Home UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
Article Open Access

UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling

  • Ping Zhang EMAIL logo , Huiping Guo , Fang Zhao , Ke Jia , Fei Yang and Xiaoli Liu
Published/Copyright: February 24, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Emerging evidence has demonstrated that ubiquitin conjugating enzyme E2 J1 (UBE2J1) exerts pivotal function in many cancers. UBE2J1 was reported to be dysregulated in endometrial cancer (EC). This study was designed to further investigate the regulatory character and mechanism of UBE2J1 in EC. Bioinformatic tools and databases were used to analyze gene expression pattern and gene expression correlation in EC tissues, and the prognosis of EC patients. Gene expression was evaluated by reverse-transcription quantitative polymerase chain reaction. Western blot was used for protein level detection. In vitro cell apoptosis was detected by flow cytometry analyses and TUNEL assays. In vivo cell apoptosis was evaluated by detecting Bax and Bcl-2 expression in tumor tissues via immunohistochemical and western blot analyses. In this study, UBE2J1 knockdown promoted cell apoptosis in EC cells and in mouse models of EC. PI3K and AKT expression is positively correlated with UBE2J1 level and is related to poor prognosis of EC patients. UBE2J1 knockdown repressed the PI3K/AKT pathway both in vitro and in vivo. UBE2J1 downregulation decreased MDM2 expression, but increased p53 expression. MDM2 overexpression reverses the promotion of UBE2J1 knockdown on cell apoptosis in EC. Overall, UBE2J1 knockdown induces cell apoptosis in EC by inactivating the PI3K/AKT signaling and suppressing the MDM2/p53 signaling.

Keywords: cell apoptosis; endometrial cancer; MDM2/p53 pathway; PI3K/AKT pathway; UBE2J1

1 Introduction

Endometrial cancer (EC) is one prevalent malignant tumor of the reproductive system for females in the world, and its incidence is increasing fast in recent years [1]. The potential causes of such increase in global incidence are the epidemic of obesity and the resulting hyperinsulinemia [2–4]. Studies have shown that the majority of patients with EC have promising therapeutic results after standard therapies, and the development of novel drugs for the treatment of advanced EC is encouraging [5,6]. However, the diagnosis and prognosis of advanced-staged EC patients are still poor. Therefore, revealing the mechanisms of EC to develop targeted therapies are vital for improving endometrial outcome.

Ubiquitin conjugating enzyme E2 J1 (UBE2J1) has been reported to exert biological functions on several cancers. For example, UBE2J1 is suggested to be aberrantly expressed in prostatic cancer and its upregulation is closely related to unfavorable prognosis of patients [7]. In addition, the ectopic expression of UBE2J1 in hepatocellular carcinoma (HCC) was reported to induce poor survival in patients with HCC [8]. Importantly, it has been reported that UBE2J1 overexpression promotes EC cell growth, adhesion, invasion, migration as well as epithelial–mesenchymal transition (EMT) through modulating the PI3K/AKT pathway [9]. Our study further explored the biological effects of UBE2J1 on apoptosis of EC cells.

Emerging evidence has revealed that the PI3K/AKT signaling is implicated in the regulatory process of many cancers. For example, activating the PI3K/AKT pathway was suggested to facilitate of ovarian cancer onset and progression [10]. The PI3K/AKT signaling is activated by the interaction between MALAT1 and miR-26a to enhance the malignant phenotypes of colorectal cancer [11]. Additionally, PI3K/AKT signaling has been validated to be implicated in the regulation of EC progression [9].

MDM2/p53 pathway was also suggested to play a pivotal role in the progression of many cancers. MDM2 was found to be abnormally expressed in the p53 pathway in colorectal cancer, which is putatively associated with cell motions and tumor progression [12]. HAX1 reinforces the malignancy of non-small cell lung cancer by the MDM2/p53 pathway [13]. miR-219a-2-3p restrains pituitary adenoma cell proliferation and facilitates cell apoptosis via interacting with the MDM2/p53 pathway [14]. However, only a few reports refer to the role of MDM2/p53 in EC, and a more specific investigation is needed.

This study aimed to explore the role of UBE2J1 in EC cell apoptosis and the underlying mechanism. We hypothesized that UBE2J1 suppresses EC cell apoptosis via regulating the PI3K/AKT and MDM2/p53 pathways. This study may provide more favorable outcomes for the patients suffering from EC.

2 Materials and methods

2.1 Cell lines

Ishikawa and MFE-296 cells were bought from ATCC. Both cells were cultivated in the dulbecco’s modified eagle medium (Gibco, USA) containing 10% fetal bovine serum in a damp atmosphere with 5% CO2 at 37℃.

2.2 Cell transfection

To silence UBE2J1, Ishikawa and MFE-296 cells were transfected with short hairpin RNA (sh-RNA) targeting UBE2J1 (sh-UBE2J1) or the corresponding negative control sh-NC (GenePharma, Shanghai, China). To overexpress MDM2, Ishikawa and MFE-296 cells were transfected with pcDNA3.1/MDM2, with pcDNA3.1 as a negative control. The above-mentioned vectors were stably transfected into EC cells for 48 h using Lipofectamine 3000 (Invitrogen). The transfection efficiency was evaluated by reverse-transcription quantitative polymerase chain reaction (RT-qPCR) after 48 h.

