Abstract
Endometriosis (EM) is a prevalent estrogen-dependent disorder that adversely affects the life quality of many reproductive-age women. Previous evidence has suggested the significant role of miR-429 in EM; however, its molecular mechanisms underlying EM pathogenesis are unclarified. Human endometrial stromal cells (HESCs) were identified using immunofluorescence staining and flow cytometry. A mouse EM model was established by endometrial auto-transplantation. RNA and protein expression of molecules was examined using real-time quantitative polymerase chain reaction and western blotting, respectively. In vitro functional experiments showed that inhibiting miR-429 restrained HESC proliferation, migration, and invasiveness. Luciferase reporter assay confirmed that miR-429 targeted hypoxia-inducible factor 1 subunit alpha inhibitor (HIF1AN) in HESCs. HIF1AN silencing offset the negative regulation of miR-429 inhibition on the HIF1A/vascular endothelial growth factor (VEGF) signaling pathway. In vivo experiments showed that depletion of miR-429 attenuated ectopic lesion development in the mouse EM model. Collectively, suppressing miR-429 hinders the invasive behaviors of HESCs and EM progression in mice by targeting HIF1AN and regulating the HIF1A/VEGF signaling pathway.
1 Introduction
Endometriosis (EM) is a prevalent gynecological disorder referring to the extra-uterine growth of endometrial stromal or glandular tissue [1]. It affects approximately 10% of reproductive-age women and can cause symptoms including chronic pelvic pain, dysmenorrhea, dyspareunia, and infertility [2,3]. Although benign, EM shares very similar biological characteristics with malignant tumors and has been considered a precursor lesion of several malignancies, including ovarian cancer [4]. The pathogenesis of EM remains unclear. Accumulating evidence has indicated that the increased proliferation, invasion, migration, and adhesion of endometrial stromal cells (ESCs) contribute to the ectopic implantation of endometrial tissue and the progression of endometriotic lesions [5]. Repression of the invasive behaviors of ESCs mitigates EM development [6].
MicroRNAs (miRNAs) are small endogenous nonprotein-coding fragments with approximately 22 nucleotides and mediate gene expression post-transcriptionally [7]. Circulating miRNAs are considered promising diagnostic biomarkers for diseases largely owing to their high stability in human fluids [8]. As estimated, miRNAs control more than 50% of the mammalian protein-coding genes involved in various biological processes [9]. Accumulating evidence has suggested that targeting miRNAs is a promising therapeutic strategy for disease treatment [10]. Recent reports have suggested that miRNAs are implicated in the pathophysiology of EM. For instance, rhein exhibits an anti-proliferative role in EM by repressing miR-135 [11]. Kai et al. demonstrated that miR-210 is downregulated in ectopic endometrial samples and overexpressing miR-210 attenuates the proliferation and migration of ectopic endometriotic epithelial cells [12]. Moreover, previous evidence has indicated the upregulation of miR-429 in EM patients, and Berberine can impede the invasive phenotypes of ESCs by downregulating miR-429 [13,14]. These results indicate the significant role of miR-429 in EM. Nevertheless, the underlying molecular mechanisms of miR-429 in regulating EM progression are unclear.
Hypoxia-inducible factor 1 subunit alpha inhibitor (HIF1AN) gene is located at chromosome 10q24.31 and encodes an asparaginyl hydroxylase that regulates the activity of key biological modulators via hydroxylation [15]. HIF1AN is a well-known negative regulator of HIF1A [16]. It was demonstrated that HIF1A is upregulated in the ectopic endometrium of EM patients and contributes to ESC invasiveness and migration by enhancing autophagy [17]. Additionally, vascular endothelial growth factor (VEGF) is a downstream target of HIF1A. HIF1A binds to hypoxia-responsive elements in the promoter of VEGF, consequently leading to VEGF upregulation [18]. The VEGF level in the peritoneal fluid of EM patients is markedly increased in comparison to that of health controls [19]. Ye et al. demonstrated that miR-21-5p targets and downregulates HIF1AN, consequently leading to the activation of the HIF1A/VEGF pathway in choriocarcinoma [20]. Herein, we investigated whether miR-429 regulated the invasive behaviors of ESCs via the HIF1AN-mediated HIF1A/VEGF pathway.
