Home Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
Article Open Access

Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway

  • Xinyu Wang , Xiyu Zeng , Yu Long , Yanfei Du , Chang Li , Hua Jiang EMAIL logo and Guang Li EMAIL logo
Published/Copyright: November 19, 2024
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 19 Issue 1

Abstract

Recent studies have reported that electroacupuncture (EA) can treat osteoporosis, but most of which were based on the “kidney governing bones” theory. However, the ancient Chinese medical textbook Huangdi Neijing pointed out that “Gallbladder Meridian of Foot Shaoyang” correlates with bone diseases, including osteoporosis, although the therapeutic regimens were lost after the Tang Dynasty. Here, we explored whether EA at GB points improves osteoporosis and its underlying mechanism. We constructed ovariectomized mice and treated them with EA at GB30 (Huantiao), GB34 (Yanglingquan), and GB39 (Xuanzhong) acupoints. EA treatment significantly improved bone parameters in osteoporotic mice, as evidenced by micro-computed tomography and histological assessment. Additionally, EA treatment elevated the serum levels of estradiol and SOD that were downregulated in osteoporotic mice. Transcriptome and qPCR results verified that EA treatment upregulated the expression of genes associated with bone formation. Moreover, transcriptome analysis revealed differential enrichment of the PI3K–Akt pathway. Furthermore, Western blot analysis demonstrated that estradiol partially counteracted a reduction in p-AKT expression induced by hydrogen peroxide. These findings indicate that EA treatment increases serum estradiol levels in mice, thus inhibiting osteoporosis induced by oxidative stress. This effect is achieved by activating the PI3K–Akt signaling pathway.

Keywords: osteoporosis; electroacupuncture; PI3K-Akt; oxidative stress; estradiol

1 Introduction

Osteoporosis is a skeletal disorder characterized by compromised bone strength, which increases an individual’s susceptibility to fractures [1]. Fractures considerably impact mortality, morbidity, and medical expenses globally, and their detrimental effects on public health are expected to increase in the future [2]. Both men and women experience a decline in bone mineral density (BMD) with age, beginning in midlife. Women experience a rapid phase of bone loss 5–10 years after menopause due to a sudden decrease in estrogen levels and an increase in bone turnover [3]. In men, rapid bone loss is not present due to the continuous and slow decrease of sex hormones, producing a bone loss-age curve as a gentle straight line [4]. Comparing the bone mass loss characteristics of men and women, it has been suggested that estrogen deficiency is closely related to high bone turnover metabolism.

A recent study reported that the prevalence of osteoporosis among individuals aged 40 and above in mainland China is 5% for males and 20.6% for females [5]. This poses a substantial health challenge for postmenopausal women, affecting up to 50% of this population [6]. This condition not only induces pain and inconvenience but can also result in severe disability, significantly diminishing the quality of life of patients. The pathogenesis of postmenopausal osteoporosis is intricately linked to a pronounced decrease in estrogen levels [7]. Estrogen deficiency enhances osteoclast differentiation and activity, accelerating bone resorption that outpaces bone formation. This disrupted bone metabolism is particularly evident during early menopause, leading to a reduced BMD and compromised bone microarchitecture, ultimately weakening bone strength and elevating the risk of fragility fractures [8]. To elucidate this complex pathology, ovariectomized mouse models have emerged as invaluable research tools, effectively simulating postmenopausal osteoporosis in humans. Surgical removal of the ovaries in mice rapidly decreases estrogen levels, mirroring the physiological changes experienced by postmenopausal women [9,10]. This model replicates the estrogen deficiency-induced imbalance in bone metabolism in humans, facilitating the study of osteoporosis progression and the evaluation of therapeutic interventions in a controlled setting. Consequently, ovariectomized mouse models are crucial in advancing our understanding of the underlying mechanisms of osteoporosis and for developing novel treatment strategies.

Many factors, including nutrition, cytokines, hormones, and aging, are associated with osteoporosis development [8,11,12]. Additionally, the basic loss of bone mass and reduced protein intake are critical factors contributing to the development of osteoporosis [11]. As people age, bone resorption outpaces bone formation, leading to a decrease in bone density [13]. Insufficient protein intake can further impair bone health, as proteins are essential for maintaining bone structure and function [14]. Oxidative stress is also believed to contribute to the pathogenesis of osteoporosis. Several in vitro and animal studies reported that oxidative stress decreased the level of bone formation by modulating the differentiation and survival of osteoblasts [15]. Moreover, osteoclasts activated by oxidative stress were shown to enhance bone resorption [16]. The balance between osteoblast formation and osteoclast resorption is related to bone development. Many studies indicated that oxidative stress plays a pivotal role in the development and progression of various types of osteoporosis [17,18]. The level of oxidative stress increases as osteoporosis advances, indicating that it plays a critical role in bone loss progression [19]. Recent studies showed that serum hydrogen peroxide (H2O2) levels are associated with decreased bone density in postmenopausal women [20]. Oxidative stress is a major pathological determinant of postmenopausal bone loss, and age-related changes, such as the loss of estrogen, exacerbate bone loss [21,22,23].

Current treatments for osteoporosis include basic treatments (e.g., calcium and vitamin D supplementation), lifestyle changes (limiting tobacco and alcohol intake, performing weight-bearing exercise, and avoiding falls or injury), and drugs (such as estrogen, parathyroid hormone, raloxifene, and denosumab). The adherence to vitamin D, calcium, and osteoporosis drugs is currently low in the investigated population [24]. Moreover, the treatment with these drugs can cause many unavoidable side effects, such as an increased risk of cardiovascular disease, gastrointestinal reactions, and rhinitis [25]. Therefore, there is an urgent need for an alternative treatment to increase bone quality and prevent fractures with a high degree of safety. In recent years, acupuncture has increasingly been used to treat osteoporosis because of its efficacy, relatively low cost, and low risk of side effects [26]. Acupuncture was widely used for treatment, along with herbal medicine, more than 2,000 years ago, and it is the second most popular supplement and alternative treatment for osteoporosis in Australia, after multivitamins [27]. Its potential benefits include increased bone density and analgesia. Clinical studies have shown that acupuncture is superior to calcium D in enhancing BMD in postmenopausal individuals [28]. Previous studies also reported that acupuncture significantly increased BMD in the lumbar vertebrae, trabecular area, and trabecular bone number while reducing the trabecular separation in postmenopausal rats [29]. Furthermore, acupuncture has been found to significantly improve osteoporosis in patients, with an increase in serum estradiol levels observed after treatment [30]. Electroacupuncture (EA), a modern technique that combines traditional acupuncture with electrotherapy, has been suggested to have beneficial effects on osteoporosis patients, based on animal experiments showing increased BMD in rats after 12 and 24 weeks [31]. The therapeutic effects of EA in the treatment of diseases such as ischemic stroke, cerebral hemorrhage, and spinal cord injury are achieved by inhibiting oxidative stress [32,33,34]. It is hypothesized that acupuncture therapy may have a positive impact on osteoporosis by mitigating oxidative stress; however, the precise underlying molecular mechanisms have yet to be fully understood. In this study, the therapeutic efficacy of EA on osteoporosis was assessed in ovariectomized mice, and an in-depth exploration of the underlying molecular mechanisms was conducted.