2.3 RT-qPCR

Total RNA was extracted from EC cells using TRIzol reagent (Takara, Tokyo, Japan). Total RNA was reverse transcribed into first-strand cDNA using a cDNA Reverse Transcription Kit (Takara). A SYBR® Premix Ex TaqTM II reagent kit (Takara) was applied to perform RT-qPCR with an ABI7500 real-time qPCR system (ABI Company, Oyster Bay, NY, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the internal reference. The relative gene expression was analyzed applying the 2−ΔΔCt method [15]. Sequences of primers used for RT-qPCR are:

UBE2J1: Forward 5′−GTACATCGTACGGACTCCAG−3′,

Reverse 5′−TCATGGAGGTATTCTTAGCTACAG−3′,

GAPDH: Forward 5′−AGAAACGGCTACCACATCCA−3′,

Reverse 5′−CACCAGACTTGCCCTCCA−3′.

2.4 Western blot

Cell lysates were collected by radio immunoprecipitation assay buffer with protease inhibitors. Then, 20 μg of protein sample was separated with 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane (Sigma-Aldrich, St Louis, MO, USA). Next, the membrane was blocked with 5% skimmed milk powder, and then incubated overnight at 4°C with the primary antibodies: anti-Bcl2 (ab182858, 1:2,000; Abcam, Shanghai, China), anti-Bax (ab32503, 1:1,000; Abcam), anti-MDM2 (ab259265, 1:1,000; Abcam), anti-p53 (ab90363, 1:250; Abcam), anti-PI3K (ab191606, 1:1,000; Abcam), anti-p-PI3K (ab182651, 1:1,000; Abcam), anti-AKT (ab8805, 1:500; Abcam), anti-p-AKT (ab38449, 1:1,000; Abcam), and anti-GAPDH (ab9485, 1:2,500, Abcam). After being rinsed with phosphate buffer saline (PBS) thrice, the membrane was incubated with secondary antibody at 37℃ for 1 h. The protein bands were visualized using Imaging Analysis System (Odyssey Infrared, USA).

2.5 TUNEL assay

TUNEL assay was performed to monitor cell apoptosis using In Situ Cell Death Detection Kit (Roche, Basel, Switzerland). Biologic coloring agent of 4′,6-diamidino-2-phenylindole (Haoran Biotechnology, Shanghai, China) or Merge (Haoran Biotechnology) was used to dye Ishikawa and MFE-296 cells. An EVOS FL microscope (Thermo Fisher Scientific, Waltham, MA, USA) was used to count the positively stained cells.

2.6 Flow cytometry

Cell apoptosis was analyzed by flow cytometry. Cells were collected and rinsed with precooled PBS thrice. After being resuspended with 0.3 mL PBS and fixed with 0.7 mL absolute ethyl alcohol, the cells were stored at −20°C for 24 h and centrifuged at 1,000 rpm for 15 min. Next, the cells were washed with PBS twice after the fixation solution was wiped off. Cells were added with 120 μL RnaseA (200 μg/mL), and cultured at 37°C for 30 min. Next, the cells were stained with annexin V-FITC (BD Biosciences, San Jose, CA, USA) and propidium iodide staining solution (Beyotime). At last, cell apoptosis was evaluated with flow cytometry (BD Biosciences).

2.7 Tumor xenografts in nude mice

ShRNA targeting UBE2J1 (sh-UBE2J1) and NC shRNA (sh-NC) were synthesized by GenePharma. The sh-UBE2J1 sequences were 5′−GTGAAGAGTCCGGCTGTTA−3′ and 5′−TAACAGCCGGACTCTTCAC−3′. Sh-UBE2J1 and sh-NC were inserted into the pLKO.1 plasmid and then transfected into 293 T cells in parallel with psPAX2 packaging plasmid and pMD2.G envelope plasmid. The 293 T cells were cultured for 48 h at room temperature with 5% CO2, and the lentiviruses stably expressing sh-UBE2J1 or sh-NC were harvested and used to infect Ishikawa cells.

BALB/c mice (females, 4–6 weeks old) were bought from Vital River Laboratory Animal Technology Co., Ltd (Beijing, China) and housed under specific pathogen-free condition. Ishikawa cells (4 × 106) with stable sh-UBE2J1 or sh-NC transfection were subcutaneously injected into each mouse. At 28 days post-cell injection, the mice were euthanized by cervical dislocation, and the tumors were excised for further experiments. The animal experiments were approved by the Animal Ethics Committee of The First People’s Hospital of Zhangjiagang Affiliated to Suzhou University (Approved Number: 2021-012; Jiangsu, China).

