Home IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
Article Open Access

IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury

  • Xiaokeya Yasen , Renaguli Aikebaier , Atiguli Maimaiti and Munire Mushajiang EMAIL logo
Published/Copyright: March 30, 2024

Abstract

Radiotherapy for treating breast cancer is associated with cardiac damage. This study aimed to investigate the role of the interleukin (IL)-33/soluble receptor ST2 (sST2) axis in radiation-induced cardiac injury. Expressions of IL-33 and sST2 were detected in breast cancer patients following radiotherapy, radiation-induced cardiac damaged mice model, and cardiomyocytes using quantitative real-time PCR (qRT-PCR) and immunohistochemical assay. Cardiac injury was evaluated through an ultrasound imaging system and hematoxylin & eosin staining. The transcriptional factor was assessed using dual-luciferase reporter assay and chromatin immunoprecipitation. The results indicated that IL-33 and sST2 were highly expressed in breast cancer patients, which further elevated post-6 months but reduced after 12 months of radiotherapy. Radiation induces cardiac dysfunction and elevated IL-33 and sST2 levels in a time-dependent manner. However, silencing of IL-33 decreased sST2 expression to alleviate radiation-induced cardiac dysfunction. The IL-33 could be transcriptional activated by TCF7L2 by binding to IL33 promoter sites, which mutation alleviated cardiomyocyte injury caused by radiation. Additionally, radiation treatment resulted in higher levels of TCF7L2, IL-33, and sST2 in cardiomyocytes, and TCF7L2 knockdown reduced IL-33 and sST2 expression. In conclusion, TCF7L2 transcriptional-activated IL-33 mediated sST2 to regulate radiation-induced cardiac damage, providing novel insights into radiotherapy-induced cardiac damage.

Graphical abstract

1 Introduction

Breast cancer remains the leading cause of cancer-associated death in women worldwide [1]. The treatment strategy for breast cancer has enormously improved in recent years, and radiotherapy has proven effective in controlling the disease and improving survival rates [2]. Regional lymph node irradiation provides better coverage of the target area and reduces long-term toxicity in patients [2]. Nonetheless, the heart is often exposed during breast cancer radiotherapy, thereby elevating the risk of radiation-associated cardiac damage [3]. Generally, the heart receives a dose of 1–5 Gy; however, regional lymph node radiation usually results in a higher dose to the heart, inducing non-breast cancer-related death [4,5]. Although not absolute, the heart-exposed dose is associated with the development of cardiovascular disease [4,6] Therefore, it is imperative to elucidate the underlying mechanisms of radiation-induced heart damage and to provide novel preventive strategies.

Interleukin (IL)-33, a tissue-derived nuclear cytokine, is a member of the IL-1 family expressed in endothelial, epithelial, and fibroblast cells [7], playing a vital role in cell homeostasis, immune response, and tissue regeneration [8,9]. IL-33 is upregulated in barrier sites and serves its functions by mediating the suppression of tumorigenicity 2 (ST2), encoded by IL-1 receptor like-1 (IL-1RL1) [10]. The ST2 belongs to the IL-1 receptor family and exists in two isoforms, namely transmembrane (ST2L) and soluble (sST2) [11]. It has been reported that the IL-33/ST2 axis was involved in several pathologic processes, including organ fibrosis [12], autoimmune disease [13], cancers [14], and nerve injury [15]. IL-33 and sST2 are both associated with the development and metastasis of breast cancer [16,17]. Additionally, IL-33 has also been found to have cardioprotective effects, which are inhibited by sST2, a decoy receptor [18]. However, whether IL-33 is involved in cardiac injury after radiotherapy by regulating the sST2 receptor has not been elaborated.

This study investigated the involvement of the IL-33/sST2 axis in radiation-induced cardiac injury to provide potential novel targets for treating cardiac damage post-radiotherapy in breast cancer patients.

2 Materials and methods

2.1 Subjects

A total of 300 subjects were enrolled in this study, among which 50 were healthy individuals, 50 patients with breast cancer before radiotherapy, 50 patients who received radiotherapy once, 50 patients post 1 month of radiotherapy, 50 patients post 6 months of radiotherapy, and 50 patients post 12 months of radiotherapy. All patients had tumors in their left breast and had not received any other treatments. Whole blood samples were collected from all subjects, allowed to stand for 30 min, and then centrifuged at 3,000 rpm for 10 min to collect the serum, which was then stored at −80°C until further use. The clinical information of patients with breast cancer is shown in Table 1.

Table 1

Clinical details of patients with breast cancer

Parameters Number
Age (median with range) 51 (23–84)
pT stage (tumor size)
pTis 15
pT1 (≤2 cm) 123
pT2 (2 < T ≤ 5) 104
pT3 (>5) 8
Lymph node metastasis (N stage)
pN0 (0) 125
pN1 (1–3) 60
pN2 (4–9) 52
pN3 (≥10) 13
Estrogen receptor status
Negative 41
Positive 209
Progesterone receptor status
Negative 48
Positive 202
HER2 status
Negative 172
Positive 48
Unknown 30
Clinical TNM stage
0 11
I 61
II 95
III 83
  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance with the tenets of the Helsinki Declaration, and has been approved by the Ethics Committee of Cancer Hospital Affiliated to Xinjiang Medical University.