The traditional Chinese medicine (TCM) theory of “kidney controlling bones” has long been recognized as an important theoretical and clinical concept in the prevention and treatment of osteoporosis, as osteoporosis is considered an aging and degenerative disease caused by insufficient kidney qi, as described in the Huangdi Neijing [35]. However, this concept primarily emphasizes the relationship between organs and bones and does not directly reflect the connection between meridians and bones. The ancient Chinese books documented the “Gallbladder Meridian of Foot Shaoyang” for treating bone diseases, which specifically focuses on the relationship between meridians and bones. Unfortunately, this record was lost for thousands of years, rendering it unknown until recently [36]. In this study, we used this ancient description as the basis for selecting GB acupoints for EA treatment to explore the mechanism by which EA treats osteoporosis. This study provides a new approach to applying EA to the treatment of osteoporosis while elucidating the specific underlying molecular mechanisms and provides data supporting the clinical application of EA as a complementary therapy.

2 Materials and methods

2.1 Modeling and interventions

Forty female C57 mice (8 weeks old, weighing 20 ± 1 g) were purchased from Chengdu Dashuo Bioscience Inc. Animal feeding conditions were as follows: temperature, 20–26°C; relative humidity, 40–70%; light and dark cycle, 12 h/12 h; ordinary feed feeding; and free intake of water. Mice were randomly divided into four groups (n = 10 each): ovariectomized model with EA (OVX + EA), sham surgery model with EA (SHAM + EA), sham surgery model with non-acupoints (SHAM + non), and ovariectomized model with non-acupoints (OVX + non). After 1 week of adaptive training, mice were anesthetized with isoflurane. Ovariectomy was performed by ligating and excising the ovaries by laparotomy. In the sham groups, a small fat mass close to the ovaries was dissected. For the intervention, needles (Hanyi brand sterile acupuncture needles, half inch 0.18 × 13 mm, produced by Changchun Aikang Medical Equipment Inc., China) were inserted at GB30, GB34, and GB39 to a depth of 2–5 mm from the body surface. The EA instrument (New Huatuo brand electronic needle therapy instrument SDZ-II produced by Suzhou Medical Supplies Factory Inc., China) was connected to the three acupoints, a density wave was selected, the frequency was 15 Hz, the voltage was 1.5 V, and the needle was retained for 10 min. This was performed once a day, and the contralateral acupoints were taken the next day. Each treatment cycle comprised continuous intervention for 5 days, followed by rest for 2 days. There were four cycles of intervention over a total of 26 days. In the control group, three nonacupoints were targeted, and the mice underwent needling at these non-acupuncture points accompanied by electrical stimulation.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and has been approved by the Ethics Committee of Southwest Medical University (permission number: 2020323), and animals were cared according to the National Institutes of Health guide for the care and use of Laboratory animals guidelines (NIH Publications No. 8023).

2.2 Specimen collection, serum enzyme-linked immunosorbent assay (ELISA), and femoral morphology

At the end of 26 days, all mice were anesthetized with isoflurane. The abdomen was quickly opened, and the inferior vena cava was separated. Then, 0.5–0.9 mL of blood was collected with a disposable blood collection needle and placed in a centrifuge tube. After standing for 30 min, the blood was centrifuged at 4°C and 3,000×g for 15 min. The supernatant was rapidly frozen in liquid nitrogen and stored in a −80°C refrigerator for ELISA analysis (Elabscience Inc.).

For the ELISA analysis, mouse E2 antigen was coated on an enzyme-labeled plate, and anti-estradiol monoclonal antibody labeled with horseradish peroxidase (HRP) was added along with the sample or standard. The estradiol present in the sample or standard competed with the antigen estradiol for the binding site on the HRP-labeled anti-estradiol monoclonal antibody, forming a complex with the antigen estradiol-HRP on the plate. Any unbound components were washed away. A color-developing substrate (tetramethylbenzidine) was then added, which turned blue under catalysis by HRP and then became yellow upon the addition of a stop solution. Optical density values were measured at a wavelength of 450 nm using a spectrophotometer. The estradiol concentration was inversely proportional to the OD450 values. The estradiol concentration in the sample was determined by plotting a standard curve [37]. The mice were then killed by cervical dislocation, the bilateral leg bones were collected, and fur and muscle were removed from the leg bones. One intact tibia was fixed in 75% ethanol for micro-computed tomography (CT) bone density determination. After the CT scan, the tibia was used for Hematoxylin-Eosin staining and Masson staining, while the other tibia was cut frozen in liquid nitrogen and stored in a −80°C freezer for subsequent Western blot experiments.

2.3 RNA sequencing

MC3T3-E1 cells (ATCC, CRL-593) were cultured in α-minimum essential medium (Gibco Life Technologies Inc., USA) supplemented with 10% fetal bovine serum (HyClone, Inc., USA) and 1% penicillin and streptomycin antibiotics (Biyuntian Inc., China). After cells reached 80–90% confluence in a T-25-cm2 culture bottle, the cells were digested and seeded in a six-well plate. After 24 h of cell attachment, the old medium was removed, and a new medium with 100 μm H2O2 (Biyuntian Inc., China) or 10−6 mol/L estradiol (Sigma-Aldrich Inc., USA) was added to the treatment group, respectively, and phosphate-buffered solution (PBS) was added to the control group. After 12 h of treatment, adherent cells were washed quickly with PBS buffer, and 1 mL of TRIzol reagent (Thermo Scientific Inc., USA) was added to each well of the six-well plate and blown repeatedly with a pipette. The cells were transferred to a 1.5-mL RNase-free centrifuge tube for RNA sequencing (Novogene Inc., China). Liquid nitrogen was quick-frozen and stored in a −80℃ refrigerator for dry ice transportation.

2.4 Quantitative real time-PCR

We measured the expression of osteoblast formation markers by quantitative real time-PCR (qPCR). Total RNA was extracted from cells using NucleoZOL reagent (Macherey-Nagel Inc., Germany) according to the instructions. cDNA was synthesized using a high-capacity cDNA reverse transcription kit, and qPCR analysis was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme Inc., China) according to the manufacturer’s instructions. Target genes included alpl (F: ccaactcttttgtgccagaga, R: ggctacattggtgttgagctttt), ibsp (F: atggagacggcgatagttcc, R: ctagctgttacacccgagagt), col1a1 (F: gctcctcttaggggccact, R: attggggacccttaggccat), and runx2 (F: gactgtggttaccgtcatggc, R: acttggtttttcataacagcgga). GAPDH (F: tgcccccatgtttgtgatg, R: tgtggtcatgagcccttcc) served as an internal control. The relative levels of gene expression were estimated using the 2−ΔΔCt method.

2.5 Western blotting

Cells and bone tissue were lysed with RIPA lysis buffer (Solarbio Inc.) containing a 1× protease inhibitor and phosphatase inhibitor (Thermo Scientific Inc., USA). Equivalent amounts of protein were separated by electrophoresis and transferred to a polyvinylidene fluoride membrane. The membranes were probed with anti-Akt (1:1,000; #60203-2-lg; Proteintech Inc., China) and anti-phosphorylated Akt (1:1,000; Ser473; Cell Signaling Technology Inc., USA) antibodies, followed by HRP-conjugated anti-lgG [38]. Bound antibodies were visualized using a chemiluminescent substrate (Merck Millipore, Watford, UK) and images were acquired with Quantity One software (Bio-Rad, CA, USA).