2.8 Immunohistochemistry

Immunohistochemistry was used to detect the expression of UBE2J1, Bcl-2, and Bax in tumor tissues. Briefly, the sections were dewaxed with xylene and rehydrated and then incubated in 3% H2O2 at room temperature for 15 min to quench endogenous peroxidase activity. Sections were blocked with 5% bovine serum albumin at 37°C for 20 min and then incubated overnight at 4°C with the following primary antibodies: anti-UBE2J1 (1:150, #MA5-26025, Invitrogen), anti-Bax (1:100, #33-6600, Invitrogen), and anti-Bcl-2 (1:200, #MA5-15668, Invitrogen). After washing with PBS, the sections were incubated with a biotinylated secondary antibody (1:1,000, #31430, Invitrogen) for 30 min at room temperature. Tissue sections were then stained with diaminobenzidine, counterstained with hematoxylin, dehydrated, and mounted. The sections were analyzed using a microscope.

2.9 Statistical analysis

SPSS 22.0 (IBM Corporation, Armonk, NY, USA) and GraphPad prism 5.0 (GraphPad Software Inc., San Diego, CA, USA) were used to analyze the data. Experimental assays were conducted in triplicate and the data are expressed as mean ± standard deviation. Comparisons were made by student’s t-test or one-way analysis of variance followed by Tukey’s post hoc analysis. The value of p < 0.05 was of statistical significance. The detailed statistics are shown in Table A1.

3 Results

3.1 UBE2J1 knockdown promotes cell apoptosis in EC

To investigate the role of UBE2J1 in EC cell apoptosis, Ishikawa and MFE-296 cells were transfected with sh-UBE2J1. RT-qPCR showed that the expression of UBE2J1 in EC cells was significantly downregulated after sh-UBE2J1 transfection (Figure 1a). TUNEL assay demonstrated that the percent of TUNEL positive cells was remarkably elevated by UBE2J1 knockdown in Ishikawa and MFE-296 cells (Figure 1b and c). As shown by flow cytometry analysis, the apoptosis rates of EC cells were significantly raised after UBE2J1 knockdown (Figure 1d and e). Subsequently, western blot was conducted to detect the protein levels of cell apoptosis markers Bcl-2 and Bax. The protein level of Bax was markedly increased, while the protein level of Bcl-2 was decreased by UBE2J1 downregulation (Figure 1f). In conclusion, the downregulation of UBE2J1 facilitates EC cell apoptosis.

Figure 1 UBE2J1 knockdown promotes cell apoptosis in EC. Ishikawa and MFE-296 cells were transfected with sh-NC or sh-UBE2J1. (a) Expression of UBE2J1 in Ishikawa and MFE-296 cells was evaluated by RT-qPCR. (b and c) TUNEL assay and (d and e) flow cytometry analysis were adopted to measure cell apoptosis. (f) Protein levels of apoptosis markers, Bcl-2, and Bax, in EC cells were analyzed by western blot. Bar graphs were used to represent the data. ** p < 0.01, *** p < 0.001.
Figure 1

UBE2J1 knockdown promotes cell apoptosis in EC. Ishikawa and MFE-296 cells were transfected with sh-NC or sh-UBE2J1. (a) Expression of UBE2J1 in Ishikawa and MFE-296 cells was evaluated by RT-qPCR. (b and c) TUNEL assay and (d and e) flow cytometry analysis were adopted to measure cell apoptosis. (f) Protein levels of apoptosis markers, Bcl-2, and Bax, in EC cells were analyzed by western blot. Bar graphs were used to represent the data. ** p < 0.01, *** p < 0.001.

3.2 The expression of PI3K and AKT is positively correlated with UBE2J1 expression and is related to poor prognosis of patients with EC

The ENCORI website (http://starbase.sysu.edu.cn) and Kaplan–Meier plotter website (http://www.kmplot.com/) show that high PIK3CA (PI3K) expression is associated with adverse prognosis of patients with Uterine Corpus Endometrial Carcinoma (UCEC) (Figure 2a and b). In addition, GEPIA database (http://gepia.cancer-pku.cn) displays that the expression of PIK3CA is positively correlated with that of UBE2J1 in UCEC tissues (Figure 2c). Moreover, the ENCORI website and Kaplan–Meier plotter website show that high expression levels of AKT2 have close association with the poor overall survival and unfavorable prognosis in patients with UCEC (Figure 2d and e). Furthermore, the GEPIA database displays a positive correlation between UBE2J1 expression level and AKT2 expression level in UCEC tissues (Figure 2f). These results demonstrate that the upregulation of PI3K and AKT is closely related to poor prognosis of patients with EC, and UBE2J1 expression has a positive correlation with PI3K and AKT expression.