Herein, we explored miR-429 functions and molecular mechanisms in regulating the invasive phenotypes of ESCs. It was hypothesized that miR-429 might mediate ESC phenotypes by regulating downstream molecules. Our results might help deepen the understanding of molecular mechanisms underlying EM pathogenesis.
2 Materials and methods
2.1 Cell culture and characterization
Human endometrial stromal cells (HESCs) purchased from Procell (Wuhan, China) were incubated in Dulbecco's modified Eagle's medium (Gibco, Carlsbad, NY, USA) containing 10% fetal bovine serum (FBS, Gibco) and 1% penicillin–streptomycin (Gibco) and maintained at 37°C in a humidified atmosphere with 5% CO2. Cells at passage 3 were used for subsequent experiments. Cell morphology was observed under a light microscope (Olympus, Tokyo, Japan). HESCs were identified by immunofluorescence (IF) staining for vimentin and cytokeratin 7 (CK7) as well as flow cytometry using antibodies against CD29, CD73, CD45, and CD31 (all from Abcam, Shanghai, China).
2.2 Cell transfection
For knockdown assays, miR-429 inhibitor or its negative control NC inhibitor, short hairpin RNA targeting HIF1AN (sh-HIF1AN) or control sh-NC purchased from GenePharma (Shanghai, China) were transfected into HESCs using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). Cells were harvested for further analysis 48 h post-transfection.
2.3 Quantitative reverse transcription PCR (RT-qPCR)
Total RNA isolation from HESCs or endometriotic lesions was performed using TRIzol reagent (Invitrogen). RNA samples were reverse-transcribed using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) to produce cDNA. RT-qPCR was implemented using SYBR Green Master (Roche, Mannheim, Germany). Normalized to U6 and GAPDH, miR-429 and mRNA expression was quantified with the 2−ΔΔCt method. Primer sequences are shown in Table 1.
Primers used for RT-qPCR
Gene | Sequence (5′–3′) | |
---|---|---|
miR-429 | Forward | AGGTCT CTGAGGGTCAAGCA |
Reverse | CTGGTTGAAAAGCATGAGCA | |
TOB1 | Forward | TGCTACCTGAACAAGATCAC |
Reverse | ACTTGGATTTCAAGCTGCA | |
RTN4 | Forward | CCATTCAGGGCATATCTGGA |
Reverse | ATGACCAAGAGCAGAATTACTG | |
DNAJB9 | Forward | CATGAAGTACCACCCTGAC |
Reverse | GAGTGTTTCATATGCTTCTGC | |
HYOU1 | Forward | AGTGCCCATGGAAATTGTC |
Reverse | CTTAATCGCCATGCTTGCT | |
XIAP | Forward | GGAGGGCTAACTGATTGGA |
Reverse | TAACAGATATTTGCACCCTGGA | |
HIF1AN | Forward | TTAAGCCGAGGTCCAACAG |
Reverse | TGCTGCAGATACAACCTCTC | |
SYNJ1 | Forward | GCCTCATAGTGGAAACTAGG |
Reverse | TTTCTGCAGATGAGAGCAC | |
U6 | Forward | ATACAGAGAAAGTTAGCACGG |
Reverse | GGAATGCTTCAAAGAGTTGTG | |
GAPDH | Forward | TCAAGATCATCAGCAATGCC |
Reverse | CGATACCAAAGTTGTCATGGA |
2.4 Cell counting kit-8 (CCK-8) assay
Transfected HESCs (1 × 105 cells/well) were inoculated into 96-well plates for 24, 48, and 72 h. Afterward, 10 μL of CCK-8 solution was added to each well (Solarbio, Beijing, China) and incubated for another 2 h. The 450 nm absorbance was examined using a microplate reader (Thermo Scientific, Waltham, MA, USA).
2.5 EdU assay
Transfected HESCs in 96-well plates were incubated with EdU (5-ethynyl-2′-deoxyuridine) solution (50 μM; Beyotime, Shanghai, China) for 2 h. After fixing with 4% paraformaldehyde, cells were stained with Apollo solution and DAPI solution (4',6-diamidino-2-phenylindole; Solarbio) for 30 min. The stained cells were observed under a fluorescence microscope (Olympus).
