kim SW, Woo HJ, Kim EH, Kim HS, Suh HN, Kim SH, et al. Neural stem cells derived from human midbrain organoids as a stable source for treating Parkinson’s disease: midbrain organoid-NSCs (Og-NSC) as a stable source for PD treatment. Prog Neurobiol. 2021;204:102086.10.1016/j.pneurobio.2021.102086Suche in Google Scholar PubMed

[48] Garitaonandia I, Gonzalez R, Christiansen-Weber T, Abramihina T, Poustovoitov M, Noskov A, et al. Neural stem cell tumorigenicity and biodistribution assessment for phase I clinical trial in Parkinson’s disease. Sci Rep. 2016;6:34478.10.1038/srep34478Suche in Google Scholar PubMed PubMed Central

[49] Wang YK, Zhu WW, Wu MH, Wu YH, Liu ZX, Liang LM, et al. Human clinical-grade parthenogenetic ESC-derived dopaminergic neurons recover locomotive defects of nonhuman primate models of Parkinson’s disease. Stem Cell Rep. 2018;11(1):171–82.10.1016/j.stemcr.2018.05.010Suche in Google Scholar PubMed PubMed Central

[50] Takahashi J. iPS cell-based therapy for Parkinson’s disease: a Kyoto trial. Regen Ther. 2020;13:18–22.10.1016/j.reth.2020.06.002Suche in Google Scholar PubMed PubMed Central

[51] Barker RA, Parmar M, Studer L, Takahashi J. Human trials of stem cell-derived dopamine neurons for Parkinson’s disease: dawn of a new era. Cell Stem Cell. 2017;21:569–73.10.1016/j.stem.2017.09.014Suche in Google Scholar PubMed

Received: 2023-09-25
Revised: 2024-01-15
Accepted: 2024-01-16
Published Online: 2024-02-24

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
https://doi.org/10.1515/biol-2022-0834
Schlagwörter für diesen Artikel
neural stem cell; motor behavior; dopamine; Parkinson’s disease; neurodegenerative disease; stem cell transplantation
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 26.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0834/html
Button zum nach oben scrollen