Figure 2 Expression of PI3K and AKT is positively correlated with UBE2J1 expression and is associated with poor prognosis of patients with EC. (a and b) ENCORI (http://starbase.sysu.edu.cn) and Kaplan–Meier plotter websites (http://www.kmplot.com/) show the overall survival time of UCEC patients with high or low PIK3CA expression. (c) GEPIA database (http://gepia.cancer-pku.cn) shows the correlation between UBE2J1 expression and PIK3CA expression in UCEC tissues. (d and e) ENCORI and Kaplan–Meier plotter websites show the overall survival time of UCEC patients with high or low AKT2 expression. (f) GEPIA website shows the relationship between UBE2J1 expression and AKT2 expression in UCEC tissues.
Figure 2

Expression of PI3K and AKT is positively correlated with UBE2J1 expression and is associated with poor prognosis of patients with EC. (a and b) ENCORI (http://starbase.sysu.edu.cn) and Kaplan–Meier plotter websites (http://www.kmplot.com/) show the overall survival time of UCEC patients with high or low PIK3CA expression. (c) GEPIA database (http://gepia.cancer-pku.cn) shows the correlation between UBE2J1 expression and PIK3CA expression in UCEC tissues. (d and e) ENCORI and Kaplan–Meier plotter websites show the overall survival time of UCEC patients with high or low AKT2 expression. (f) GEPIA website shows the relationship between UBE2J1 expression and AKT2 expression in UCEC tissues.

3.3 UBE2J1 downregulation inhibits the PI3K/AKT signaling pathway in EC cells

Next, we evaluated the effects of UBE2J1 knockdown on the expression of key molecules involved in the PI3K/AKT signaling pathway in EC cells. The results of western blot showed that UBE2J1 knockdown decreased the protein levels of p-PI3K and p-AKT in EC cells (Figure 3). Therefore, UBE2J1 knockdown inactivates the PI3K/AKT signaling pathway in EC cells.

Figure 3 UBE2J1 downregulation inhibits the PI3K/AKT signaling pathway. Western blot analyses were used to detect the protein levels of key molecules involved in the PI3K/AKT signaling pathway in EC cells after downregulating UBE2J1. Bar graphs were used to represent the data. *** p < 0.001.
Figure 3

UBE2J1 downregulation inhibits the PI3K/AKT signaling pathway. Western blot analyses were used to detect the protein levels of key molecules involved in the PI3K/AKT signaling pathway in EC cells after downregulating UBE2J1. Bar graphs were used to represent the data. *** p < 0.001.

3.4 UBE2J1 knockdown reduces MDM2 expression and facilitates the p53 signaling pathway in EC cells

As shown by the ENCORI website, MDM2 expression is markedly upregulated in 548 UCEC tissue samples versus 35 in normal tissue samples (Figure 4a). Notably, the ENCORI website shows that MDM2 expression is positively correlated with UBE2J1 expression in UCEC tissue samples, indicating that UBE2J1 may influence UCEC development by modulating the expression of MDM2 (Figure 4b). Further, western blot was used to investigate the influence of UBE2J1 knockdown on MDM2 and p53 expression, which revealed that MDM2 protein levels in Ishikawa and MFE-296 cell lines were significantly decreased by UBE2J1 downregulation, while p53 protein levels were increased (Figure 4c and d). The results above indicate that UBE2J1 knockdown promotes the p53 signaling by inhibiting MDM2 expression in EC cells.

Figure 4 UBE2J1 positively modulates the expression of MDM2. (a) MDM2 expression in 548 EC tissues and 35 normal samples is shown on ENCORI website. (b) ENCORI website shows the correlation between MDM2 expression and UBE2J1 expression. (c and d) Western blot analyses were conducted to measure the protein levels of MDM2 and p53 in EC cells transfected with sh-UBE2J1. Bar graphs were used to represent the data. *** p < 0.001.
Figure 4

UBE2J1 positively modulates the expression of MDM2. (a) MDM2 expression in 548 EC tissues and 35 normal samples is shown on ENCORI website. (b) ENCORI website shows the correlation between MDM2 expression and UBE2J1 expression. (c and d) Western blot analyses were conducted to measure the protein levels of MDM2 and p53 in EC cells transfected with sh-UBE2J1. Bar graphs were used to represent the data. *** p < 0.001.

3.5 MDM2 overexpression reverses the promotive effect of UBE2J1 knockdown on cell apoptosis in EC

To explore the function of MDM2 in modulating EC development, Ishikawa cells were transfected with pcDNA3.1/MDM2. Western blot illustrated that MDM2 expression in Ishikawa cells was markedly increased after overexpressing MDM2 (Figure 5a). Subsequently, TUNEL assay showed that UBE2J1 downregulation increased the percent of TUNEL positive cells, but the promotive effect of UBE2J1 knockdown on cell apoptosis was reversed by MDM2 overexpression (Figure 5b and c). Additionally, flow cytometry analysis showed that the promoting effect of sh-UBE2J1 on the apoptosis rate of Ishikawa cells was reversed by MDM2 upregulation (Figure 5d and e). Moreover, the suppression of UBE2J1 knockdown on Bcl-2 protein level was rescued by MDM2 overexpression, and the promotion of UBE2J1 knockdown on Bax protein level was also neutralized by MDM2 overexpression (Figure 5f). In summary, these results demonstrate that MDM2 upregulation reverses the enhanced cell apoptosis caused by UBE2J1 downregulation.

Figure 5 MDM2 overexpression reverses cell apoptosis mediated by UBE2J1 downregulation. (a) Overexpression efficiency of pcDNA3.1/MDM2 in Ishikawa cells was assessed by western blot. (b and c) TUNEL assay and (d and e) flow cytometry analysis were conducted to evaluate the apoptosis of Ishikawa cells transfected with sh-NC, sh-UBE2J1, and sh-UBE2J1 + pcDNA3.1/MDM2. (f) Protein levels of Bcl-2, Bax, and TP53 in Ishikawa cells with the above transfection were analyzed by western blot. Bar graphs were used to represent the data. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 5

MDM2 overexpression reverses cell apoptosis mediated by UBE2J1 downregulation. (a) Overexpression efficiency of pcDNA3.1/MDM2 in Ishikawa cells was assessed by western blot. (b and c) TUNEL assay and (d and e) flow cytometry analysis were conducted to evaluate the apoptosis of Ishikawa cells transfected with sh-NC, sh-UBE2J1, and sh-UBE2J1 + pcDNA3.1/MDM2. (f) Protein levels of Bcl-2, Bax, and TP53 in Ishikawa cells with the above transfection were analyzed by western blot. Bar graphs were used to represent the data. * p < 0.05, ** p < 0.01, *** p < 0.001.

3.6 Knockdown of UBE2J1 induces cell apoptosis in the mouse model of EC

Given that UBE2J1 knockdown significantly facilitated EC cell apoptosis in vitro, we sought to evaluate the influence of UBE2J1 on cell apoptosis in vivo by using a mouse model of EC. The mice were subcutaneously injected with Ishikawa cells transfected with stable sh-UBE2J1 or sh-NC. Immunohistochemistry analysis demonstrated that the expression of UBE2J1 was lower in the sh-UBE2J1-Ishikawa group than in the sh-NC-Ishikawa group. The increased expression of Bax and the decreased expression of Bcl-2 were discovered in the sh-UBE2J1-Ishikawa group compared with the sh-NC-Ishikawa group (Figure 6a). In addition, western blot analysis indicated that Bax protein level was increased while Bcl-2 protein level was reduced in the sh-UBE2J1-Ishikawa group versus the sh-NC-Ishikawa group (Figure 6b). These results indicate that UBE2J1 depletion results in apoptosis induction in vivo.

Figure 6 Knockdown of UBE2J1 induces cell apoptosis in vivo. (a) Expression levels of UBE2J1, Bax, and Bcl-2 in tumor tissues were detected by immunohistochemistry. (b) H-score for each protein. (c) Protein levels of Bax and Bcl-2 in tumor tissues were evaluated by western blot. Bar graphs were used to represent the data. *** p < 0.001.
Figure 6

Knockdown of UBE2J1 induces cell apoptosis in vivo. (a) Expression levels of UBE2J1, Bax, and Bcl-2 in tumor tissues were detected by immunohistochemistry. (b) H-score for each protein. (c) Protein levels of Bax and Bcl-2 in tumor tissues were evaluated by western blot. Bar graphs were used to represent the data. *** p < 0.001.

3.7 Knockdown of UBE2J1 regulates the PI3K/AKT and MDM2/p53 signaling in the mouse model of EC

Finally, the molecular mechanisms underlying the regulation of UBE2J1 on in vivo cell apoptosis were explored. Western blot analysis illustrated that the protein levels of p-PI3K and p-AKT were decreased in the sh-UBE2J1-Ishikawa group compared with the sh-NC-Ishikawa group (Figure 7a). Furthermore, lower expression of UBE2J1 and MDM2 and higher expression of p53 were found in the sh-UBE2J1-Ishikawa group than in the sh-NC-Ishikawa group (Figure 7b and c). Taken together, UBE2J1 knockdown suppressed the PI3K/AKT and activated the MDM2/p53 signaling in the mouse model of EC.

Figure 7 Knockdown of UBE2J1 regulates the PI3K/AKT and MDM2/p53 signaling in vivo. (a) Western blot analyses were applied to assess the protein levels of key molecules involved in the PI3K/AKT signaling pathway in tumor tissues. (b) Expression of UBE2J1 in tumor tissues was tested by RT-qPCR. (c) Protein levels of MDM2 and p53 in tumor tissues were examined by western blot. Bar graphs were used to represent the data. *** p < 0.001.
Figure 7

Knockdown of UBE2J1 regulates the PI3K/AKT and MDM2/p53 signaling in vivo. (a) Western blot analyses were applied to assess the protein levels of key molecules involved in the PI3K/AKT signaling pathway in tumor tissues. (b) Expression of UBE2J1 in tumor tissues was tested by RT-qPCR. (c) Protein levels of MDM2 and p53 in tumor tissues were examined by western blot. Bar graphs were used to represent the data. *** p < 0.001.