2.6 Scratch assay
Transfected HESCs were plated in six-well plates and then the confluent monolayer cells were scratched using a 10 μL Eppendorf tip. The plates were washed twice with phosphate buffer saline for removing exfoliated cells. After 24 h, wound closure was examined using a microscope (Olympus) and analyzed with ImageJ software (NIH, Bethesda, MD, USA).
2.7 Transwell assay
HESCs in serum-free medium were placed into the upper Matrigel-covered Transwell chamber (24 wells, 8 μm pore size, Corning, NY, USA), with medium containing 10% FBS added to the lower chamber. After culturing for 24 h, the invaded cells in the lower chamber were fixed with 10% formaldehyde, dyed with 0.1% crystal violet, and counted under an inverted microscope (Olympus).
2.8 Western blotting
Protein extraction from HESCs or endometriotic lesions was carried out using RIPA lysis buffer (Solarbio), and a bicinchoninic acid assay kit (Solarbio) was utilized for measuring the protein concentration. Protein samples (20 μg) were dissolved with 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, blotted onto polyvinylidene fluoride membranes (Beyotime), and blocked with 5% defatted milk. Next, the membranes were incubated overnight with anti-HIF1AN (ab92498, 1:5,000), anti-HIF1A (ab179483, 1:1,000), anti-VEGF (ab214424, 1:1,000), and anti-GAPDH (ab22555, 1:1,000) primary antibodies (all from Abcam) at 4℃, and then incubated at room temperature with the secondary antibody (ab6721, 1:2,000, Abcam) for 2 h. Protein bands were visualized with the enhanced chemiluminescence detection kit (Solarbio) and quantified with ImageJ software (NIH).
2.9 Luciferase reporter assay
The ENCORI database shows the putative binding site between miR-429 and HIF1AN. HIF1AN wild type (Wt) or mutant (Mut) 3′-UTR sequence containing miR-429 binding site was subcloned into pmirGLO vector (Promega, Madison, WI, USA). HESCs were co-transfected with these vectors and miR-429 or NC inhibitor using Lipofectamine 3000 (Invitrogen). A dual luciferase reporter assay system (Promega) was utilized for luciferase activity measurement 48 h post-transfection.
2.10 Mice
Female BALB/c nude mice (6 and 7 weeks, 18–22 g) were purchased from Cavens Laboratory Animal Co., Ltd (Changzhou, China) and housed in a specific pathogen-free environment (temperature, 23 ± 2℃, humidity, 50–60%, 12 h light/dark cycle) with free access to food and water. The mice were allowed to acclimatize for 1 week before experiments. All animal experiments were conducted following the NIH Guidelines for the Care and Use of Laboratory Animals and approved by the Ethics Committee of Wuhan Myhalic Biotechnology Co., Ltd (202211005).
2.11 Mouse EM model
The mouse EM model was established by endometrial auto-transplantation according to previous description [21]. Briefly, all mice were anesthetized by intraperitoneal injection of 1% pentobarbital sodium (40 mg/kg). Then, a small midline incision was made on the abdomen, and the left uterine horn was excised and immediately placed in a physiological saline solution. The endometrium was carefully separated from muscles and cut into two segments (5 mm × 5 mm). A subcutaneous pocket was created on each side of the abdominal wall and the uterine segments were placed in the spaces with the endometrium facing the abdominal muscle. Then, the abdominal incision was sutured. One day after the surgery, the mice were randomly divided into two groups (n = 6/group). The mice were injected intraperitoneally with 90 μg of NC inhibitor or miR-429 inhibitor and 20 μL of in vivo‐jet PEI delivery reagent (Polyplus Transfection, Illkirch, France) in 5% glucose every 2 days, respectively. After 2 weeks, the mice were euthanized under anesthesia, and endometriotic lesions were collected for subsequent experiments. All results were assessed by two investigators blinded to the group treatments.
2.12 Measurement of estradiol levels
The level of estrogen estradiol in the homogenates of endometriotic lesions was estimated using an enzyme-linked immunosorbent assay (ELISA) kit (Beyotime) following the manufacturer’s instructions.