2.2 Animal model establishment

C57BL/6 mice (4–6 weeks old, 20 ± 2 g, female) were purchased from Charles River (Beijing, China). After 1 week of acclimatization, the mice were divided into five groups (n = 6/group): control, RT, RT + 1W, RT + 2W, and RT + 4W. The mice in the control group were anesthetized by intraperitoneal injection of 2% isoflurane with sham radiation and euthanized 4 weeks later, while other group animals were used to establish the radiation-induced heart damage (RIHD) model. Briefly, the mice were anesthetized using the same method as the control, immobilizing their limbs in the supine position, and their heart was irradiated with a 6 MV energy X-ray beam with 14 Gy/1 Fx dose using a medical linear accelerator (Varian Trilogy, FL, USA) as previously described [19]. The mice were euthanized with radiation for once, and 1, 2, and 4 weeks of radiation.

To explore the role of IL-33 in vivo, short hairpin RNA (sh)-IL-33 and its negative control (sh-NC) were synthesized by GenePharma (Shanghai, China). The mice were divided into four groups (n = 6/group): control, RT + 2W, RT + 2W + sh-NC, and RT + 2W + sh-IL-33. sh-IL-33 and sh-NC were packaged in lentivirus. The mice were anesthetized by 2% isoflurane to expose the hearts. Lentivirus (10 μL, 109 PFU/mL) were administrated through vein injection for 3 consecutive days. Then, the mouse hearts were irradiated with X-ray for 2 weeks.

  1. Ethics statement: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and has been approved by the Ethics Committee of Cancer Hospital Affiliated to Xinjiang Medical University.

2.3 Cardiac function analysis

Cardiac function was measured before euthanasia. The left ventricular ejection fraction, left ventricular end-diastolic dimension (LVEDD), and systolic left ventricular diameter (SLVD) were assessed by transthoracic ultrasound using a Vevo2100 high-resolution ultrasound imaging system (VisualSonics, USA).

2.4 Hematoxylin & eosin (H&E) staining assay

Following euthanasia, the heart from all animals was surgically excised after perfusing 20 mL phosphate buffer saline (PBS) through systemic circulation, followed by fixation in 4% polyformaldehyde and sliced into 4 μm paraffin sections using a microtome. The sections were subjected to H&E staining for assessing tissue pathology, where after dewaxing and dehydration, the sections were stained with hematoxylin (Aladdin, Shanghai, China) for 5 min, washed, and counterstained with 0.5% eosin (Aladdin, Shanghai, China) for 3 min.

2.5 Immunohistochemical (IHC) assay

The heart tissue sections were dewaxed and rehydrated, and endogenous peroxidase activity was eliminated using 3% hydrogen peroxide, followed by blocking them with normal goat serum in PBS. The sections were then incubated overnight with primary antibodies against IL-33 and sST2 at 4°C, followed by incubation with a secondary antibody for 30 min at 37°C. Diaminobenzidine solution (Aladdin, Shanghai, China) was employed for 10 min for displaying sections color. After washing in running water, the sections were dehydrated, permeated, sealed, and viewed under a light microscope.

2.6 Cell culture and radiation

Rat cardiomyocytes (H9C2) were purchased from the ATCC and maintained in Dulbecco’s modified eagle’s medium (Hyclone, South Logan, UT, USA) containing 10% fetal bovine serum (Hyclone) and 1% penicillin/streptomycin at 37°C with 95% air and 5% CO2. The cells received the 6 MV X-ray beam energy with 0, 2, 4, and 8 Gy using a medical linear accelerator for 48 h. Additionally, the cells received 8 Gy X-rays for 0, 12, 24, and 48 h. Radiation parameters were set as previously described [19].

2.7 Quantitative real-time PCR (qRT-PCR)

Total RNA was isolated from the serum of patients with breast cancer, mouse heart, and H9C2 cells using TRIzol reagent (Invitrogen, ThermoFisher Scientific, MA, USA). The cDNA was synthesized using the TaqMan™ Reverse Transcription Reagents (Invitrogen). Then, qPCR was carried out using the ABsolute qPCR low ROX Mix (ThermoFisher Scientific) on the ABI PRISM 7500 system according to the manufacturer’s protocol. The reaction mixture contains Absolute blue SYBP Green ROX (12.5 μL), forward primer (1.75 μL), reverse primer (1.75 μL), cDNA (2 μL), and nuclease-free water (7 μL). The reaction conditions were 95°C for 15 min, 40 cycles of 95°C for 15 s, 56°C for 30 s, and 72°C for 30 s. GAPDH served as the control. The mRNA expression was calculated by the 2−ΔΔCt method. The primer sequences are shown in Table 2.

Table 2

Specific primer sequences used in qRT-PCR

Name Species Sequences (forward 5ʹ–3ʹ) Sequences (reverse 5ʹ–3ʹ)
IL-33 Human GGTGACGGTGTTGATGGT TGGTCTGGCAGTGGTTTT
sST2 Human CAGGAAAGAAATCGTGTGT GCCAAGAACTGAGTGCCT
IL-33R Human CTCTACAACTGGACAGCACCTC TGCGTCCTCAGTCATCACAT
IL-1RAcP Human AGTGATGCCTCAGAACGC TGGGCTGTGCTGTAGTTG
GADPH Human GACCTGACCTGCCGTCTA AGGAGTGGGTGTCGCTGT
IL-33 Mouse ATTTCCCCGGCAAAGTTCAG AACGGAGTCTCATGCAGTAGA
sST2 Mouse TGACACCTTACAAAACCCGGA AGGTCTCTCCCATAAATGCACA
GAPDH Mouse AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
TCF7L2 Rat AAGTGCGTTCGCTACATACA CAGAGGATCAGGCTTCAGG
IL-33 Rat GACAGCACATCAGGCAGAG TGAGGCCAGAACGGAGC
sST2 Rat AGCGCCTGTTCAGTGGTT TGGTTCCGTTCTCCGTGT
GAPDH Rat AACTCCCTCAAGATTGTCAGC GAGCCCTTCCACGATGC