4 Discussion

Previous studies have revealed that UBE2J1 facilitates malignant phenotypes of many human cancers and is closely associated with poor overall survival and unfavorable prognosis of patients [7,8,16]. Importantly, downregulation of UBE2J1 was reported to repress EC cell growth, adhesion, migration, invasion as well as EMT process via mediating the PI3K/AKT signaling [9]. Based on this, our study demonstrated for the first time that UBE2J1 downregulation facilitated EC cell apoptosis, which might be achieved through regulating the PI3K/AKT and the MDM2/p53 signaling. Thus, we concluded from our study that UBE2J1 may be an oncogene in EC genesis and development.

The PI3K/AKT signaling is suggested to play an oncogenic role in multiple cancer cellular processes including cell proliferation, motion, and autophagy [17]. Moreover, emerging evidence has shown that UBE2J1 is involved in gene modulation in human cancers through different signaling pathways [9,18,19]. Herein, our study revealed that the expression of PI3K and AKT have positive correlations with that of UBE2J1. High expression PI3K and AKT contributes to poor prognosis in patients with EC. Since the previous study has demonstrated that UBE2J1 influenced EC cell phenotypes via modulating the PI3K/AKT pathway, the inhibition of UBE2J1 on EC cell apoptosis might also be mediated by through the PI3K/AKT axis. The subsequent western blot analyses in our study showed that UBE2J1 depletion markedly reduced the protein levels of p-PI3K and p-AKT in EC cells, suggesting that the PI3K/AKT pathway is implicated in the regulation of EC cell apoptosis by UBE2J1.

The p53 gene, as a tumor suppressor, plays a very important role in the progression of tumors [20]. P53 is usually inactivated during cancer development, which not only losses its suppressive tumor activities but often results in additional oncogenic functions, such as promoting cancer cell proliferation and metastasis, and inhibiting cell apoptosis [21,22]. The E3 ubiquitin protein ligase MDM2 was reported to negatively regulate p53, which can directly interact with p53 to suppress p53 transcriptional activity and translocation from the nucleus to the cytoplasm [23]. MDM2 is dysregulated in many cancers and impedes many activities that heavily depend on p53, such as cell apoptosis and cell-cycle arrest [24]. Numerous studies have demonstrated that the MDM2/p53 pathway plays a pivotal role in the development of a variety of tumors, including EC [25–27]. In addition, MDM2-mediated p53 ubiquitination and degradation can be modulated by the PI3K/AKT signaling pathway [28]. Herein, it was found that UBE2J1 positively modulated the expression of MDM2. UBE2J1 knockdown promoted p53 signaling by inhibiting MDM2 expression. Importantly, we found that the promotive effect of UBE2J1 knockdown on cell apoptosis in EC was reversed by MDM2 overexpression. We also analyzed the protein levels of cell apoptosis markers in cancer cells after the co-transfection of sh-UBE2J1 and pcDNA3.1/MDM2 to validate the interaction between UBE2J1 and MDM2. Typically, as a member of B cell leukemia 2 (BCL2) family, Bax serves as a regulator in various cell types and pro- or anti-apoptotic activities. Bax expression is modulated by p53 and was suggested to be implicated in p53-induced apoptosis [29–31]. Furthermore, in vivo animal experiments were also performed to verify the results obtained from in vitro assays. The results showed that UBE2J1 knockdown increased Bax protein level and decreased Bcl-2 protein level in mouse model of EC. The expression of p-PI3K, p-AKT, and MDM2 was elevated, while the expression of p53 was reduced in mice after downregulating UBE2J1. These analyses suggested that UBE2J1 can suppress the p53 pathway by upregulating MDM2 expression, thereby facilitating the malignancy of EC.

Our study has several strengths and limitations. This is the first study to investigate the role and molecular mechanism of UBE2J1 on cell apoptosis in EC. Second, in vivo animal experiments were performed to validate the findings of the in vitro assays. Third, we further confirmed that the PI3K/AKT pathway mediates the downstream MDM2/P53 signaling in EC development. However, there also exist some limitations. The upstream genes of UBE2J1 in mediating EC cell apoptosis have not been explored. Additionally, clinical data on EC cases were all obtained from public database, whose accuracy requires to be verified.

In conclusion, our study demonstrated for the first time that UBE2J1 suppresses cell apoptosis in EC by regulating the PI3K/AKT and MDM2/p53 signaling. Our findings provide new perspectives on the investigation of dysregulated genes in EC and suggest that the interaction among UBE2J1, the PI3K/AKT, and MDM2/p53 signaling pathway might be a possible therapeutic target for patients with EC.

# These authors contributed equally to this work.

Acknowledgement

Not applicable.

  1. Funding information: No funding was received.

  2. Author contributions: All authors contributed to the study conception and design. Material preparation and data collection were performed by H.P.G., F.Z., K.J., F.Y., and X.L.L. Data analysis was performed by H.P.G. and F.Z. The first draft of the manuscript was written by P.Z. All authors commented on the previous versions of the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors declare that there are no competing interests in this study.

  4. Data availability statement: The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

Appendix

Additional file 1 The flow chart of the main steps in our experiment.

Table A1 The detailed statistics for each assay.
Table A1

The detailed statistics for each assay.

References

[1] Colombo N, Creutzberg C, Amant F, Bosse T, González-Martín A, Ledermann J, et al. ESMO-ESGO-ESTRO consensus conference on endometrial cancer: diagnosis, treatment and follow-up. Int J Gynecol Cancer. 2016;26(1):2–30. 10.1097/igc.0000000000000609.Search in Google Scholar PubMed PubMed Central

[2] Amant F, Moerman P, Neven P, Timmerman D, Van Limbergen E, Vergote I. Endometrial cancer. Lancet. 2005;366(9484):491–505. 10.1016/s0140-6736(05)67063-8.Search in Google Scholar PubMed

[3] Braun MM, Overbeek-Wager EA, Grumbo RJ. Diagnosis and management of endometrial cancer. Am Fam Physician. 2016;93(6):468–74.Search in Google Scholar

[4] Moore K, Brewer MA. Endometrial cancer: is this a new disease? Am Soc Clin Oncol Educ Book. 2017;37:435–42. 10.1200/edbk_175666.Search in Google Scholar

[5] Lee YC, Lheureux S, Oza AM. Treatment strategies for endometrial cancer: current practice and perspective. Curr Opin Obstet Gynecol. 2017;29(1):47–58. 10.1097/gco.0000000000000338.Search in Google Scholar

[6] Suri V, Arora A. Management of endometrial cancer: a review. Rev Recent Clin Trials. 2015;10(4):309–16. 10.2174/1574887110666150923115228.Search in Google Scholar PubMed

[7] Chen Z, Hu H. Identification of prognosis biomarkers of prostatic cancer in a cohort of 498 patients from TCGA. Curr Probl Cancer. 2019;43(6):100503. 10.1016/j.currproblcancer.2019.100503.Search in Google Scholar PubMed

[8] Wang X, Liao X, Huang K, Zeng X, Liu Z, Zhou X, et al. Clustered microRNAs hsa-miR-221-3p/hsa-miR-222-3p and their targeted genes might be prognostic predictors for hepatocellular carcinoma. J Cancer. 2019;10(11):2520–33. 10.7150/jca.29207.Search in Google Scholar PubMed PubMed Central

[9] Yang D, Ma X, Xu J, Jia K, Liu X, Zhang P. Zfx-induced upregulation of UBE2J1 facilitates endometrial cancer progression via PI3K/AKT pathway. Cancer Biol Ther. 2021;22(3):238–47. 10.1080/15384047.2021.1883186.Search in Google Scholar PubMed PubMed Central

[10] Ediriweera MK, Tennekoon KH, Samarakoon SR. Role of the PI3K/AKT/mTOR signaling pathway in ovarian cancer: biological and therapeutic significance. Semin Cancer Biol. 2019;59:147–60. 10.1016/j.semcancer.2019.05.012.Search in Google Scholar PubMed

[11] Xu J, Xiao Y, Liu B, Pan S, Liu Q, Shan Y, et al. Exosomal MALAT1 sponges miR-26a/26b to promote the invasion and metastasis of colorectal cancer via FUT4 enhanced fucosylation and PI3K/Akt pathway. J Exp Clin Cancer Res. 2020;39(1):54. 10.1186/s13046-020-01562-6.Search in Google Scholar PubMed PubMed Central

[12] Kondo I, Iida S, Takagi Y, Sugihara K. MDM2 mRNA expression in the p53 pathway may predict the potential of invasion and liver metastasis in colorectal cancer. Dis Colon Rectum. 2008;51(9):1395–402. 10.1007/s10350-008-9382-5.Search in Google Scholar PubMed

[13] Liang Z, Zhong Y, Meng L, Chen Y, Liu Y, Wu A, et al. HAX1 enhances the survival and metastasis of non-small cell lung cancer through the AKT/mTOR and MDM2/p53 signaling pathway. Thorac Cancer. 2020;11(11):3155–67. 10.1111/1759-7714.13634.Search in Google Scholar PubMed PubMed Central

[14] Wang Y, Zhao J, Zhang C, Wang P, Huang C, Peng H. miR-219a-2-3p suppresses cell proliferation and promotes apoptosis by targeting MDM2/p53 in pituitary adenomas cells. Biosci Biotechnol Biochem. 2020;84(5):911–8. 10.1080/09168451.2020.1715780.Search in Google Scholar PubMed

[15] Du SH, Li DR, Wang HJ, Wang Q. Application of RT-qPCR in the study of forensic pathology. Fa Yi Xue Za Zhi. 2017;33(5):526–31. 10.3969/j.issn.1004-5619.2017.05.017.Search in Google Scholar PubMed

[16] Palmer CJ, Galan-Caridad JM, Weisberg SP, Lei L, Esquilin JM, Croft GF, et al. Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway. Cancer Res. 2014;74(20):5914–24. 10.1158/0008-5472.Can-14-0834.Search in Google Scholar PubMed PubMed Central

[17] Aoki M, Fujishita T. Oncogenic roles of the PI3K/AKT/mTOR axis. Curr Top Microbiol Immunol. 2017;407:153–89. 10.1007/82_2017_6.Search in Google Scholar PubMed

[18] Cremer T, Jongsma MLM, Trulsson F, Vertegaal ACO, Neefjes J, Berlin I. The ER-embedded UBE2J1/RNF26 ubiquitylation complex exerts spatiotemporal control over the endolysosomal pathway. Cell Rep. 2021;34(3):108659. 10.1016/j.celrep.2020.108659.Search in Google Scholar PubMed

[19] Feng T, Deng L, Lu X, Pan W, Wu Q, Dai J. Ubiquitin-conjugating enzyme UBE2J1 negatively modulates interferon pathway and promotes RNA virus infection. Virol J. 2018;15(1):132. 10.1186/s12985-018-1040-5.Search in Google Scholar PubMed PubMed Central

[20] Duffy M, Synnott N, McGowan P, Crown J, O’Connor D, Gallagher W. p53 as a target for the treatment of cancer. Cancer Treat Rev. 2014;40(10):1153–60. 10.1016/j.ctrv.2014.10.004.Search in Google Scholar PubMed

[21] Bhutia Y, Ogura J, Grippo P, Torres C, Sato T, Wachtel M, et al. Chronic exposure to excess iron promotes EMT and cancer via p53 loss in pancreatic cancer. Asian J Pharm Sci. 2020;15(2):237–51. 10.1016/j.ajps.2020.02.003.Search in Google Scholar PubMed PubMed Central

[22] Omar A, Kalra R, Putri J, Elwakeel A, Kaul S, Wadhwa R. Soyasapogenol-A targets CARF and results in suppression of tumor growth and metastasis in p53 compromised cancer cells. Sci Rep. 2020;10(1):6323. 10.1038/s41598-020-62953-5.Search in Google Scholar PubMed PubMed Central

[23] Gupta A, Shah K, Oza M, Behl T. Reactivation of p53 gene by MDM2 inhibitors: a novel therapy for cancer treatment. Biomed Pharmacother. 2019;109:484–92. 10.1016/j.biopha.2018.10.155.Search in Google Scholar PubMed

[24] Oliner JD, Saiki AY, Caenepeel S. The role of MDM2 amplification and overexpression in tumorigenesis. Cold Spring Harb Perspect Med. 2016;6(6):a026336. 10.1101/cshperspect.a026336.Search in Google Scholar PubMed PubMed Central

[25] Chen L, Li W, Li Z, Song Y, Zhao J, Chen Z, et al. circNUDT21 promotes bladder cancer progression by modulating the miR-16-1-3p/MDM2/p53 axis. Mol Ther Nucleic Acids. 2021;26:625–36. 10.1016/j.omtn.2021.08.032.Search in Google Scholar PubMed PubMed Central

[26] Wang C, Li X, Shi P, Ding H, Liu Y, Li T, et al. Holliday junction recognition protein promotes pancreatic cancer growth and metastasis via modulation of the MDM2/p53 signaling. Cell Death Dis. 2020;11(5):386. 10.1038/s41419-020-2595-9.Search in Google Scholar PubMed PubMed Central

[27] Yoneda T, Kuboyama A, Kato K, Ohgami T, Okamoto K, Saito T, et al. Association of MDM2 SNP309 and TP53 Arg72Pro polymorphisms with risk of endometrial cancer. Oncol Rep. 2013;30(1):25–34. 10.3892/or.2013.2433.Search in Google Scholar PubMed PubMed Central

[28] Ogawara Y, Kishishita S, Obata T, Isazawa Y, Suzuki T, Tanaka K, et al. Akt enhances Mdm2-mediated ubiquitination and degradation of p53. J Biol Chem. 2002;277(24):21843–50. 10.1074/jbc.M109745200.Search in Google Scholar PubMed

[29] Donahue RJ, Maes ME, Grosser JA, Nickells RW. BAX-depleted retinal ganglion cells survive and become quiescent following optic nerve damage. Mol Neurobiol. 2020;57(2):1070–84. 10.1007/s12035-019-01783-7.Search in Google Scholar PubMed PubMed Central

[30] Edlich F, Banerjee S, Suzuki M, Cleland MM, Arnoult D, Wang C, et al. Bcl-x(L) retrotranslocates Bax from the mitochondria into the cytosol. Cell. 2011;145(1):104–16. 10.1016/j.cell.2011.02.034.Search in Google Scholar PubMed PubMed Central

[31] Jensen K, WuWong DJ, Wong S, Matsuyama M, Matsuyama S. Pharmacological inhibition of Bax-induced cell death: Bax-inhibiting peptides and small compounds inhibiting Bax. Exp Biol Med (Maywood). 2019;244(8):621–9. 10.1177/1535370219833624.Search in Google Scholar PubMed PubMed Central

Received: 2021-11-30
Revised: 2022-07-01
Accepted: 2022-08-18
Published Online: 2023-02-24

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2022-0567
Keywords for this article
cell apoptosis; endometrial cancer; MDM2/p53 pathway; PI3K/AKT pathway; UBE2J1
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 9.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0567/html?lang=en
Scroll to top button