2.13 Statistical analysis
All experiments were repeated at least three times. Data are presented as mean ± standard deviation. Student’s t-test or one-way ANOVA was carried out for evaluating statistical differences among groups using SPSS 25.0 software (IBM, Armonk, MA, USA). p < 0.05 was defined as statistically significant.
3 Results
3.1 Identification of HESCs
As shown in Figure 1a, HESCs exhibited a fibroblast-like morphology. IF staining displayed positive staining of vimentin, a stromal cytoskeletal marker, and negative staining of CK7, an epithelial marker (Figure 1b and c). Additionally, HESCs were positive (≥95%) for the mesenchymal cell markers CD29 and CD73 and negative (<5%) for the hematopoietic cell markers CD45 and CD31, as indicated by flow cytometry (Figure 1d). The above results confirmed the stromal cell characteristics of HESCs.

Identification of HESCs. (a) Morphology of HESCs under a light microscope. (b) and (c) Representative images of IF staining for examining vimentin (b) and CK7 (c) expression in HESCs. (d) Flow cytometry for detecting cell surface markers of HESCs.
3.2 miR-429 effect on the HESC growth
To identify the effect of miR-429 on the phenotypes of HESCs, we knocked down miR-429 in HESCs. Notably, miR-429 expression was reduced in miR-429 inhibitor-treated HESCs compared to that in NC inhibitor-treated HESCs, confirming the successful transfection of miR-429 inhibitor (Figure 2a). The growth of HESCs was examined with CCK-8 and EdU assays. As displayed by the results, the proliferative capability of HESCs was markedly repressed after inhibiting miR-429 (Figure 2b–d).

Knocking down miR-429 represses HESC growth. HESCs were transfected with miR-429 or NC inhibitor. (a) RT-qPCR for analyzing miR-429 knockdown efficiency. (b) CCK-8 assay for determining HESC viability. (c) and (d) EdU assay for evaluating HESC proliferation. **p < 0.01.
3.3 Effect of miR-429 on HESC migration and invasiveness
The effect of miR-429 on HESC migration and invasiveness was also investigated. The scratch assay revealed that miR-429 depletion prominently restrained the migratory ability of HESCs (Figure 3a and b). In parallel, HESC invasiveness was significantly impeded by miR-429 inhibitor, as suggested by Transwell assay (Figure 3c and d). Collectively, inhibiting miR-429 restrained HESC migration and invasiveness.

Inhibiting miR-429 restrains HESC migration and invasiveness. (a) and (b) The scratch assay for examining HESC migratory capability. (c) and (d) Transwell assay for detecting HESC invasiveness. ***p < 0.001.
3.4 miR-429 targets HIF1AN in HESCs
To explore the potential molecular mechanism of miR-429 in HESCs, we explored its downstream genes utilizing the ENCORI database. With the screening condition of the number of supported AGO CLIP-seq experiments (AgoExpNum) > 35, seven candidate genes were screened out. RT-qPCR analysis demonstrated that among the seven genes, only HIF1AN was significantly upregulated in miR-429-inhibited HESCs (Figure 4a). Hence, HIF1AN was selected for further analysis. Suppression of miR-429 markedly upregulated HIF1AN protein expression in HESCs, as indicated by western blotting (Figure 4b and c). The ENCORI database predicts the binding site of miR-429 on HIF1AN (Figure 4d). We then mutated the predicted binding site on HIF1AN and performed the luciferase reporter assay. Notably, the luciferase activity of HIF1AN 3′-UTR was markedly elevated in miR-429-depleted HESCs but was almost unchanged after mutation (Figure 4e), confirming the interaction between HIF1AN and miR-429.

miR-429 targets HIF1AN in HESCs. (a) RT-qPCR for evaluating mRNA levels of miR-429 candidate targets. (b) and (c) Western blotting of HIIF1AN protein expression in miR-429-silenced HESCs. (d) The predicted binding site of miR-429 on HIF1AN by ENCORI. (e) Luciferase reporter assay for elucidating the interaction between miR-429 and HIF1AN in HESCs. **p < 0.01.