2.8 Western blotting

Total proteins were extracted from mouse heart tissues and H9C2 cells using RIPA lysis buffer. Proteins from the serum of participants were extracted using the serum protein extraction kit (Solarbio, Beijing, China). After concentration was measured using a BCA protein assay kit (Solarbio), the protein samples were run on 15% SDS-PAGE and transferred to polyvinylidene fluoride membranes. After blocking, the membranes were incubated with primary antibodies targeting IL-33 (ab118503; Abcam, Cambridge, UK), sST2 (ab25877; Abcam), TCF7L2 (sc-271287, Santa Cruz Biotechnology, Santa Cruz, CA, USA), GAPDH (ab9485; Abcam) at 4°C overnight, followed by incubation with anti-rabbit (ab6721; Abcam) or anti-mouse (ab205719; Abcam) conjugated to horse radish peroxidase at 25°C for 1 h. The band signals were visualized using an ECL substrate (Solarbio).

2.9 Bioinformatic analysis

The DNA motif of TCF7L2 and the binding sites between TCF72L and IL33 promoter were predicted by the JASPAR online tool (http://jaspar.genereg.net/).

2.10 Chromatin immunoprecipitation (CHIP)

A CHIP assay kit was purchased from Beyotime (Shanghai, China). H9C2 cells were cross-linked with 1% methanol for 10 min at 37°C, followed by washing with 1 mM PMSP in PBS and lysed using the SDS lysis buffer containing 1 mM phenylmethanesulfonyl fluoride for 10 min. The DNA was cleaved with ultrasonic treatment, followed by centrifuging and diluting samples using a ChIP dilution buffer. It was proceeded by incubating samples with Protein A + G Agarose/Salmon Sperm DNA for 30 min at 4°C. After centrifugation, the supernatant was incubated with anti-TCF7L2 and anti-IgG antibodies overnight at 4°C. Afterward, washing with low and high salt, and LiCl immune complex buffers in sequence, the enrichment of IL-33 was detected using qRT-PCR.

2.11 Luciferase reporter analysis

IL33 promoter sequences and mutant sequences were amplified and inserted into the pmiR-GLO vector (Promega, Madison, WI, USA). The H9C2 cells were seeded into 24-well plates and co-transfected the wild-type or mutant sequences recombinant plasmids (lipofectamine 2000) along with TCF7L2 overexpressing and empty vectors. Following 48 h, the luciferase activity was detected using the dual-luciferase reporter assay system (Promega).

2.12 Cell transfection

H9C2 cells were seeded in six-well plates and cultured until 80% cell confluence. Sh-TCF7L2 and sh-NC were purchased from Genepharma. These vectors were transfected into H9C2 cells using lipofectamine 3000 (Invitrogen). After 48 h, cells were harvested and TCF7L2 expression was measured using qRT-PCR.

2.13 Determination of lactic dehydrogenase (LDH) activity

LDH activity in H9C2 cells were measured using a LDH activity assay kit (Elabscience, Wuhan, China). Briefly, H9C2 cells were homogenated in PBS. After centrifuging at 10,000g for 10 min, the supernatant was collected. The protein concentration was detected using a BCA kit (Elabscience). The supernatant (20 μL) was incubated with 25 μL substrate buffer and 5 μL coenzyme I at 37°C for 15 min. Next, 25 μL chromogenic agent was added to incubate with the mixture at 37°C for 15 min. After adding alkali reagent, the absorbance was measured using a microplate reader.

2.14 Statistical analysis

All data were analyzed with one-way ANOVA among multiple groups using the GraphPad Prism 8 statistics software. P < 0.05 was considered a significant difference.

3 Results

3.1 IL-33 and sST2 are dysregulated after radiotherapy for breast cancer

We enrolled 250 patients with breast cancer and 50 healthy controls in this study. The clinical details of patients are shown in Table 1. The median age was 51 (range from 23 to 84). Most patients had tumors smaller than 5 cm in size. Half of the patients had no lymph node metastasis. Estrogen receptor positive, progesterone receptor positive, and HER2 negative patients accounted for a large proportion of all patients, and TNM stages were mainly concentrated in stage I–III. To explore the function of IL-33 and its receptors, we first examined the levels of IL-33, sST2, IL-33R, and IL-1RAcP in the serum of all subjects. As shown in Figure 1a and b, the levels of IL-33 and sST2 were elevated in patients with breast cancer, compared with the healthy control. Besides, the IL-33 and sST2 levels remained unaltered in patients after receiving radiotherapy once, compared with those without treatment, but were upregulated after 6 months of radiotherapy, and there was no significant difference at 1 or 12 months interval compared to those who received radiotherapy once. The protein levels of IL-33 and sST2 were consistent with their mRNA expression (Figure 1c). Moreover, the IL-33R and IL-1RAcP expressions were elevated in patients with breast cancer compared to healthy control; however, they remained unaffected by radiotherapy (Figure 1d and e).

Figure 1 
                  IL-33 and sST2 are dysregulated after radiotherapy for breast cancer. (a) IL-33 and (b) sST2 levels were detected in healthy subjects (n = 50), patients with breast cancer before radiotherapy (n = 50; CA), radiotherapy for once (n = 50; CA + RT), 1 month after radiotherapy (n = 50; CA + RT-1M), 6 months after radiotherapy (n = 50; CA + RT-6M), and 12 months after radiotherapy (n = 50; CA + RT-12M) using qRT-PCR. (c) IL-33 and sST2 protein levels in the serum of each group were measured using western blotting. (d) IL-33R and (e) IL-1RAcP mRNA expression in each group was examined using qPCR. ***P < 0.001; **P < 0.01; ns: no significance.
Figure 1

IL-33 and sST2 are dysregulated after radiotherapy for breast cancer. (a) IL-33 and (b) sST2 levels were detected in healthy subjects (n = 50), patients with breast cancer before radiotherapy (n = 50; CA), radiotherapy for once (n = 50; CA + RT), 1 month after radiotherapy (n = 50; CA + RT-1M), 6 months after radiotherapy (n = 50; CA + RT-6M), and 12 months after radiotherapy (n = 50; CA + RT-12M) using qRT-PCR. (c) IL-33 and sST2 protein levels in the serum of each group were measured using western blotting. (d) IL-33R and (e) IL-1RAcP mRNA expression in each group was examined using qPCR. ***P < 0.001; **P < 0.01; ns: no significance.

3.2 Radiation induces cardiac dysfunction and the abnormal expression of IL-33/sST2 in RIHD mice

The radiotherapy effects on cardiac dysfunction were subsequently assessed in the RIHD animal model. The results showed that the ejection fraction, LVEDD, and SLVD remained unaffected when radiations were received once; however, LVEDD was found reduced when radiotherapy was received for 1 week. The ejection fraction, LVEDD, and SLVD decreased significantly after 2 and 4 weeks of radiation, particularly after 4 weeks (Figure 2a–c). In addition, radiation for 2 and 4 weeks resulted in the irregular arrangement of myocardial cells, local inflammatory infiltration, and myocardial fiber rupturing, indicating myocardial injury (Figure 2d). The mRNA and protein levels of IL-33 and sST2 in heart tissues had no significant difference between the control and RT group. However, compared to mice which received radiation for once, radiation treatment for 1 and 2 weeks upregulated the IL-33 and sST2 levels, while remained unaffected at 4 weeks of radio treatment (Figure 2e–h).

Figure 2 
                  Radiation induces cardiac dysfunction and the abnormal expression of IL-33/sST2 in RIHD mice. The cardiac function including (a) the left ventricular ejection fraction, (b) LVEDD, and (c) SLVD was analyzed using the ultrasound imaging system. (d) Myocardial damage was visualized using the H&E staining assay. Scale bar: 50 μm. (e) IL-33 and (f) sST2 mRNA expression in the hearts of mice. (g) IL-33 and sST2 levels were examined using western blotting in heart tissues of mice. (h) IHC assay showed the protein levels of IL-33 and sST2 in the hearts of mice. Scale bar: 50 μm. ***P < 0.001; **P < 0.01; *P < 0.05; ns: no significance.
Figure 2

Radiation induces cardiac dysfunction and the abnormal expression of IL-33/sST2 in RIHD mice. The cardiac function including (a) the left ventricular ejection fraction, (b) LVEDD, and (c) SLVD was analyzed using the ultrasound imaging system. (d) Myocardial damage was visualized using the H&E staining assay. Scale bar: 50 μm. (e) IL-33 and (f) sST2 mRNA expression in the hearts of mice. (g) IL-33 and sST2 levels were examined using western blotting in heart tissues of mice. (h) IHC assay showed the protein levels of IL-33 and sST2 in the hearts of mice. Scale bar: 50 μm. ***P < 0.001; **P < 0.01; *P < 0.05; ns: no significance.

3.3 Knockdown of IL-33 reverses the cardiac dysfunction caused by radiation

To explore the role of IL-33 in cardiac function, we knocked down IL-33 in mice. The expression of IL-33 was reduced after sh-IL-33 injection (Figure 3a and b). Then, we measured sST2 expression in heart tissues. The results showed that RT for 2 weeks increased sST2 expression, while knockdown of IL-33 abrogated this increase (Figure 3c and d). Cardiac function, including ejection fraction, LVEDD, and SLVD, were assessed using transthoracic ultrasound. The results indicated that RT elevated ejection fraction and reduced LVEDD and SLVD, suggesting that RT induced cardiac dysfunction, whereas IL-33 knockdown reversed the effects caused by RT (Figure 3e–g). Talem together, silencing of IL-33 attenuates cardiac injury in RT-induced mice by downregulating sST2 expression.

Figure 3 
                  Knockdown of IL-33 reverses the cardiac dysfunction caused by radiation. (a) IL-33 expression in the hearts was measured using qRT-PCR. (b) IL-33 expression in the hearts was measured using western blotting. (c) and (d) sST2 mRNA and protein expression in the hearts of mice after RT stimulation and IL-33 knockdown. (e) The left ventricular ejection fraction, (f) LVEDD, and (g) SLVD were measured to evaluate cardiac function using the ultrasound imaging system. ***P < 0.001; **P < 0.01; *P < 0.05.
Figure 3

Knockdown of IL-33 reverses the cardiac dysfunction caused by radiation. (a) IL-33 expression in the hearts was measured using qRT-PCR. (b) IL-33 expression in the hearts was measured using western blotting. (c) and (d) sST2 mRNA and protein expression in the hearts of mice after RT stimulation and IL-33 knockdown. (e) The left ventricular ejection fraction, (f) LVEDD, and (g) SLVD were measured to evaluate cardiac function using the ultrasound imaging system. ***P < 0.001; **P < 0.01; *P < 0.05.

3.4 TCF7L2 promotes IL-33 transcriptional activation

To investigate the factors mediating IL-33 functions, we assessed the upstream transcription factors of IL-33. The TCF7L2 DNA binding motif is shown in Figure 4a, predicting that TCF7L2 could bind to the IL33 promoter (Figure 4b). Overexpression of TCF7L2 increased the enrichment of IL-33, compared with IgG, suggesting that TCF7L2 has an affinity for IL33 promoter (Figure 4c). Besides, the luciferase activity of wild-type IL33 promoter was increased by TCF7L2 overexpression compared to empty vector, whereas TCF7L2 did not affect the luciferase activity of mutant IL33 promoter (Figure 4d).

Figure 4 
                  TCF7L2 promotes IL-33 transcriptional activation. (a) The DNA motif of TCF7L2 was predicted using the JASPAR database. (b) The binding sites between TCF7L2 and IL33 promoter were predicted. (c) The affinity of TCF7L2 in IL33 promoter was verified using the CHIP. (d) The binding relationship between TCF7L2 and IL-33 was evaluated using dual-luciferase reporter analysis. ***P < 0.001.
Figure 4

TCF7L2 promotes IL-33 transcriptional activation. (a) The DNA motif of TCF7L2 was predicted using the JASPAR database. (b) The binding sites between TCF7L2 and IL33 promoter were predicted. (c) The affinity of TCF7L2 in IL33 promoter was verified using the CHIP. (d) The binding relationship between TCF7L2 and IL-33 was evaluated using dual-luciferase reporter analysis. ***P < 0.001.

3.5 TCF7L2, IL-33, and sST2 are dysregulated in radiation-induced cardiomyocytes

To explore the expression of TCF7L2, IL-33, and sST2 in cardiomyocytes, H9C2 cells were treated with 0, 2, 4, and 8 Gy X-rays for 48 h. Results showed that compared to 0 Gy group, 2 Gy radiation increased sST2 instead of TCF7L2 and IL-33 expressions, whereas 4 and 8 Gy markedly elevated TCF7L2, IL-33, and sST2 expression with an increasing radiation dose (Figure 5a–d). In addition, H9C2 cells were treated with 8 Gy X-ray for 0, 12, 24, and 48 h, and results showed that TCF7L2, IL-33, and sST2 expressions were increased in a time-dependent manner (Figure 6a–d).

Figure 5 
                  TCF7L2, Il-33, and sST2 are dysregulated in different doses of radiation-treated cardiomyocytes. After H9C2 cells were treated with 0, 2, 4, and 8 Gy X-rays for 48 h, (a) TCF7L2, (b) IL-33, and (c) sST2 levels were detected using qRT-PCR. (d) TCF7L2, IL-33, and sST2 levels in each group were examined using western blotting. ***P < 0.001; **P < 0.01; *P < 0.05; ns: no significance.
Figure 5

TCF7L2, Il-33, and sST2 are dysregulated in different doses of radiation-treated cardiomyocytes. After H9C2 cells were treated with 0, 2, 4, and 8 Gy X-rays for 48 h, (a) TCF7L2, (b) IL-33, and (c) sST2 levels were detected using qRT-PCR. (d) TCF7L2, IL-33, and sST2 levels in each group were examined using western blotting. ***P < 0.001; **P < 0.01; *P < 0.05; ns: no significance.

Figure 6 
                  TCF7L2, Il-33, and sST2 are dysregulated in radiation-treated cardiomyocytes at different times. After H9C2 cells were treated with 8 Gy X-ray for 0, 12, 24, and 48 h, (a) TCF7L2, (b) IL-33, and (c) sST2 expression was detected using qRT-PCR. (d) Western blotting was performed to measure TCF7L2, IL-33, and sST2 levels in each group ***P < 0.001; **P < 0.01; *P < 0.05; ns: no significance.
Figure 6

TCF7L2, Il-33, and sST2 are dysregulated in radiation-treated cardiomyocytes at different times. After H9C2 cells were treated with 8 Gy X-ray for 0, 12, 24, and 48 h, (a) TCF7L2, (b) IL-33, and (c) sST2 expression was detected using qRT-PCR. (d) Western blotting was performed to measure TCF7L2, IL-33, and sST2 levels in each group ***P < 0.001; **P < 0.01; *P < 0.05; ns: no significance.

3.6 Knockdown of TCF7L2 decreases IL-33 and sST2 expression in radiation-induced cardiomyocytes

To investigate the effect of TCF7L2 on IL-33 and sST2 expression, TCF7L2 expression was knocked down by transfecting with sh-TCF7L2. The results of qRT-PCR showed that TCF7L2 expression was downregulated after sh-TCF7L2 transfection, compared with sh-NC (Figure 7a and b). Later, IL-33 and sST2 expression was measured using qRT-PCR. The results indicated that 8 Gy X-ray elevated IL-33 and sST2 expression, whereas TCF7L2 knockdown reversed this elevation (Figure 7c–e).

Figure 7 
                  Knockdown of TCF7L2 decreases IL-33 and sST2 expression in radiation-induced cardiomyocytes. (a) and (b) TCF7L2 expression was measured in H9C2 cells after sh-TCF7L2 and sh-NC transfection. (c) IL-33 and (d) sST2 levels were measured using qRT-PCR after cell transfection and 8 Gy X-ray treatment for 48 h. (e) Western blotting was conducted to assess IL-33 and sST2 protein levels. ***P < 0.001; **P < 0.01.
Figure 7

Knockdown of TCF7L2 decreases IL-33 and sST2 expression in radiation-induced cardiomyocytes. (a) and (b) TCF7L2 expression was measured in H9C2 cells after sh-TCF7L2 and sh-NC transfection. (c) IL-33 and (d) sST2 levels were measured using qRT-PCR after cell transfection and 8 Gy X-ray treatment for 48 h. (e) Western blotting was conducted to assess IL-33 and sST2 protein levels. ***P < 0.001; **P < 0.01.

3.7 Mutation of IL33 promoter attenuates cell damage

Reporter vectors with wild-type and mutant IL33 promoter sequences were transfected into H9C2 cells, which were treated with 8 Gy X-ray for 48 h. LDH activity was measured to assess cell injury. The results showed that 8 Gy X-ray increased LDH activity. Mutation of IL33 promoter reduced LDH activity after 8 Gy X-ray treatment, but failed to affect LDH activity after 0 Gy X-ray treatment (Figure 8).

Figure 8 
                  Mutation of IL33 promoter attenuates cell damage. H9C2 cells with wild-type and mutant IL33 promoter were treated with 0 or 8 Gy X-ray, and cell injury was assessed by detecting LDH activity. ***P < 0.001; ns, no significant.
Figure 8

Mutation of IL33 promoter attenuates cell damage. H9C2 cells with wild-type and mutant IL33 promoter were treated with 0 or 8 Gy X-ray, and cell injury was assessed by detecting LDH activity. ***P < 0.001; ns, no significant.

4 Discussion

Radiotherapy is a commonly used treatment strategy for breast cancer. However, cardiac damage induced by radiation exposure remains a serious concern. Cardiac cells under stress express ST2, whose ligand is reported to be IL-33. The interaction between IL-33 and ST2L has been reported to have a cardioprotective effect; however, when sST2 binds to IL-33 by decoy function, it blocks the interaction between IL-33 and ST2L, resulting in the diminishing of the cardioprotective role [20,21]. They have also been involved in the progression of various cardiovascular diseases, like myocardial fibrosis, hypertrophy, and remodeling [22]. Florens et al. [23] have reported that IL-33 antibody protects heart after acute kidney injury, and overexpression of IL-33 induces cardiac hypertrophy and cardiomyopathy. Asensio-Lopez et al. [24] have found that metformin improves cardiac remodeling after myocardial infarction by increasing IL-33 expression and reducing sST2 levels. These studies indicated the important role of IL-33 and sST2 in heart injury and repair. Meanwhile, IL-33 and sST2 are important tumor development drivers and have been found to promote tumor metastasis in breast cancer [16,25]. Moreover, sST2 has been reported to be used as a biomarker for predicting the cardiac function of breast cancer patients receiving chemotherapeutics [26]. However, whether IL-33 and sST2 regulate radiotherapy-induced cardiac function remains unclear. In this study, the levels of IL-33 and sST2 in patients with breast cancer were elevated compared to healthy subjects, consistent with the previous studies [27,28], suggesting that they play a crucial role in breast cancer development. In addition, radiotherapy for 6 months was found to upregulate IL-33 and sST2 levels, suggesting that radiotherapy for 6 months in breast cancer patients may cause myocardial damage. Moreover, we found an interesting phenomenon that IL-33 and sST2 expressions were decreased after 12 months of radiotherapy compared to 6 months, but not significantly different from 1 month or radiotherapy once. We hypothesized that after 6 months of radiotherapy, IL-33 and sST2 were highly expressed, and they blocked the cardioprotective function of IL-33 through the combination of decoy function, resulting in cardiac injury. However, sustained heart damage may block their binding and promote the heart-protecting effects of IL-33. Therefore, IL-33 and sST2 levels were decreased 12 months after radiotherapy, attenuating heart damage.

To explore the association between cardiac injury and the IL-33/sST2 axis, the RIHD mouse model was established, which is related to the extended follow-up time and partly abolishes the survival benefit of radiotherapy. The incidence of RIHD remains unknown due to the lack of long-term follow-up studies [29]. Our results indicated that cardiac function injury in RIHD mice was gradually severed with increased RIHD time (during 4 weeks). One and 2 weeks of radiation of mice significantly increased the IL-33 and sST2 levels; however, no significant difference was observed at their levels at once and 4 weeks of radiation, suggesting that the IL-33/sST2 axis might be associated with cardiac damage severity as a function of radiation duration. Moreover, we found that knockdown of IL-33 reduced sST2 expression to attenuate cardiac function, suggesting that radiation promotes heart damage by increasing the IL-33/sST2 axis.

TCF7L2 is a transcription factor and is a component of the TCF7L2/β-catenin complex transcriptionally activating the downstream factors in the Wnt pathway [30], and also regulates multiple cellular processes, including cell growth, differentiation, death, and metabolism [31]. The TCF7L2 gene was reported to be linked with the risk and development of breast cancer and heart diseases [32,33]. Wu et al. [34] have reported that TCF7L2 mediated by miR-509-3p promotes breast cancer cell proliferation and angiogenesis, and inhibits apoptosis. In addition, Li et al. [35] have found that TCF7L2 contributes to anti-atherosclerosis. In this study, we speculated that IL-33 may be regulated by TCF7L2. Our results revealed TCF7L2 transcription-activated IL-33 and a consistent expression trend of TCF7L2, IL-33, and sST2 in irradiated cardiomyocytes. Silencing of TCF7L2 causes sensitivity of cancer cells to X-ray [36]. Thus, we speculated that IL-33 was transcription-activated by upstream TCF7L2 and mediated downstream sST2 to affect radiation-induced heart injury. However, whether TCF7L2 is involved in radiation-induced cardiac dysfunction in vivo has not been studied, which will be investigated in our future work.

In conclusion, the results show that the TCF7L2/IL-33/sST2 axis promotes radiation-induced cardiac damage. These findings are envisaged to provide novel information regarding radiotherapy-induced cardiac injury in patients with breast cancer.

  1. Funding information: Authors state no funding involved.

  2. Author contributions: R.A. designed the experiments and A.M. carried them out. X.Y. prepared the manuscript with contributions from all co-authors. M.M. made substantial contributions to the conception or design of the work and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Trayes KP, Cokenakes S. Breast cancer treatment. Am Fam Physician. 2021;104(2):171–8.Search in Google Scholar

[2] Haussmann J, Corradini S, Nestle-Kraemling C, Bolke E, Njanang F, Tamaskovics B, et al. Recent advances in radiotherapy of breast cancer. Radiat Oncol. 2020;15(1):71. 10.1186/s13014-020-01501-x.Search in Google Scholar PubMed PubMed Central

[3] Kerr AJ, Dodwell D, McGale P, Holt F, Duane F, Mannu G, et al. Adjuvant and neoadjuvant breast cancer treatments: a systematic review of their effects on mortality. Cancer Treat Rev. 2022;105:102375. 10.1016/j.ctrv.2022.102375.Search in Google Scholar PubMed PubMed Central

[4] Darby SC, Ewertz M, McGale P, Bennet AM, Blom-Goldman U, Bronnum D, et al. Risk of ischemic heart disease in women after radiotherapy for breast cancer. N Engl J Med. 2013;368(11):987–98. 10.1056/NEJMoa1209825.Search in Google Scholar PubMed

[5] Taylor C, Correa C, Duane FK, Aznar MC, Anderson SJ, Bergh J, et al. Estimating the risks of breast cancer radiotherapy: evidence from modern radiation doses to the lungs and heart and from previous randomized trials. J Clin Oncol. 2017;35(15):1641–9. 10.1200/JCO.2016.72.0722.Search in Google Scholar PubMed PubMed Central

[6] Banfill K, Giuliani M, Aznar M, Franks K, McWilliam A, Schmitt M, et al. Cardiac toxicity of thoracic radiotherapy: existing evidence and future directions. J Thorac Oncol. 2021;16(2):216–27. 10.1016/j.jtho.2020.11.002.Search in Google Scholar PubMed PubMed Central

[7] Yeoh WJ, Vu VP, Krebs P. IL-33 biology in cancer: an update and future perspectives. Cytokine. 2022;157:155961. 10.1016/j.cyto.2022.155961.Search in Google Scholar PubMed

[8] Dwyer GK, D’Cruz LM, Turnquist HR. Emerging functions of IL-33 in homeostasis and immunity. Annu Rev Immunol. 2022;40:15–43. 10.1146/annurev-immunol-101320-124243.Search in Google Scholar PubMed

[9] Dagher R, Copenhaver AM, Besnard V, Berlin A, Hamidi F, Maret M, et al. IL-33-ST2 axis regulates myeloid cell differentiation and activation enabling effective club cell regeneration. Nat Commun. 2020;11(1):4786. 10.1038/s41467-020-18466-w.Search in Google Scholar PubMed PubMed Central

[10] Saikumar JA, Hesse L, Ketelaar ME, Koppelman GH, Nawijn MC. The central role of IL-33/IL-1RL1 pathway in asthma: from pathogenesis to intervention. Pharmacol Ther. 2021;225:107847. 10.1016/j.pharmthera.2021.107847.Search in Google Scholar PubMed

[11] Homsak E, Gruson D. Soluble ST2: a complex and diverse role in several diseases. Clin Chim Acta. 2020;507:75–87. 10.1016/j.cca.2020.04.011.Search in Google Scholar PubMed

[12] Kotsiou OS, Gourgoulianis KI, Zarogiannis SG. IL-33/ST2 axis in organ fibrosis. Front Immunol. 2018;9:2432. 10.3389/fimmu.2018.02432.Search in Google Scholar PubMed PubMed Central

[13] Shakerian L, Kolahdooz H, Garousi M, Keyvani V, Kamal KR, Abdulsattar FT, et al. IL-33/ST2 axis in autoimmune disease. Cytokine. 2022;158:156015. 10.1016/j.cyto.2022.156015.Search in Google Scholar PubMed

[14] Jiang W, Lian J, Yue Y, Zhang Y. IL-33/ST2 as a potential target for tumor immunotherapy. Eur J Immunol. 2021;51(8):1943–55. 10.1002/eji.202149175.Search in Google Scholar PubMed

[15] He D, Xu H, Zhang H, Tang R, Lan Y, Xing R, et al. Disruption of the IL-33-ST2-AKT signaling axis impairs neurodevelopment by inhibiting microglial metabolic adaptation and phagocytic function. Immunity. 2022;55(1):159–73. 10.1016/j.immuni.2021.12.001.Search in Google Scholar PubMed PubMed Central

[16] Shani O, Vorobyov T, Monteran L, Lavie D, Cohen N, Raz Y, et al. Fibroblast-derived IL33 facilitates breast cancer metastasis by modifying the immune microenvironment and driving type 2 immunity. Cancer Res. 2020;80(23):5317–29. 10.1158/0008-5472.CAN-20-2116.Search in Google Scholar PubMed PubMed Central

[17] Stojanovic B, Gajovic N, Jurisevic M, Stojanovic MD, Jovanovic M, Jovanovic I, et al. Decoding the IL-33/ST2 axis: its impact on the immune landscape of breast cancer. Int J Mol Sci. 2023;24(18). 10.3390/ijms241814026.Search in Google Scholar PubMed PubMed Central

[18] Opinc A, Sarnik J, Brzezinska O, Makowski M, Lewandowska-Polak A, Makowska J. Interleukin-33/suppression of tumorigenicity 2 (IL-33/ST2) axis in idiopathic inflammatory myopathies and its association with laboratory and clinical parameters: a pilot study. Rheumatol Int. 2020;40(7):1133–41. 10.1007/s00296-020-04554-z.Search in Google Scholar PubMed PubMed Central

[19] Li H, Cao L, Yi PQ, Xu C, Su J, Chen PZ, et al. Pituitary adenylate cyclase-activating polypeptide ameliorates radiation-induced cardiac injury. Am J Transl Res. 2019;11(10):6585–99.10.1016/j.ijrobp.2019.06.1051Search in Google Scholar

[20] Pascual-Figal DA, Januzzi JL. The biology of ST2: the international ST2 consensus panel. Am J Cardiol. 2015;115(7 Suppl):3–7B. 10.1016/j.amjcard.2015.01.034.Search in Google Scholar PubMed

[21] Zhang J, Chen Z, Ma M, He Y. Soluble ST2 in coronary artery disease: clinical biomarkers and treatment guidance. Front Cardiovasc Med. 2022;9:924461. 10.3389/fcvm.2022.924461.Search in Google Scholar PubMed PubMed Central

[22] De la Fuente M, MacDonald TT, Hermoso MA. The IL-33/ST2 axis: role in health and disease. Cytokine Growth Factor Rev. 2015;26(6):615–23. 10.1016/j.cytogfr.2015.07.017.Search in Google Scholar PubMed

[23] Florens N, Kasam RK, Rudman-Melnick V, Lin SC, Prasad V, Molkentin JD. Interleukin-33 mediates cardiomyopathy after acute kidney injury by signaling to cardiomyocytes. Circulation. 2023;147(9):746–58. 10.1161/CIRCULATIONAHA.122.063014.Search in Google Scholar PubMed PubMed Central

[24] Asensio-Lopez MC, Lax A, Fernandez DPM, Sassi Y, Hajjar RJ, Januzzi JL, et al. Yin-Yang 1 transcription factor modulates ST2 expression during adverse cardiac remodeling post-myocardial infarction. J Mol Cell Cardiol. 2019;130:216–33. 10.1016/j.yjmcc.2019.04.009.Search in Google Scholar PubMed

[25] Gillibert-Duplantier J, Duthey B, Sisirak V, Salaun D, Gargi T, Tredan O, et al. Gene expression profiling identifies sST2 as an effector of ErbB2-driven breast carcinoma cell motility, associated with metastasis. Oncogene. 2012;31(30):3516–24. 10.1038/onc.2011.525.Search in Google Scholar PubMed

[26] Huang G, Zhai J, Huang X, Zheng D. Predictive value of soluble ST-2 for changes of cardiac function and structure in breast cancer patients receiving chemotherapy. Medicine (Baltimore). 2018;97(38):e12447. 10.1097/MD.0000000000012447.Search in Google Scholar PubMed PubMed Central

[27] Yang ZP, Ling DY, Xie YH, Wu WX, Li JR, Jiang J, et al. The association of serum IL-33 and sST2 with breast cancer. Dis Markers. 2015;2015:516895. 10.1155/2015/516895.Search in Google Scholar PubMed PubMed Central

[28] Yigitbasi MR, Guntas G, Atak T, Sonmez C, Yalman H, Uzun H. The role of interleukin-33 as an inflammatory marker in differential diagnosis of idiopathic granulomatous mastitis and breast cancer. J Invest Surg. 2017;30(4):272–6. 10.1080/08941939.2016.1240270.Search in Google Scholar PubMed

[29] Pezner RD. Coronary artery disease and breast radiation therapy. Int J Radiat Oncol Biol Phys. 2013;86(5):816–8. 10.1016/j.ijrobp.2013.04.046.Search in Google Scholar PubMed

[30] Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell. 2000;103(2):311–20. 10.1016/s0092-8674(00)00122-7.Search in Google Scholar PubMed

[31] Hrckulak D, Kolar M, Strnad H, Korinek V. TCF/LEF transcription factors: an update from the internet resources. Cancers (Basel). 2016 7:8. 10.3390/cancers8070070.Search in Google Scholar PubMed PubMed Central

[32] Zhang M, Tang M, Fang Y, Cui H, Chen S, Li J, et al. Cumulative evidence for relationships between multiple variants in the VTI1A and TCF7L2 genes and cancer incidence. Int J Cancer. 2018;142(3):498–513. 10.1002/ijc.31074.Search in Google Scholar PubMed

[33] Zhao L, Sun L, Lu Y, Li F, Xu H. A small-molecule LF3 abrogates beta-catenin/TCF4-mediated suppression of Na(V)1.5 expression in HL-1 cardiomyocytes. J Mol Cell Cardiol. 2019;135:90–6. 10.1016/j.yjmcc.2019.08.007.Search in Google Scholar PubMed PubMed Central

[34] Wu D, Jia H, Zhang Z, Li S. Circ-PRMT5 promotes breast cancer by the miR-509-3p/TCF7L2 axis activating the PI3K/AKT pathway. J Gene Med. 2021;23(2):e3300. 10.1002/jgm.3300.Search in Google Scholar PubMed

[35] Li J, Zhou L, Ouyang X, He P. Transcription factor-7-Like-2 (TCF7L2) in atherosclerosis: a potential biomarker and therapeutic target. Front Cardiovasc Med. 2021;8:701279. 10.3389/fcvm.2021.701279.Search in Google Scholar PubMed PubMed Central

[36] Kendziorra E, Ahlborn K, Spitzner M, Rave-Frank M, Emons G, Gaedcke J, et al. Silencing of the Wnt transcription factor TCF4 sensitizes colorectal cancer cells to (chemo-) radiotherapy. Carcinogenesis. 2011;32(12):1824–31. 10.1093/carcin/bgr222.Search in Google Scholar PubMed PubMed Central

Received: 2023-10-11
Revised: 2024-01-24
Accepted: 2024-02-20
Published Online: 2024-03-30

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Downloaded on 23.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0841/html
Scroll to top button