2.6 Statistical analysis

All experiments were performed at least three times independently. Statistical analysis was carried out using GraphPad Prism 8.0 software by one-way analysis of variance and Tukey’s multiple comparison test. Statistical significance was defined as p < 0.05.

3 Results

3.1 EA improves bone density

The femurs of mice were scanned using a Siemens Inveon MM scanner, which has a spatial resolution of 1.4 mm with an X-ray energy of 80 kV and 500 μA. Micro-CT is a superior technique to dual-energy X-ray absorptiometry, as it provides a more accurate reflection of changes in bone mass, BMD, and quantitative measurements of bone trabecular microstructure, including bone volume, cortical thickness, and bone strength. Therefore, micro-CT is an important tool in the study of osteoporosis, osteoarthritis, osteosclerosis, and other bone metabolic diseases for elucidating bone microstructure in animal experiments and in vitro human specimens [39]. After interventions in ovariectomized mice (Figure 1), indicators including bone volume fraction (BV/TV), cortical bone thickness (Ct.Th), number of bone trabecular (Tb.N), and trabecular thickness (Tb.Th) were significantly increased, while the trabecular separation degree (Tb.Sp) showed an opposite trend (Figure 2a). The same results were observed in sham mice compared to ovariectomized mice, suggesting that the osteoporosis model in our study was successful. As shown in Figure 2, the bone structure arrangement of ovariectomized mice without interventions was sparse, disordered, and discontinuous; some regions of trabeculae were disrupted or even disappeared, and the bone marrow cavity was empty (Figure 2b and c). The bone surface area-to-bone volume (BS/BV) ratio can indirectly reflect bone mass. BV/TV, which is a common index for evaluating the bone mass of cortical bone and cancellous bone. In intramedullary cancellous bone, this ratio can reflect the amount of trabecular bone mass in different samples [40]. An increase in this value indicates that bone anabolism is greater than catabolism, causing the bone mass to increase, and indirectly reflects bone metabolism. This also applies to the evaluation of bone mass and bone metabolism of cortical bone in the middle part of the long bone. Tb.N, Tb.Th, and Tb.Sp are the main indexes characterizing trabecular spatial morphology. When bone catabolism is greater than bone anabolism, such as when osteoporosis occurs, Tb.N and Tb.Th decrease, and Tb.Sp increases. These indices indicate that bone anabolism is greater than catabolism, and bone mass increases, indirectly reflecting bone metabolism. EA treatment also showed a positive effect on the number of trabeculae and their arrangement, which was further confirmed by Hematoxylin-Eosin staining and Masson staining.

Figure 1 Mice in electroacupuncture (A).
Figure 1

Mice in electroacupuncture (A).

Figure 2 Micro-CT showed changes in bone density-related indexes in mice after EA treatment. BS/BV, bone surface area-to-bone volume ratio; BV/TV, bone volume fraction; Ct.Th, cortical bone thickness; Tb.N, number of trabecular; Tb.Sp, trabecular separation; Tb.Th, trabecular thickness. Quantitative parameters of trabecular bone and cortical bone were analyzed (a). Data are performed as mean ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Transverse plane morphology of the femur micro-CT; green represents bone trabeculae from different layers (b). Sagittal plane morphology of the femur (c).
Figure 2

Micro-CT showed changes in bone density-related indexes in mice after EA treatment. BS/BV, bone surface area-to-bone volume ratio; BV/TV, bone volume fraction; Ct.Th, cortical bone thickness; Tb.N, number of trabecular; Tb.Sp, trabecular separation; Tb.Th, trabecular thickness. Quantitative parameters of trabecular bone and cortical bone were analyzed (a). Data are performed as mean ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Transverse plane morphology of the femur micro-CT; green represents bone trabeculae from different layers (b). Sagittal plane morphology of the femur (c).

A histological examination using Hematoxylin-Eosin staining and Masson staining revealed distinct changes in bone quality in the OVX + non group. Specifically, a reduction in the trabecular number, a disrupted and discontinuous trabecular arrangement, fractured trabeculae, and significant expansion of the bone marrow cavity were observed. Additionally, an increase in fat cell density and decreased osteoblasts were evident. However, these pathological features were ameliorated in ovariectomized mice receiving the EA intervention (Figure 3a–c).

Figure 3 Bone histopathology and detection of serum indexes in mice. The Hematoxylin-Eosin staining of the four groups under 4× scope (a). The Hematoxylin-Eosin staining of the four groups under 10× scope (b). The Masson staining of the four groups under 10× scope; blue shows newly formed bone, and red shows mature bone tissue; NB represents new bone trabeculae (c). Four groups of mice, each group (n ≥ 6) were included in the test. The X-axis is the group, and the Y-axis is the concentration in the serum (d and e). Data are presented as mean ± SEM; *, p < 0.05; ***, p < 0.001.
Figure 3

Bone histopathology and detection of serum indexes in mice. The Hematoxylin-Eosin staining of the four groups under 4× scope (a). The Hematoxylin-Eosin staining of the four groups under 10× scope (b). The Masson staining of the four groups under 10× scope; blue shows newly formed bone, and red shows mature bone tissue; NB represents new bone trabeculae (c). Four groups of mice, each group (n ≥ 6) were included in the test. The X-axis is the group, and the Y-axis is the concentration in the serum (d and e). Data are presented as mean ± SEM; *, p < 0.05; ***, p < 0.001.

3.2 EA increased the concentration of SOD and estradiol in serum

Oxidative stress is a major contributor to bone loss, and its impact on bone health has been extensively studied. In this study, we examined the expression of SOD in the serum of model mice and found that EA significantly increased SOD levels, whereas SOD levels decreased when mice underwent ovariectomy. We further compared the OVX + non group with the SHAM + non group and found that oxidative stress increased after ovariectomy (Figure 3d). Estradiol is critical for osteoblast formation and differentiation, and our study revealed that the serum estradiol levels in ovariectomized mice were significantly increased in the EA groups compared to the non groups (Figure 3e). Our results suggest that the loss of estradiol reduces the defense against oxidative stress in bone, while EA treatment inhibits bone injury by increasing serum estradiol levels. Therefore, our findings support the potential of EA as a therapeutic approach to prevent bone loss induced by oxidative stress in ovariectomized mice.

3.3 Estradiol inhibits bone damage by activating the PI3K–Akt signaling pathway

MC3T3-E1 cells were subjected to treatment with H2O2 and estradiol, followed by transcriptome analysis using cluster analysis, differential gene volcano, KEGG enrichment, and Gene Ontology (GO) enrichment. Cluster analysis of the differentially expressed gene sets revealed that genes with similar expression patterns were clustered together, suggesting potential common functions or involvement in common metabolic and signaling pathways. The colors in the heatmap can only be compared horizontally (the expression of the same gene in different samples). We identified differential expression of genes involved in osteoblast generation and differentiation (Figure 4a). The volcano plot depicted the differential expression of genes involved in osteoblast generation and differentiation. More genes were differentially expressed with H2O2 treatment compared to estradiol treatment (Figure 4b and c). Then, we performed qPCR on several genes associated with osteoblast differentiation. From the results of the KEGG enrichment, the 20 most significant KEGG pathways were selected for generating scatter plots. Through KEGG enrichment, we found that the PI3k–Akt signaling pathway changed significantly and was downregulated in the H2O2 group and upregulated in the estradiol group (Figure 4d and e). GO is an internationally standardized classification system of gene functions used to comprehensively describe the properties of genes and gene products in living organisms. It categorizes genes according to molecular function, cellular component, and biological process (BP). The results of the GO analysis showed that the BPs of the genes in the two groups were mostly focused on osteoblast proliferation, differentiation, ossification, cell cycle, apoptosis, and the G protein-coupled receptor (GPCR) signaling pathway (Figure 4f and g). The results suggested that the PI3K–Akt pathway may play a crucial role in mediating the effects of H2O2 and estradiol on osteoblast differentiation and proliferation, as supported by the significant number of enriched genes associated with this pathway and their significant p-value.

Figure 4 Transcriptome results of MC3T3-E1 treated with estradiol and H2O2 respectively. Gene expression heatmap; mRNA levels changed significantly under two treatments. Color-coded microarray hybridization signals (blue to red = low-to-high signals) of the H2O2 group, the CON group, and the estradiol group (a). The volcanic plot, deferentially expressed genes in the two comparisons (estradiol group versus CON group, H2O2 group versus CON group) are clustered as dots in the figure. Two vertical lines indicate gene expression fold change >1 and <−1, respectively, and the horizontal line indicates the adjusted p value of 0.05. p values were calculated by a two-sided Wilcoxon rank-sum test. The color of the dot represents the p adjust levels (b and c). As shown in the figure, the abscissa is the ratio of the number of differentially expressed genes annotated to the total number of differentially expressed genes, and the ordinate is the KEGG pathway. The size of the dots represents the number of genes annotated to the KEGG pathway, and the color from red to blue represents the significance of enrichment (d) and (e). The PI3K–Akt pathway in (e) and (f) pictures was marked in blod font. Differential genes were enriched in the GO database. As shown in the figure, ten GO terms with more enriched genes were drawn from the BP ontologies. The horizontal coordinate is the description of the enriched gene, and the vertical coordinate is −1og10(padj) (f and g). Descriptions related to bone are highlighted.
Figure 4

Transcriptome results of MC3T3-E1 treated with estradiol and H2O2 respectively. Gene expression heatmap; mRNA levels changed significantly under two treatments. Color-coded microarray hybridization signals (blue to red = low-to-high signals) of the H2O2 group, the CON group, and the estradiol group (a). The volcanic plot, deferentially expressed genes in the two comparisons (estradiol group versus CON group, H2O2 group versus CON group) are clustered as dots in the figure. Two vertical lines indicate gene expression fold change >1 and <−1, respectively, and the horizontal line indicates the adjusted p value of 0.05. p values were calculated by a two-sided Wilcoxon rank-sum test. The color of the dot represents the p adjust levels (b and c). As shown in the figure, the abscissa is the ratio of the number of differentially expressed genes annotated to the total number of differentially expressed genes, and the ordinate is the KEGG pathway. The size of the dots represents the number of genes annotated to the KEGG pathway, and the color from red to blue represents the significance of enrichment (d) and (e). The PI3K–Akt pathway in (e) and (f) pictures was marked in blod font. Differential genes were enriched in the GO database. As shown in the figure, ten GO terms with more enriched genes were drawn from the BP ontologies. The horizontal coordinate is the description of the enriched gene, and the vertical coordinate is −1og10(padj) (f and g). Descriptions related to bone are highlighted.

3.4 Estradiol upregulates the expression of genes related to bone formation

Alkaline phosphatase (Alpl), bone sialoprotein (Ibsp), type Ⅰ collagen (Col1a1), and runt-related transcription factor 2 (Runx2) are well-known genes that play important roles in osteoblastic differentiation [41,42]. Alpl has been widely used as a diagnostic index to evaluate the bone formation capacity in osteoporosis due to its well-established use as an osteoblastic marker. Ibsp serves as an intermediate-stage marker, while Col1a1 is an early marker of osteoblast differentiation as it is primarily produced by osteoblasts during bone formation. Runx2 is involved in inhibiting adipogenic differentiation and directing mesenchymal stromal cells toward an osteogenic lineage [41,42]. Our transcriptome analysis revealed that the expression of these four genes was differentially regulated (Figure 5a). Subsequent qPCR experiments unequivocally substantiated that these genes were upregulated following estradiol administration but were downregulated after H2O2 treatment (Figure 5b). The consistency between the results obtained from the transcriptome analysis and the qPCR experiments supports the differential expression findings of these four genes in response to H2O2 and estradiol treatments during osteoblastic differentiation. This evidence showed that estradiol impeded bone loss and fostered bone formation.

Figure 5 Expression of genes associated with bone formation. In transcriptome sequencing, the number of counts alignment on the four genes Alpl, Ibsp, Col1a1, and Runx2 indicated the expression level (a). H2O2 decreases the differentiation of osteoblast-related genes, and osteoblasts were pretreated with H2O2 (100 µm) for 12 h. Estradiol increases the differentiation of osteoblast-related genes, and osteoblasts were pretreated with Estradiol (10−6 mol/L) for 12 h. The mRNA expression value is normalized to GAPDH expression (b). The data are presented as the mean ± SEM, *, p < 0.05; **, p < 0.01; ****, p < 0.0001.
Figure 5

Expression of genes associated with bone formation. In transcriptome sequencing, the number of counts alignment on the four genes Alpl, Ibsp, Col1a1, and Runx2 indicated the expression level (a). H2O2 decreases the differentiation of osteoblast-related genes, and osteoblasts were pretreated with H2O2 (100 µm) for 12 h. Estradiol increases the differentiation of osteoblast-related genes, and osteoblasts were pretreated with Estradiol (10−6 mol/L) for 12 h. The mRNA expression value is normalized to GAPDH expression (b). The data are presented as the mean ± SEM, *, p < 0.05; **, p < 0.01; ****, p < 0.0001.

3.5 EA treats osteoporosis by activating the PI3K–Akt pathway

Transcriptome analysis revealed that the PI3K–Akt pathway is involved in bone resorption induced by oxidative stress. To investigate whether estradiol could inhibit bone mass loss caused by oxidative stress, we assessed the effect of estradiol on p-AKT expression at the cellular level. Estradiol increased p-AKT expression, while H2O2 decreased it. Estradiol treatment of the H2O2 treatment group partially restored the decreased p-AKT expression. The p-AKT level was significantly changed in the estradiol-treated group, H2O2-treated group, and H2O2+E2 (HE)-treated group, and total AKT was significantly changed in the estradiol-treated group. However, the ratio of phosphorylated AKT to total AKT was not significant in any of the groups (Figure 6a and c). At the tissue level, we explored the effect of EA on bone quality and the PI3K–Akt signaling pathway. Compared to the SHAM + non group, the OVX + non group exhibited a reduction in p-AKT expression post-ovariectomy, which was subsequently increased following EA intervention, as observed in the OVX + EA group. A similar trend was observed in the level of total AKT protein; however, there was no significant difference in the ratio of phosphorylated AKT to total AKT (Figure 6b and d). These findings indicate that EA confers significant protection against oxidative stress-induced injury in osteoblast cells, potentially by activating the PI3K–Akt pathway.

Figure 6 Changes in proteins of the PI3K-Akt pathway under different treatments. Cells were pretreated with H2O2, E2, and H2O2 + E2 for 12 h. AKT and P-AKT levels were measured by Western blot. E2, estradiol; CON, control; HE, H2O2 + E2. Quantitative analysis of the Western blot (n = 3); the relative value is normalized to GAPDH expression. The data are presented as the mean ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001 (a, b). Western blot analysis for the expression of AKT and P-AKT at the cellular level (c); Western blot analysis for the expression of AKT and P-AKT at the tissue level (d).
Figure 6

Changes in proteins of the PI3K-Akt pathway under different treatments. Cells were pretreated with H2O2, E2, and H2O2 + E2 for 12 h. AKT and P-AKT levels were measured by Western blot. E2, estradiol; CON, control; HE, H2O2 + E2. Quantitative analysis of the Western blot (n = 3); the relative value is normalized to GAPDH expression. The data are presented as the mean ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001 (a, b). Western blot analysis for the expression of AKT and P-AKT at the cellular level (c); Western blot analysis for the expression of AKT and P-AKT at the tissue level (d).

4 Discussion

With the rapid progression of global population aging, the incidence of osteoporosis is steadily rising, particularly among postmenopausal women. Given the significant morbidity and mortality rates associated with osteoporosis and its substantial social and economic burden, osteoporosis has become a significant public health concern [43]. Existing treatment modalities are frequently inadequate and are hindered by potential side effects and suboptimal patient adherence. Thus, this study sought to elucidate the therapeutic effects of EA, a TCM intervention, as a complementary therapy for osteoporosis. EA is cost-effective, has minimal side effects, and has shown promise in the management of osteoporosis.

In this study, we demonstrated that EA ameliorated osteoporosis in ovariectomized mice, as evidenced by significant improvements in bone histomorphometry and tissue histology. Furthermore, we showed that EA increased systemic estrogen levels in ovariectomized mice. The beneficial effects of EA on osteoporosis in ovariectomized models have been previously reported, in which BMD, bone strength, bone structure, and markers of bone formation and resorption all improved [29]. Consistent with prior research, our findings underscore the therapeutic potential of EA in alleviating osteoporosis. Despite variations in the types of acupuncture and the selection of specific acupoints compared to previous studies, our results highlight the necessity for further exploration into the mechanisms underlying the effects of EA.

Acupuncture, originating in China and practiced for over 2,500 years, has recently garnered scientific interest for its potential regulation of the “neuro-endocrine-immune network,” a concept introduced by Professor Besedovsky in the 20th century. Acupuncture can locally activate cell functions and neuroreceptors and also regulate the release of biomolecules, such as hormones, neurotransmitters, and neuromodulators into the microenvironment, thus achieving comprehensive regulation through their interactions [44]. Previous studies demonstrated that acupuncture can modulate the hypothalamic–pituitary–gonadal (adrenal) axis. In ovariectomized rats, acupuncture increased serum levels of estradiol, parathyroid hormone, bone gla protein, insulin-like growth factor-1, and calcitonin, thereby enhancing calcium metabolism and bone homeostasis [45]. These findings suggest that hormonal regulation is a direct effect of EA stimulation, consistent with our results.

According to TCM theory, osteoporosis is primarily caused by Qi deficiency and blood stasis, which are often associated with dysfunction in the liver, kidney, and spleen [46]. Numerous studies have explored acupuncture treatment for postmenopausal osteoporosis from the perspective of liver and kidney deficiency, focusing on specific acupoints such as BL23 (Shenshu), ST36 (Zusanli), BL11 (Dazhu), CV4 (Guanyuan), GV4 (Mingmen), SP6 (Sanyinjiao), KI3 (Taixi), BL18 (Ganshu), and GB39, consistent with the principles of nourishing the kidney and spleen [45]. A previous study reported that EA treatment at ST36 and SP6 acupoints increased serum estradiol levels, BMD, and bone strength in ovariectomized rats [47]. Additionally, EA treatment at BL20 (Pishu), BL23, and ST36 acupoints in ovariectomized New Zealand rabbits prevented bone loss by upregulating estradiol and downregulating osteoprotegerin (OPG) ligands [48]. Based on the “Shaoyang main bone” theory recorded in the Neijing, some researchers suggest that acupuncture at the Shaoyang meridian points of the foot can balance osteogenesis and osteoclastic resorption, thus improving osteoporosis [36]. Consequently, in our study, we selected the GB30, GB34, and GB39 acupoints, all key points of the Shaoyang gallbladder meridian, to further investigate the efficacy of EA applied to these acupoints for treating osteoporosis, and to discern the underlying molecular mechanisms.

The mechanisms underlying the efficacy of acupuncture in treating osteoporosis have been partially elucidated. First, acupuncture appears to mitigate bone loss by modulating the adrenal axis. Previous research demonstrated that acupuncture at ST36, BL23, and BL11 acupoints regulated serum levels of estradiol, corticotropin-releasing hormone, adrenocorticotropin, and corticosterone, thereby improving osteoporosis [49]. Second, acupuncture has been shown to reduce pro-inflammatory factors, inhibiting those involved in osteoclastogenesis and enhancing bone metabolism. Studies have indicated that acupuncture at the ST36 acupoint reduced serum IL-1β expression in ovariectomized rats; generally, acupuncture can mitigate bone destruction and slow the progression of osteoporosis by downregulating inflammatory factors such as tumor necrosis factor-α and interleukin-6 [45,50]. Third, acupuncture activates various signaling pathways that promote bone formation and increase bone density. For example, acupuncture has been shown to regulate the RANKL–OPG pathway to inhibit bone resorption, activate the Wnt/β-catenin pathway to promote bone formation and strengthen bone, and modulate the TGF-β signaling pathway to enhance osteoblast proliferation [29,45,51]. Notably, the role of the PI3K–Akt pathway in acupuncture-induced effects on ovariectomized mice has remained unexplored, and our study addresses this gap in the literature.

The PI3K–Akt pathway is well-documented as promoting osteoblast proliferation and inhibiting bone resorption [52]. Inhibition of p-AKT exacerbates bone mass loss in osteoarthritis models, while upregulation of AKT and particularly of p-AKT by estradiol is known to induce chondrocyte proliferation [53]. This pathway is also involved in regulating the proliferation, differentiation, and apoptosis of osteoclasts and osteoblasts. Activation of the PI3K–Akt signaling pathway in ovariectomized mouse models was shown to improve mitochondrial function, alleviate osteoblast pyroptosis, promote bone formation, and ameliorate osteoporosis [54]. Additionally, activation of the PI3K–Akt pathway promoted the proliferation and differentiation of bone marrow mesenchymal stem cell precursors in ovariectomized rats [55]. The importance of Akt in bone formation is highlighted by Akt knockout (Akt-KO) mice, which exhibit osteopenia, reduced body size, and shorter bone length [56]. Our study corroborated these findings and demonstrated that estradiol inhibited H2O2-induced bone loss via the PI3K–Akt pathway in ovariectomized mice. This underscores the role of the PI3K–Akt pathway in counteracting oxidative stress-induced bone loss, which is particularly significant given the detrimental impact of reactive oxygen species on bone health. Although previous studies have primarily used rats as research models, we opted for mice due to their ease of handling and the use of osteogenic cell lines also derived from mouse skulls. Additionally, mice share closer genetic and physiological similarities to humans, potentially enhancing the clinical translatability of our findings.

The role of GPCR, also known as G protein-coupled estrogen receptor, in the proliferation of human fetal osteoblast cell lines induced by estradiol is well-documented [57]. Estrogen-induced GPCR is crucial in the osteogenic axis, as it activates the ERK1/2 and PI3K–Akt signaling pathways to promote mitophagy in osteoblasts and reduce osteoblast apoptosis, thereby reversing osteoporosis [54,58,59]. Our GO enrichment analysis further corroborated that the GPCR signaling pathway is implicated in these biological processes (Figure 4f and g). In our study, ovariectomized mice developed osteoporosis, characterized in part by decreased serum SOD and estradiol levels. Subsequent EA stimulation at acupoints GB30, GB34, and GB39 increased serum estradiol levels in these mice, effectively mitigating bone damage induced by oxidative stress. Estradiol exerts its effects by binding to GPCR on cell membranes and activating PI3K, which subsequently activates Akt. This activation promotes cell differentiation, proliferation, and ossification, ultimately attenuating osteoporosis (Figure 7). Our findings contribute to the growing body of evidence supporting the beneficial effects on bone health of applying EA at GB acupoints and provide insights into the underlying mechanisms involved.

Figure 7 Schematic diagram demonstrating how electroacupuncture improves osteoporosis.
Figure 7

Schematic diagram demonstrating how electroacupuncture improves osteoporosis.

Despite these encouraging findings, there are still some limitations that need to be addressed. Experiments on mice may affect the applicability of the results in clinical settings. We look forward to conducting future studies on larger animal models, such as rabbits, dogs, pigs, or primates, to provide a molecular basis for future clinical applications. Moreover, investigating how different acupoints might interact with various signaling pathways involved in bone metabolism could provide a more comprehensive understanding of the mechanisms by which EA improves osteoporosis. Furthermore, longitudinal studies to observe the long-term effects of EA on bone health and its potential preventative benefits would be highly valuable.

5 Conclusion

This study elucidated the role of the PI3K–Akt signaling pathway in the therapeutic efficacy of EA at specific GB acupoints for treating osteoporosis. Specifically, the PI3K–Akt signaling pathway was observed to be attenuated in osteoporotic mice, and EA stimulation at specific GB acupoints markedly increased the expression of p-AKT and serum estradiol in these mice. These findings suggest that EA exerts its molecular effects in the treatment of osteoporosis by enhancing osteoblast differentiation, proliferation, and ossification by upregulating serum estradiol and activating p-AKT.

# Contributed equally to this work.

  1. Funding information: This work was supported by Sichuan Science and Technology Program (2022YFS0610) and Key Project of Southwest Medical University: Experimental Study on Electroacupuncture Intervention on Bone Metabolism and Glucose Metabolism in Type 2 Diabetes Rats during 7 a.m. to 9 a.m. (03/00030859).

  2. Author contributions: W.X.Y.: designed, investigation, methodology, performed data analysis, and wrote the manuscript.; Z.X.Y.: methodology, data collection and analysis; L.Y.: organized, methodology, data collection; D.Y.F.: performed data analysis; L.C.: supervision; J.H.: edited and revised the manuscript; L.G.: typeset and revised the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: Authors state no conflicts of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Johnston CB, Dagar M. Osteoporosis in older adults. Med Clin North Am. 2020;104(5):873–84.10.1016/j.mcna.2020.06.004Search in Google Scholar PubMed

[2] Wu AM, Bisignano C, James SL, Abady GG, Abedi A, Abu-Gharbieh E, et al. Global, regional, and national burden of bone fractures in 204 countries and territories, 1990–2019: a systematic analysis from the Global Burden of Disease Study 2019. Lancet Healthy Longev. 2021;2(9):e580–92.10.1016/S2215-0366(21)00395-3Search in Google Scholar PubMed PubMed Central

[3] Warming L, Hassager C, Christiansen C. Changes in bone mineral density with age in men and women: a longitudinal study. Osteoporos Int. 2002;13(2):105–12.10.1007/s001980200001Search in Google Scholar PubMed

[4] Laurent MR, Dedeyne L, Dupont J, Mellaerts B, Dejaeger M, Gielen E. Age-related bone loss and sarcopenia in men. Maturitas. 2019;122:51–6.10.1016/j.maturitas.2019.01.006Search in Google Scholar PubMed

[5] Wang LH, Yu W, Yin XJ, Cui LJ, Tang SY, Jiang N, et al. Prevalence of osteoporosis and fracture in China: The China osteoporosis prevalence study. JAMA Netw Open. 2021;4(8):e2121106.10.1001/jamanetworkopen.2021.21106Search in Google Scholar PubMed PubMed Central

[6] Eastell R, O’Neill TW, Hofbauer LC, Langdahl B, Reid IR, Gold DT, et al. Postmenopausal osteoporosis. Nat Rev Dis Primers. 2016;2:16069.10.1038/nrdp.2016.69Search in Google Scholar PubMed

[7] Bhatnagar A, Kekatpure AL. Postmenopausal osteoporosis: a literature review. Cureus. 2022;14(9):e29367.10.7759/cureus.29367Search in Google Scholar PubMed PubMed Central

[8] Cheng CH, Chen LR, Chen KH. Osteoporosis due to hormone imbalance: an overview of the effects of estrogen deficiency and glucocorticoid overuse on bone turnover. Int J Mol Sci. 2022;23(3):1376.10.3390/ijms23031376Search in Google Scholar PubMed PubMed Central

[9] Komori T. Animal models for osteoporosis. Eur J Pharmacol. 2015;759:287–94.10.1016/j.ejphar.2015.03.028Search in Google Scholar PubMed

[10] Medina-Contreras J, Villalobos-Molina R, Zarain-Herzberg A, Balderas-Villalobos J. Ovariectomized rodents as a menopausal metabolic syndrome model. A minireview. Mol Cell Biochem. 2020;475(1–2):261–76.10.1007/s11010-020-03879-4Search in Google Scholar PubMed

[11] Muñoz-Garach A, García-Fontana B, Muñoz-Torres M. Nutrients and dietary patterns related to osteoporosis. Nutrients. 2020;12(7):1986.10.3390/nu12071986Search in Google Scholar PubMed PubMed Central

[12] Xu J, Yu LX, Liu F, Wan LB, Deng ZH. The effect of cytokines on osteoblasts and osteoclasts in bone remodeling in osteoporosis: a review. Front Immunol. 2023;14:1222129.10.3389/fimmu.2023.1222129Search in Google Scholar PubMed PubMed Central

[13] Chandra A, Rajawat J. Skeletal aging and osteoporosis: mechanisms and therapeutics. Int J Mol Sci. 2021;22(7):3553.10.3390/ijms22073553Search in Google Scholar PubMed PubMed Central

[14] Yu YH, Li XP, Zheng MJ, Zhou LY, Zhang JJ, Wang J, et al. The potential benefits and mechanisms of protein nutritional intervention on bone health improvement. Crit Rev Food Sci Nutr. 2024;64(18):6380–94.10.1080/10408398.2023.2168250Search in Google Scholar PubMed

[15] Hamada Y, Fujii H, Fukagawa M. Role of oxidative stress in diabetic bone disorder. Bone. 2009;45:S35–8.10.1016/j.bone.2009.02.004Search in Google Scholar PubMed

[16] Agidigbi TS, Kim C. Reactive oxygen species in osteoclast differentiation and possible pharmaceutical targets of ROS-mediated osteoclast diseases. Int J Mol Sci. 2019;20(14):3576.10.3390/ijms20143576Search in Google Scholar PubMed PubMed Central

[17] Munmun F, Witt‐Enderby PA. Melatonin effects on bone: Implications for use as a therapy for managing bone loss. J Pineal Res. 2021;71(1):e12749.10.1111/jpi.12749Search in Google Scholar PubMed

[18] Tao ZS, Li TL, Yang M, Xu HG. Silibinin can promote bone regeneration of selenium hydrogel by reducing the oxidative stress pathway in ovariectomized rats. Calcif Tissue Int. 2022;110(6):723–35.10.1007/s00223-021-00936-ySearch in Google Scholar PubMed

[19] Zhou W, Liu Y, Shen JN, Yu BQ, Bai JX, Lin JY, et al. Melatonin increases bone mass around the prostheses of OVX rats by ameliorating mitochondrial oxidative stress via the SIRT3/SOD2 signaling pathway. Oxid Med Cell Longev. 2019;2019:4019619.10.1155/2019/4019619Search in Google Scholar PubMed PubMed Central

[20] Cervellati C, Bonaccorsi G, Cremonini E, Romani A, Fila E, Castaldini MC, et al. Oxidative stress and bone resorption interplay as a possible trigger for postmenopausal osteoporosis. Biomed Res Int. 2014;2014:569563.10.1155/2014/569563Search in Google Scholar PubMed PubMed Central

[21] Baek KH, Oh KW, Lee WY, Lee SS, Kim MK, Kwon HS, et al. Association of oxidative stress with postmenopausal osteoporosis and the effects of hydrogen peroxide on osteoclast formation in human bone marrow cell cultures. Calcif Tissue Int. 2010;87(3):226–35.10.1007/s00223-010-9393-9Search in Google Scholar PubMed

[22] Manolagas SC. From estrogen-centric to aging and oxidative stress: a revised perspective of the pathogenesis of osteoporosis. Endocr Rev. 2010;31(3):266–300.10.1210/er.2009-0024Search in Google Scholar PubMed PubMed Central

[23] Abdollahi M, Larijani B, Rahimi R, Salari P. Role of oxidative stress in osteoporosis. Therapy. 2005;2:787–96.10.2217/14750708.2.5.787Search in Google Scholar

[24] Maksimović M, Jurišić V, Erdeljan B, Zvekić-Svorcan J, Lazarević B, Dojcinovic D. Evaluation of adherence to calcium, vitamin D and drugs for osteoporosis in patients with low bone mineral density. Srpski Arh Za Celokupno Lekarstvo. 2017;145:259–64.10.2298/SARH160524041MSearch in Google Scholar

[25] Kling JM, Clarke BL, Sandhu NP. Osteoporosis prevention, screening, and treatment: a review. J Womens Health. 2014;23(7):563–72.10.1089/jwh.2013.4611Search in Google Scholar PubMed PubMed Central

[26] Pan H, Jin RJ, Li MX, Liu ZH, Xie Q, Wang P. The effectiveness of acupuncture for osteoporosis: a systematic review and meta-analysis. Am J Chin Med. 2018;46(3):489–513.10.1142/S0192415X18500258Search in Google Scholar PubMed

[27] Mak JCS, Faux S. Complementary and alternative medicine use by osteoporotic patients in Australia (CAMEO-A): a prospective study. J Alter Complement Med. 2010;16(5):579–84.10.1089/acm.2009.0425Search in Google Scholar PubMed

[28] Ouyang G, Wang LL, Wang DY, Zhuo TJ, Shen ZX. The effect of acupuncture on bone mineral density in postmenopausal women. J Tradit Chin Med. 2002;22(1):9–11.10.1186/s12905-022-01662-9Search in Google Scholar PubMed PubMed Central

[29] Zheng XF, Nie Y, Sun CT, Wu GW, Cai QY, Huang S, et al. Long-term electroacupuncture stimulation prevents osteoporosis in ovariectomised osteopaenic rats through multiple signalling pathways. Acupunct Med. 2018;36(3):176–82.10.1136/acupmed-2016-011268Search in Google Scholar PubMed

[30] Yan DD, Wang J, Hou XH, Bao YQ, Zhang ZL, Hu C, et al. Association of serum uric acid levels with osteoporosis and bone turnover markers in a Chinese population. Acta Pharmacol Sin. 2017;39(4):626–32.10.1038/aps.2017.165Search in Google Scholar PubMed PubMed Central

[31] Zhou J, Li XH, Liao Y, Feng WB, Guo X. Effects of electroacupuncture on bone mass and cathepsin K expression in ovariectomised rats. Acupunct Medicine. 2014;32(6):478–85.10.1136/acupmed-2014-010577Search in Google Scholar PubMed

[32] Luo WG, Bu W, Chen HQ, Liu WH, Lu XD, Zhang GS, et al. Electroacupuncture reduces oxidative stress response and improves secondary injury of intracerebral hemorrhage in rats by activating the peroxisome proliferator-activated receptor-γ/nuclear factor erythroid2-related factor 2/γ-glutamylcysteine synthetase pathway. Neuroreport. 2024;35(8):499–508.10.1097/WNR.0000000000002026Search in Google Scholar PubMed PubMed Central

[33] Cheng M, Wu X, Wang F, Tan B, Hu J. Electro-acupuncture inhibits p66Shc-mediated oxidative stress to facilitate functional recovery after spinal cord injury. J Mol Neurosci. 2020;70(12):2031–40.10.1007/s12031-020-01609-5Search in Google Scholar PubMed

[34] Lang J, Luo J, Wang L, Xu W, Jia J, Zhao Z, et al. Electroacupuncture suppresses oxidative stress and ferroptosis by activating the mTOR/SREBP1 pathway in ischemic stroke. Crit Rev Immunol. 2024;44(6):99–110.10.1615/CritRevImmunol.2024051934Search in Google Scholar PubMed

[35] Ju DH, Liu MJ, Zhao HY, Wang J. Mechanisms of “kidney governing bones” theory in traditional Chinese medicine. Front Med. 2014;8(3):389–93.10.1007/s11684-014-0362-ySearch in Google Scholar PubMed

[36] Wang HD, Chen Z, Inoue I, Fu SJ, Shi XL, Tang L, et al. Effects of electroacupuncture at GB points on markers of osteoporosis and bodyweight in ovariectomised rats. Acupunct Med. 2015;33(6):465–71.10.1136/acupmed-2014-010743Search in Google Scholar PubMed PubMed Central

[37] Jurisic V. Multiomic analysis of cytokines in immuno-oncology. Expert Rev Proteom. 2020;17(9):663–74.10.1080/14789450.2020.1845654Search in Google Scholar PubMed

[38] Jurisic V, Srdic-Rajic T, Konjevic G, Bogdanovic G, Colic M. TNF-α induced apoptosis is accompanied with rapid CD30 and slower CD45 shedding from K-562 cells. J Membr Biol. 2011;239(3):115–22.10.1007/s00232-010-9309-7Search in Google Scholar PubMed

[39] Körmendi S, Vecsei B, Orhan K, Dobó-Nagy C. Micro-CT in osteoporosis research. In: Orhan K, editor. Micro-computed tomography (micro-CT) in medicine and engineering. Cham: Springer International Publishing; 2020. p. 87–107.10.1007/978-3-030-16641-0_7Search in Google Scholar

[40] Brizi L, Barbieri M, Baruffaldi F, Bortolotti V, Fersini C, Liu H, et al. Bone volume-to-total volume ratio measured in trabecular bone by single-sided NMR devices. Magn Reson Med. 2017;79(1):501–10.10.1002/mrm.26697Search in Google Scholar PubMed

[41] Liu WJ, Zhang LQ, Xuan K, Hu CH, Liu SY, Liao L, et al. Alpl prevents bone ageing sensitivity by specifically regulating senescence and differentiation in mesenchymal stem cells. Bone Res. 2018;6:27.10.1038/s41413-018-0029-4Search in Google Scholar PubMed PubMed Central

[42] Nakajima K, Kho DH, Yanagawa T, Harazono Y, Gao XG, Hogan V, et al. Galectin-3 inhibits osteoblast differentiation through notch signaling. Neoplasia. 2014;16(11):939–49.10.1016/j.neo.2014.09.005Search in Google Scholar PubMed PubMed Central

[43] Walker MD, Shane E. Postmenopausal osteoporosis. N Engl J Med. 2023;389(21):1979–91.10.1056/NEJMcp2307353Search in Google Scholar PubMed

[44] Liu SB, Wang ZF, Su YS, Qi L, Yang W, Fu MZ, et al. A neuroanatomical basis for electroacupuncture to drive the vagal–adrenal axis. Nature. 2021;598(7882):641–45.10.1038/s41586-021-04001-4Search in Google Scholar PubMed PubMed Central

[45] Tian YM, Wang LL, Xu TS, Li R, Zhu RY, Chen BB, et al. Acupuncture for osteoporosis: a review of its clinical and preclinical studies. J Acupunct Meridian Stud. 2022;15(5):281–99.10.51507/j.jams.2022.15.5.281Search in Google Scholar PubMed

[46] Wang SJ, Yue W, Rahman KF, Xin HL, Zhang QY, Qin LP, et al. Mechanism of treatment of kidney deficiency and osteoporosis is similar by traditional Chinese medicine. Curr Pharm Des. 2016;22(3):312–20.10.2174/1381612822666151112150346Search in Google Scholar PubMed

[47] Zhou J, Chen SJ, Guo H, Xia L, Liu HF, Qin YX, et al. Electroacupuncture prevents ovariectomy-induced osteoporosis in rats: a randomised controlled trial. Acupunct Med. 2012;30(1):37–43.10.1136/acupmed-2011-010114Search in Google Scholar PubMed

[48] He J, Yang L, Qing YX, He CQ. Effects of electroacupuncture on bone mineral density, oestradiol level and osteoprotegerin ligand expression in ovariectomised rabbits. Acupunct Med. 2014;32(1):37–42.10.1136/acupmed-2012-010271Search in Google Scholar PubMed

[49] Li X, Wu KN, Dong QZ, Chen HX, Li CY, Ren ZQ, et al. Overall adjustment acupuncture improves osteoporosis and exerts an endocrine-modulating effect in ovariectomized rats. Front Endocrinol. 2022;13:1074516.10.3389/fendo.2022.1074516Search in Google Scholar PubMed PubMed Central

[50] Liu XX, Shen L, Wu BH, Gao L, Hu WS, Zhang AZ. Effects of acupuncture on myelogenic osteoclastogenesis and IL-6 mRNA expression. J Tradit Chin Med. 2004;24(2):144–48.Search in Google Scholar

[51] Fan HL, Ji F, Lin Y, Zhang ML, Qin W, Zhou Q, et al. Electroacupuncture stimulation at CV4 prevents ovariectomy-induced osteoporosis in rats via Wnt-β-catenin signaling. Mol Med Rep. 2016;13(3):2485–91.10.3892/mmr.2016.4849Search in Google Scholar PubMed PubMed Central

[52] Dong J, Xu XQ, Zhang QY, Yuan ZN, Tan BY. The PI3K/AKT pathway promotes fracture healing through its crosstalk with Wnt/β-catenin. Exp Cell Res. 2020;394(1):112137.10.1016/j.yexcr.2020.112137Search in Google Scholar PubMed

[53] Xi JC, Zang HY, Guo LX, Xue HB, Liu XD, Bai YB, et al. The PI3K/AKT cell signaling pathway is involved in regulation of osteoporosis. J Recept Signal Transduct Res. 2015;35(6):640–45.10.3109/10799893.2015.1041647Search in Google Scholar PubMed

[54] Chai S, Yang YB, Wei LW, Cao YJ, Ma JT, Zheng XX, et al. Luteolin rescues postmenopausal osteoporosis elicited by OVX through alleviating osteoblast pyroptosis via activating PI3K-AKT signaling. Phytomedicine. 2024;128:155516.10.1016/j.phymed.2024.155516Search in Google Scholar PubMed

[55] Wang YD, Gao Y, Wang Y, Zhang HY, Qin QZ, Xu ZH, et al. GDNF promotes the proliferation and osteogenic differentiation of jaw bone marrow mesenchymal stem cells via the Nr4a1/PI3K/Akt pathway. Cell Signal. 2023;108:110721.10.1016/j.cellsig.2023.110721Search in Google Scholar PubMed

[56] Kawamura N, Kugimiya F, Oshima Y, Ohba S, Ikeda T, Saito T, et al. Akt1 in osteoblasts and osteoclasts controls bone remodeling. PLoS One. 2007;2(10):e1058.10.1371/journal.pone.0001058Search in Google Scholar PubMed PubMed Central

[57] Prossnitz ER, Barton M. The G-protein-coupled estrogen receptor GPER in health and disease. Nat Re Endocrinol. 2011;7(12):715–26.10.1038/nrendo.2011.122Search in Google Scholar PubMed PubMed Central

[58] Dashti P, Thaler R, Hawse JR, Galvan ML, van der Eerden BJ, van Wijnen AJ, et al. G-protein coupled receptor 5C (GPRC5C) is required for osteoblast differentiation and responds to EZH2 inhibition and multiple osteogenic signals. Bone. 2023;176:116866.10.1016/j.bone.2023.116866Search in Google Scholar PubMed PubMed Central

[59] Barton M, Filardo EJ, Lolait SJ, Thomas P, Maggiolini M, Prossnitz ER. Twenty years of the G protein-coupled estrogen receptor GPER: Historical and personal perspectives. J Steroid Biochem Mol Biol. 2018;176:4–15.10.1016/j.jsbmb.2017.03.021Search in Google Scholar PubMed PubMed Central

Received: 2024-05-08
Revised: 2024-08-24
Accepted: 2024-09-13
Published Online: 2024-11-19

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
https://doi.org/10.1515/biol-2022-0978
Keywords for this article
osteoporosis; electroacupuncture; PI3K-Akt; oxidative stress; estradiol
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 24.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0978/html
Scroll to top button