3.5 miR-429/HIF1AN axis regulates the HIF1A/VEGF signaling pathway
As displayed in Figure 5a–c, HIF1AN mRNA and protein expression levels were prominently reduced in HESCs with transfection of sh-HIF1AN. Then, we explored the effect of the miR-429/HIF1AN axis on the HIF1A/VEGF signaling pathway using western blotting. Notably, miR-429 inhibition induced the downregulation of HIF1A and VEGF in HESCs, whereas these effects were counteracted by HIF1AN silencing (Figure 5d–f), indicating that the miR-429/HIF1AN axis might contribute to HIF1A/VEGF signaling.

The miR-429/HIF1AN axis regulates the HIF1A/VEGF signaling pathway. (a)–(c) RT-qPCR and western blotting for determining HIF1AN silencing efficiency. (d)–(f) Western blotting for measuring HIF1A and VEGF protein expression in HESCs with indicated treatments. **p < 0.01 and ***p < 0.001.
3.6 Effect of miR-429 on EM progression in vivo
To further verify the effect of miR-429 on EM progression, a mouse EM model was established by endometrial auto-transplantation. The endometriotic lesions were collected from the two groups. As shown by the results, the ectopic lesions in the miR-429 inhibitor-treated group were significantly smaller in size and lighter in weight as compared to those in the NC inhibitor-treated group (Figure 6a and b), indicating that inhibition of miR-429 impeded EM development in mice. Moreover, in comparison to mice treated with NC inhibitor, miR-429 expression was markedly downregulated while the HIF1AN expression level was increased in the endometriotic tissues of mice treated with miR-429 inhibitor (Figure 6c), confirming that miR-429 negatively regulated HIF1AN in EM mice. Consistent with the in vitro results, animal experiments displayed that depletion of miR-429 reduced HIF1A and VEGF protein levels in the endometriotic tissues of EM mice (Figure 6d and e). Additionally, we estimated whether miR-429 impacted the estradiol level in EM mice. The results showed that there was no significant difference in the estradiol level between the two groups (Figure 6f). These data demonstrated that inhibiting miR-429 could attenuate EM progression in the mouse model.

Inhibition of miR-429 impedes EM progression in vivo. Evaluation of the (a) size and (b) weight of EM lesions. (c) RT-qPCR analysis of miR-429 and HIF1AN expression in endometriotic tissues of EM mice. (d) and (e) Western blotting for assessing HIF1A and VEGF protein levels in endometriotic tissues of EM mice. (f) Assessment of estradiol levels in mouse endometriotic tissues by ELISA. n = 6 mice per group. **p < 0.01.
4 Discussion
EM is an estrogen-dependent disorder that is similar to malignant tumors in biological behaviors, such as excessive proliferation, metastasis, and recurrence [22]. Despite decades of research into the pathogenesis of EM, the exact etiology of this disease is still incompletely understood [23]. Growing evidence has illustrated that non-coding RNAs, including miRNAs, act as critical regulators in the onset and progression of EM [24]. Many studies have illustrated that miR-429 participates in multiple biological processes and modulates disease progression. For instance, downregulated miR-429 in plasma exosomes mediates the PTEN/PI3K/Akt signaling pathway to suppress neuronal apoptosis after spinal cord injury [25]. Nguyen et al. proposed that miR-429 interacts with CFL2 and induces its downregulation, thus impairing myoblast differentiation [26]. Overexpressed miR-429 impedes glioblastoma cell growth and migration and promotes cell apoptosis by downregulating EGFR, BCL2, and MYC, which are several oncogenes of the ERBB pathway [27]. Importantly, it has been proposed that miR-429 expression is elevated in tissues of EM patients, and overexpressing miR-429 can reverse berberine-triggered suppression of the invasive phenotypes of HESCs [14]. Nonetheless, the underlying molecular mechanisms of miR-429 in regulating HESC phenotypes are unclarified. Consistent with the aforementioned evidence, our results revealed that the depletion of miR-429 prominently restrained the proliferation, invasiveness, and migration of HESCs. In vivo experiments further demonstrated that inhibiting miR-429 ameliorated ectopic lesion development in EM mice, indicating that miR-429 might exert a promoting effect on EM progression. Additionally, we found that inhibiting miR-429 expression did not significantly affect the estradiol level in the endometriotic tissues of mice, suggesting that miR-429 might affect EM progression not by directly regulating estrogen levels but by influencing invasive phenotypes of ESCs.
Mounting evidence has documented that miRNAs can interact with the 3′-UTRs of downstream targets via base pairing, thereby inducing reduced gene/protein expression [28]. As mentioned above, miR-429 participates in regulating the development of multiple human disorders by modulating downstream targets. Herein, we explored miR-429 target genes in HESCs using bioinformatics analysis and confirmatory experiments. As a result, HIF1AN was verified to be a target of miR-425. Multiple studies have illuminated the critical roles of HIF1AN in various pathophysiological events. Zhang et al. indicated that miR-212 facilitates renal interstitial fibrosis by repressing HIF1AN expression [29]. Upregulated HIF1AN exhibits a suppressive effect on osteoblast differentiation and calcification [15]. Knocking down HIF1AN enhances the proliferative and migratory potentials of human keloid fibroblasts [30]. However, whether it is implicated in EM has not been investigated. This study revealed that HIF1AN was upregulated in miR-429-depleted HESCs and endometriotic tissues of mice.
Moreover, previous reports have suggested that HIF1AN negatively regulates the HIF1A/VEGF signaling pathway and both HIF1A and VEGF have been indicated to be upregulated in EM patients [20,31]. HIFIA enhances the invasion and migration of HESCs by activating autophagy in EM [17]. These results indicate the significant role of HIF1AN in EM. Our results depicted that inhibiting miR-429 downregulated HIF1A and VEGF protein expression in HESCs and knocking down HIF1AN could offset this effect, suggesting that the miR-429/HIF1AN axis might promote the HIF1A/VEGF pathway in HESCs, thereby contributing to EM development.
In conclusion, we explored the miR-429 molecular mechanism in EM. Our results suggest that miR-429 facilitates HESC proliferation, migration, and invasiveness in EM by modulating the HIF1AN-mediated HIF1A/VEGF signaling pathway. These findings might deepen the understanding of the mechanism underlying EM pathogenesis. Additionally, further investigations are needed to clarify the role of the miR-429/HIF1AN axis in EM in the future.
Acknowledgements
Not applicable.
-
Funding information: This work was supported by the Maternal and Child Health Hospital of Hubei Province Research Project (grant number: 2021SFY14014).
-
Author contributions: Rong Zheng conceived and designed the experiments. Rong Zheng, Yulan Liu, Yan Lei, and Yan Yue carried out the experiments. Rong Zheng and Yan Yue analyzed the data. Rong Zheng and Yan Yue drafted the manuscript. All authors agreed to be accountable for all aspects of the work. All authors have read and approved the final manuscript.
-
Conflict of interest: The authors have no competing interests.
-
Data availability statement: The dataset used or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Dai Y, Li X, Shi J, Leng J. A review of the risk factors, genetics and treatment of endometriosis in Chinese women: a comparative update. Reprod Health. 2018;15(1):82.10.1186/s12978-018-0506-7Search in Google Scholar PubMed PubMed Central
[2] Koninckx PR, Fernandes R, Ussia A, Schindler L, Wattiez A, Al-Suwaidi S, et al. Pathogenesis based diagnosis and treatment of endometriosis. Front Endocrinol (Lausanne). 2021;12:745548.10.3389/fendo.2021.745548Search in Google Scholar PubMed PubMed Central
[3] Chapron C, Marcellin L, Borghese B, Santulli P. Rethinking mechanisms, diagnosis and management of endometriosis. Nat Rev Endocrinol. 2019;15(11):666–82.10.1038/s41574-019-0245-zSearch in Google Scholar PubMed
[4] Kajiyama H, Suzuki S, Yoshihara M, Tamauchi S, Yoshikawa N, Niimi K, et al. Endometriosis and cancer. Free Radic Biol Med. 2019;133:186–92.10.1016/j.freeradbiomed.2018.12.015Search in Google Scholar PubMed
[5] Pang C, Wu Z, Xu X, Yang W, Wang X, Qi Y. Paeonol alleviates migration and invasion of endometrial stromal cells by reducing HIF-1α-regulated autophagy in endometriosis. Front Biosci (Landmark Ed). 2021;26(9):485–95.10.52586/4961Search in Google Scholar PubMed
[6] Cui L, Chen S, Wang D, Yang Q. LINC01116 promotes proliferation and migration of endometrial stromal cells by targeting FOXP1 via sponging miR-9-5p in endometriosis. J Cell Mol Med. 2021;25(4):2000–12.10.1111/jcmm.16039Search in Google Scholar PubMed PubMed Central
[7] Hammond SM. An overview of microRNAs. Adv Drug Deliv Rev. 2015;87:3–14.10.1016/j.addr.2015.05.001Search in Google Scholar PubMed PubMed Central
[8] Ghasemi F, Alemzadeh E, Allahqoli L, Alemzadeh E, Mazidimoradi A, Salehiniya H, et al. MicroRNAs dysregulation as potential biomarkers for early diagnosis of endometriosis. Biomedicines. 2022;10(10):2588.10.3390/biomedicines10102558Search in Google Scholar PubMed PubMed Central
[9] Simonson B, Das S. MicroRNA therapeutics: the Next Magic Bullet? Mini Rev Med Chem. 2015;15(6):467–74.10.2174/1389557515666150324123208Search in Google Scholar PubMed PubMed Central
[10] Ho PTB, Clark IM, Le LTT. MicroRNA-based diagnosis and therapy. Int J Mol Sci. 2022;23(13):7167.10.3390/ijms23137167Search in Google Scholar PubMed PubMed Central
[11] Dan W, En Jing Z, Juan J, Yi Y, Yi Ling J. Rhein inhibits endometriosis by targeting microRNA-135. Acta Biochim Pol. 2022;69(3):593–7.10.18388/abp.2020_5935Search in Google Scholar PubMed
[12] Kai K, Joshi NR, Burns GW, Hrbek SM, Vegter EL, Ochoa-Bernal MA, et al. MicroRNA-210-3p regulates endometriotic lesion development by targeting IGFBP3 in baboons and women with endometriosis. Reprod Sci. 2023.10.1007/s43032-023-01253-5Search in Google Scholar PubMed PubMed Central
[13] Braicu OL, Budisan L, Buiga R, Jurj A, Achimas-Cadariu P, Pop LA, et al. miRNA expression profiling in formalin-fixed paraffin-embedded endometriosis and ovarian cancer samples. Onco Targets Ther. 2017;10:4225–38.10.2147/OTT.S137107Search in Google Scholar PubMed PubMed Central
[14] Gu Y, Zhou Z. Berberine inhibits the proliferation, invasion and migration of endometrial stromal cells by downregulating miR‑429. Mol Med Rep. 2021;23(6):416.10.3892/mmr.2021.12055Search in Google Scholar PubMed PubMed Central
[15] Zhou L, Qiu M, Yang L, Yang L, Zhang Y, Mu S, et al. MicroRNA-1-3p enhances osteoblast differentiation of MC3T3-E1 cells by interacting with hypoxia-inducible factor 1 α inhibitor (HIF1AN). Mech Dev. 2020;162:103613.10.1016/j.mod.2020.103613Search in Google Scholar PubMed
[16] Yin N, Zhu L, Ding L, Yuan J, Du L, Pan M, et al. MiR-135-5p promotes osteoblast differentiation by targeting HIF1AN in MC3T3-E1 cells. Cell Mol Biol Lett. 2019;24:51.10.1186/s11658-019-0177-6Search in Google Scholar PubMed PubMed Central
[17] Liu H, Zhang Z, Xiong W, Zhang L, Xiong Y, Li N, et al. Hypoxia-inducible factor-1α promotes endometrial stromal cells migration and invasion by upregulating autophagy in endometriosis. Reproduction. 2017;153(6):809–20.10.1530/REP-16-0643Search in Google Scholar PubMed PubMed Central
[18] Peng WX, He PX, Liu LJ, Zhu T, Zhong YQ, Xiang L, et al. LncRNA GAS5 activates the HIF1A/VEGF pathway by binding to TAF15 to promote wound healing in diabetic foot ulcers. Lab Invest. 2021;101(8):1071–83.10.1038/s41374-021-00598-2Search in Google Scholar PubMed
[19] Liu H, Sun X, Zhao Y, Xia M, Wang C. Anti-angiogenesis effect and mechanism study of Huangzhi Neiyi capsule in a rat endometriosis model. J Int Med Res. 2020;48(1):300060519899767.10.1177/0300060519899767Search in Google Scholar PubMed PubMed Central
[20] Ye K, Li L, Wu B, Wang D. METTL3 m6A-dependently promotes miR-21-5p maturation to accelerate choriocarcinoma progression via the HIF1AN-induced inactivation of the HIF1A/VEGF pathway. Genes Genomics. 2022;44(11):1311–22.10.1007/s13258-022-01309-xSearch in Google Scholar PubMed
[21] Liu T, Liu M, Zheng C, Zhang D, Li M, Zhang L. Exosomal lncRNA CHL1-AS1 derived from peritoneal macrophages promotes the progression of endometriosis via the miR-610/MDM2 Axis. Int J Nanomed. 2021;16:5451–64.10.2147/IJN.S323671Search in Google Scholar PubMed PubMed Central
[22] Chen Q, Hang Y, Zhang T, Tan L, Li S, Jin Y. USP10 promotes proliferation and migration and inhibits apoptosis of endometrial stromal cells in endometriosis through activating the Raf-1/MEK/ERK pathway. Am J Physiol Cell Physiol. 2018;315(6):C863–72.10.1152/ajpcell.00272.2018Search in Google Scholar PubMed
[23] Czyzyk A, Podfigurna A, Szeliga A, Meczekalski B. Update on endometriosis pathogenesis. Minerva Ginecol. 2017;69(5):447–61.10.23736/S0026-4784.17.04048-5Search in Google Scholar PubMed
[24] Azam INA, Wahab NA, Mokhtar MH, Shafiee MN, Mokhtar NM. Roles of microRNAs in Regulating Apoptosis in the Pathogenesis of Endometriosis. Life (Basel). 2022;12(9):1321.10.3390/life12091321Search in Google Scholar PubMed PubMed Central
[25] Huang J, Wu C, Xu G, Sun Y, Gui C, Fu J, et al. The decreased expression of miR-429 in plasma exosomes after spinal cord injury inhibits neuronal apoptosis by mediating the PTEN/PI3K/Akt pathway. Ann Transl Med. 2022;10(1):6.10.21037/atm-21-5561Search in Google Scholar PubMed PubMed Central
[26] Nguyen MT, Min KH, Lee W. Palmitic acid-induced miR-429-3p impairs myoblast differentiation by downregulating CFL2. Int J Mol Sci. 2021;22(20):10972.10.3390/ijms222010972Search in Google Scholar PubMed PubMed Central
[27] Gheidari F, Arefian E, Saadatpour F, Kabiri M, Seyedjafari E, Teimoori-Toolabi L, et al. The miR-429 suppresses proliferation and migration in glioblastoma cells and induces cell-cycle arrest and apoptosis via modulating several target genes of ERBB signaling pathway. Mol Biol Rep. 2022;49(12):11855–66.10.1007/s11033-022-07903-2Search in Google Scholar PubMed
[28] Aass KR, Nedal TMV, Tryggestad SS, Haukås E, Slørdahl TS, Waage A, et al. Paired miRNA- and messenger RNA-sequencing identifies novel miRNA-mRNA interactions in multiple myeloma. Sci Rep. 2022;12(1):12147.10.1038/s41598-022-16448-0Search in Google Scholar PubMed PubMed Central
[29] Zhang Y, Zhang GX, Che LS, Shi SH, Li YT. miR‑212 promotes renal interstitial fibrosis by inhibiting hypoxia‑inducible factor 1‑α inhibitor. Mol Med Rep. 2021;23(3):189.10.3892/mmr.2021.11828Search in Google Scholar PubMed PubMed Central
[30] Yuan X, Chen B, Wang X. CircSLC8A1 targets miR-181a-5p/HIF1AN pathway to inhibit the growth, migration and extracellular matrix deposition of human keloid fibroblasts. Burns. 2023;49(3):622–32.10.1016/j.burns.2022.04.009Search in Google Scholar PubMed
[31] Zhang F, Liu XL, Wang W, Dong HL, Xia YF, Ruan LP, et al. Expression of MMIF, HIF-1α and VEGF in serum and endometrial tissues of patients with endometriosis. Curr Med Sci. 2018;38(3):499–504.10.1007/s11596-018-1906-1Search in Google Scholar PubMed
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer