Home Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
Article Open Access

Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis

  • Shaolan Li , Wenhao Chen , Zhihong Zhang , Ling Yuan , Yingchun Hu and Muhu Chen EMAIL logo
Published/Copyright: November 26, 2024

Abstract

Peripheral blood samples from 15 septic patients admitted within 24 h and 8 healthy volunteers were used to conduct RNA-seq. Quantitative PCR of THP1 cells was performed to investigate the expression levels of the selected key genes. A total of 1,128 differential genes were identified, 721 of which were upregulated and 407 were downregulated. These genes are mainly involved in neutrophil activation, T cell regulation, immune effector process regulation, cytokine receptor activity, and cytokine binding. The six target genes were ELANE, IL1R2, RAB13, RNASE3, FCGR1A, and TLR5. In the sepsis group, FCGR1A and TLR5 were positively associated with survival compared to ELANE, IL1R2, RAB13, and RNASE3, which were adversely associated with survival. Furthermore, a meta-analysis based on public databases revealed an increased expression of these six target genes in the peripheral blood of patients with sepsis. In addition, we discovered that monocytes primarily express these genes. Using qPCR, we confirmed that these six important genes were highly expressed in lipopolysaccharide-treated THP1 cells. In summary, these findings suggest that ELANE, IL1R2, RAB13, RNASE3, FCGR1A, and TLR5 may influence the prognosis of patients with sepsis and provide novel insights and potential avenues for the treatment of sepsis.

1 Introduction

Sepsis is characterized by a systemic inflammatory response followed by an immunosuppressive phase in the host [1,2]. It is a frequently encountered condition in intensive care units and is a leading contributor to mortality in these settings. The World Health Organization has raised concerns about the significant occurrence and mortality rates associated with sepsis, which places a heavy financial burden on healthcare systems [3]. Given the complex nature of sepsis pathology, there is an urgent need to develop innovative diagnostic and treatment approaches that can facilitate early detection and management, ultimately improving patient prognosis [4].

Numerous studies have demonstrated that sepsis patients exhibit altered cytokine responses, including reduced production of tumor necrosis factor, interleukin-1 (IL-1), interleukin-6 (IL-6), and lymphocyte apoptosis. These findings suggest that sepsis impairs adaptive immunity [5,6]. Studies on renal injury in endotoxemia have shown that there is an inflammatory response in the early stages, followed by an anti-inflammatory response, ultimately leading to organ dysfunction [7]. This is believed to be due to upregulated immune-related pathways in the epithelial cells. However, over time, endotoxins prevent cell–cell communication and reduce global protein synthesis [8,9]. Inflammation involves the participation of both innate and acquired immunity during the initial injury, inflammatory response, and subsequent repair processes [10]. Sepsis-induced leukocyte dysfunction and immunosuppression are associated with deleterious consequences [11,12]. Multiple studies have demonstrated that sepsis can markedly impact immune responses, leading to reduced antimicrobial capacity in the host [13] This can result in prolonged hospitalization and increased mortality rates [14]. A study using a mouse model of sepsis showed that the interaction between the Ox40 receptor on T cells and its corresponding ligand Ox40L on antigen-presenting cells had a positive impact on prognosis [15]. Hence, specific cell surface inhibitory immune checkpoint receptors and ligands cross-talk to balance between host immune competency and immunosuppression, which play important roles in the outcomes of sepsis.

The mechanisms underlying sepsis-induced systemic immune dysregulation are not clear [16]. Until now, effective strategies to rapidly discriminate and identify a specific treatment of sepsis are lacking. However, a study found that molecular signatures associated with sepsis have been identified in various whole blood samples [17]. Sepsis was found associated with dysregulation of the immune response to bacterial infection [18]. Through the application of single-cell genomics, researchers discovered immune cytologic signatures associated with sepsis in the whole blood of septic patients [19]. The utilization of single-cell RNA sequencing (scRNA-seq) allows a comprehensive analysis of the entire transcriptome in numerous individual cells, making it a widely used approach in identifying heterogeneity within the immune system in various diseases [20,21]. A recent study has uncovered that the use of scRNA-seq has successfully detected kidney injury in sepsis [22]. Furthermore, the study has demonstrated that the failure of cell–cell communication is related to organ dysfunction in endotoxemia [8]. In sepsis, the whole blood of patients contains various nucleated cells. However, scRNA-seq has the ability to investigate gene expression in individual cells, allowing for the identification of diverse cell types in a larger number of samples [23]. In this study, we used scRNA-seq technology to first screen the cellular localization of key target genes in the whole blood of septic patients, and further investigated their functional roles to identify potential therapeutic targets.

2 Materials and methods

2.1 Recruitment, sample collection, and ethical approval

This study was approved by the clinical ethics committee and registered as a clinical trial. Peripheral blood samples were obtained from patients with sepsis (N = 15) admitted to the affiliated hospital of Southwest Medical University at ICU/EICU and from normal volunteers serving as the control group (N = 8) from January to December 2019.

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance with the tenets of the Helsinki Declaration, and has been approved by the Clinical Ethics Committee of Southwest Medical University (Ethics No: KY2018029) and the clinical trial registration (ChiCTR1900021261).

2.2 Sequencing, filtering, and screening of genes in peripheral blood

Total RNA was extracted from whole blood samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and quality-controlled using Agilent 2100 BioAnalyze (Thermo Fisher Scientific, MA, USA), following the manufacturer’s instructions. Ribosomal RNA (rRNA) was removed using the Ribo-off Globin & rRNA Depletion Kit (Human/Mouse/Rat) (Vazyme). Following SPRI bead purification, libraries were prepared using an Optimal Dual-mode mRNA library Prep Kit (BGI). Briefly, the RNA was fragmented before reverse transcription. This was followed by second-strand synthesis, and the constructed libraries were amplified and quality-controlled using Agilent 2100 BioAnalyze (Thermo Fisher Scientific, MA, USA) and quantified by real-time quantitative PCR (qPCR) (TaqMan Probe). Qualified libraries were double-sequenced using the BGI-500 MGISEQ-2000 system (BGI-Shenzhen, China). The raw data (lncRNA/mRNA, miRNA) were filtered using SOAPnuke (v1.5.6) to remove adapter contaminants, reads with a low-quality base ratio >20%, and reads with an unknown base ratio >5%. The clean reads were aligned to the human reference genome GCF_000001405.38_GRCh38.p12 using HISAT. Bowtie2 was used to align the clean reads with the reference gene sequences.

The matrix data from the read alignment underwent homogenization quality control using EdgeR:log2 (CPM + c) on the iDEP93 online analysis platform, which is based on the R programming language. To reduce variance and identify high similarity among samples, principal component analysis (PCA) was used for dimensionality reduction. Differential gene filtering was performed using the DESeq2 method to compare the data of the two groups, with the difference threshold parameters set at P < 0.01 and log2FC ≥2.

2.3 Protein–protein interaction (PPI) network, gene ontology (GO) analysis, and gene set enrichment analysis (GSEA)

A PPI network was constructed using differentially expressed genes (DEGs) and the STING database (https://cn.string-db.org/). In the PPI graph, the nodes represent proteins and the edges represent their interactions. In a network, there may be isolated components without edges connecting them. Isolated components have no edge connecting them to other components, and the largest component is the main component. The parameters of the PPI network topology were generated using NetworkAnalyzer [24]. GO, which is widely applied in biomedical sciences to mine large-scale datasets, include genomics, transcriptomics, proteomics, and metabolomics assays [25]. R4.0.5 was used for GO analysis of DEmRNA to further explore the functional enrichment of DEGs (P < 0.05). GSEA was performed with GSEA (R3.6.3). The Threshold for significance was defined as a False Discovery Rate (FDR) < 0.25 and P.adjust <0.05.

2.4 Survival curve

The GSE65682 dataset was used for hub gene survival and constructed using Scicluna BP in 2015. These data include the prognosis of 400 patients with sepsis after 28 days. Survival analysis was conducted after dividing the patients into high- and low-expression groups based on their gene expression levels. The GraphPad Prism 7 software (ver. 7.0f; La Jolla, CA, USA) was used to generate the survival curve. Statistical analysis was done using the log-rank test, and statistical significance was set at P < 0.05.

2.5 Meta-analysis

To verify the key genes, a meta-analysis was conducted using human specimens sourced from the GEO public database (loading datasets GSE28750, GSE54514, GSE69528, GSE95233, and GSE67652). The screening criteria for selecting data were as follows: human species, peripheral blood samples, gene Chip-seq or RNA-seq technology, age range of 16–65 years old, septic subjects constituting septic patients and normal individuals for the control group, and a sample size of at least 20 cases. The original data were quality controlled, and the average values of the genes were calculated. A forest map was constructed and the levels of key genes were evaluated through a meta-analysis.

2.6 Single-cell RNA sequencing

ScRNA-seq was performed on the Chromium platform using 10× Genomics combined with cell hashing according to the manufacturer’s instructions [26]. Blood sample mixtures from five volunteer donors (two healthy controls, one systemic inflammatory response syndrome patient, and two septic patients) were subjected to high-throughput sequencing and quality-controlled with Seurat. The resulting data were further processed with CellRanger (10× Genomics) to exclude unwanted cells. PCA and tSNE (nonlinear dimension reduction method) were used for dimension reduction and gene expression levels.

2.7 Cell culture and septic model

THP-1 cells (Procell CL-0233, China) were cultured at 37°C in a 5% CO2 atmosphere for up to 10 passages every 3 months for potential mycoplasma contamination using DAPI (Vector Labs). Cells were cultured in RPMI 1640 medium (ATCC) with 10% FBS, 1% P/S solution and 0.05 mM β-mercaptoethanol. The cells were treated with PMA (50 ng/mL) for 48 h, and incubated with lipopolysaccharide (LPS) (100 ng/mL) for 6 h to set the sepsis model.

2.8 RT-qPCR

RNA was extracted using DP419 (TIANGEN BIOTECH, China) according to the manufacturer’s instructions. The extracted RNA was stored at −20°C until use. cDNA was synthesized by mixing 4 μL of RNA with 4 μL ReverTra Ace qPCR RT Master Mix (TOYOBO Co., Ltd, Japan). qPCR was performed using the SYBR Green Real-Time PCR Master Mix (NO. QPK-201; TOYOBO Co., Ltd, Japan) and run on a LightCycler96 (Roche, USA). The relative expression of each gene was calculated using the 2-ΔΔCt Ct method. The primer sequences used are shown in Table 1.

Table 1

Primer sequences of hub genes

Genes Primer pair base sequence Length (bp)
ELANE F: GGAGCCCATAACCTCTCGC 93
R: GAGCAAGTTTACGGGGTCGT
FCGR1A F: AGCTGTGAAACAAAGTTGCTCT 75
R: GGTCTTGCTGCCCATGTAGA
IL1R2 F: ATGTTGCGCTTGTACGTGTTG 112
R: CCCGCTTGTAATGCCTCCC
TLR5 F: CCGGGTTTGGCTTCCATAACA 91
R: TGTGAAAGATCCAGGTGTCTCA
RAB13 F: GATCCGCACTGTGGATATAGAGG 102
R: CCACGGTAGTAGGCAGTAGTTAT
RNASE3 F: CCCCACAGTTTACGAGGGCTC 229
R: ACCCGGAATCTACTCCGATGA
β-actin F: CTACCTCATGAAGATCCTCACCGA 84
R: TTCTCCTTAATGTCACGCACGATT

2.9 Statistical analysis

Data were analyzed using t-tests to confirm statistical significance, with a threshold of P < 0.05 unless otherwise noted. The figures display the means and standard deviations as mean value ± standard deviation. Additionally, the original RNA-seq data were compared after logarithmic transformation, and the survival curve was analyzed using the log-rank test. Key genes were verified using continuous Met-analysis and the mountain map was visualized using ggplot 2.

The samples were collected using the PAXgene system and stored at −80℃ freezer. The inclusion criteria for patients with sepsis adhering to the SEPSIS3.0: infection + quick sepsis-related organ failure assessment score ≥2. Individuals aged <16 or >65 years, those with prior organ dysfunction, and immunocompromised patients were excluded from the study.

3 Results

3.1 Inflammatory markers were more associated with sepsis

We analyzed peripheral blood samples obtained from a cohort of patients with sepsis (n = 15) and compared them to a control group consisting of healthy volunteers (n = 8). Patients with sepsis presented with two-organ dysfunction, and relevant demographic and clinical data were collected, including sex, age, white blood cell count (WBC), procalcitonin (PCT), lactate, prothrombin time (PT), creatinine, and direct bilirubin (Table 2). Our results revealed a significant increase in WBC, PCT, lactate, PT, creatinine, and direct bilirubin levels in patients with sepsis compared with those in the control group. However, no statistically significant difference was observed between sexes. An increase in inflammatory markers in the peripheral blood was indicative of sepsis and suggested organ dysfunction. In this study, no statistically significant difference was observed between sexes.

Table 2

Clinical and demographic characteristics of the study subjects

Items Sepsis group (n = 15) Normal control group (n = 8) P value
Gender (male/female) 7/8 4/4 #
Age (years) 50.87 ± 4.44 56.25 ± 1.60 0.08
WBC (109/L) 12.39 ± 1.67 5.25 ± 0.36 0.01
PCT (ng/L) 4.475 ± 0.86 0.01 ± 0.003 <0.001
LACT (mmol/L) 3.17 ± 0.30 0.21 ± 0.03 <0.001
PT (s) 15.93 ± 0.85 9 ± 0.32 <0.001
DBILI (μmol/L) 13.89 ± 3.021 3.625 ± 0.37 0.02
CREA (μmol/L) 114.9 ± 24.07 28.25 ± 2.73 0.02

#: No statistical significance.

3.2 Screening of DEGs

The data were standardized for comparability purposes to identify DEGs in peripheral blood samples (Figure 1a). The PCA revealed significant differences between the two samples (Figure 1b). A total of 1,128 DEGs were identified in the peripheral blood samples, of which 721 genes were upregulated and 407 genes were downregulated in septic patients compared to those in the control group (Figure 1c and d).

Figure 1 
                  Filtering the differential genes in septic peripheral blood samples compared to normal controls. (a) The phase diagram represents gene expression sequencing from two types of homogenates: NC (red) for the normal control group and SEPSIS (blue) for the sepsis group. The ordinate denotes the logarithm of gene expression. (b) The principal component analysis diagram reveals that PC1 and PC2 are primary genes distinguishing the two sample groups. (c) Volcano map illustrating the distribution of differentially expressed genes: each dot represents a gene, blue indicates downregulated genes and red represents upregulated genes. The abscissa reflects the logarithmic value of the fold change, while the ordinate corresponds to the negative logarithmic value of the FDR significance value (base 10). (d) Heatmap of differential genes: red denotes upregulated genes and blue represents downregulated genes, with 407 genes downregulated in sepsis compared to the control group.
Figure 1

Filtering the differential genes in septic peripheral blood samples compared to normal controls. (a) The phase diagram represents gene expression sequencing from two types of homogenates: NC (red) for the normal control group and SEPSIS (blue) for the sepsis group. The ordinate denotes the logarithm of gene expression. (b) The principal component analysis diagram reveals that PC1 and PC2 are primary genes distinguishing the two sample groups. (c) Volcano map illustrating the distribution of differentially expressed genes: each dot represents a gene, blue indicates downregulated genes and red represents upregulated genes. The abscissa reflects the logarithmic value of the fold change, while the ordinate corresponds to the negative logarithmic value of the FDR significance value (base 10). (d) Heatmap of differential genes: red denotes upregulated genes and blue represents downregulated genes, with 407 genes downregulated in sepsis compared to the control group.

3.3 Cell–cell interaction in context of sepsis

To explore the biological processes of immune cell interactions in sepsis, we utilized PPI network and GO analysis. Functional analysis revealed that the expression of genes related to surface compound interactions, growth factor interactions, activation of inflammatory factor receptors, and cell–cell adhesion mediator activation were altered in sepsis. There were also changes in cellular components, such as the cytoplasmic vesicle lumen, secretory granules, and specific granules. Moreover, there are changes in biological processes, including neutrophil activation, response to molecules of bacterial origin, regulation of immune effector processes, and T-cell activation, leading to cell death. The majority of the DEGs were found to be related to neutrophil activation (Figure 2a). The PPI network showed that many of the target proteins involved in these functions were interconnected and had numerous cross-links, implicating factors related to neutrophil activation, the secretory granule lumen, and primary lysosomes (Figure 2b). Furthermore, several biological processes were found upregulated in septic patients, including secreted factors, extracellular matrix organization, cell surface interactions at the vascular wall, antigen processing cross-presentation, and toll-like receptor cascades (Figure 2c and d).

Figure 2 
                  Genes associated with the functional enrichment. (a) Bubble size represents the number of genes enriched, and bubble color denotes statistical significance. (b) Blue color indicates functional enrichment, while red suggests gene enrichment by PPI. (c) GSEA analysis demonstrates that target genes are in the forefront, with relevant functions upregulated in sepsis. (d) Mountain diagram indicates that functional target genes are significantly at the forefront with increased expression based on GSEA analysis.
Figure 2

Genes associated with the functional enrichment. (a) Bubble size represents the number of genes enriched, and bubble color denotes statistical significance. (b) Blue color indicates functional enrichment, while red suggests gene enrichment by PPI. (c) GSEA analysis demonstrates that target genes are in the forefront, with relevant functions upregulated in sepsis. (d) Mountain diagram indicates that functional target genes are significantly at the forefront with increased expression based on GSEA analysis.

3.4 Location of core functional genes

Investigating the relevant functional gene cluster via cell–cell interaction or ligand-receptor link, PPI network analysis exhibited AAZU1, ELANE, MPO, RNASE3, IL10, IL1R2, RAB13, TLR5, and FCGR1A genes located in the center. Functional enrichment analysis indicated that these genes were mainly related to the inflammatory response as well as secretory and cell communication factors (Figure 3).

Figure 3 
                  Key genes associated with cell–cell communication. The STRING protein interaction network diagram illustrates that many target genes are located in the center: green represents secretion by cell, red represents immune response, purple indicates cell communication, and blue signifies secretory vesicle.
Figure 3

Key genes associated with cell–cell communication. The STRING protein interaction network diagram illustrates that many target genes are located in the center: green represents secretion by cell, red represents immune response, purple indicates cell communication, and blue signifies secretory vesicle.

3.5 Expressions of core genes vs prognosis

Analysis of clinical prognostic data (dataset: GSE65682) in the context of sepsis revealed that the upregulation of ELANE, IL1R2, RAB13, and RNASE3 affected prognosis by reducing the survival rate of patients with sepsis (Figure 4a, c, e, f). However, high expression of FCGR1A and TLR5 was associated with increased survival rates in the sepsis group compared to those in the control group (Figure 4b, d). Our results suggest that the six key genes may have a significant influence on the prognosis of patients with sepsis and can be targeted for septic drug development, which requires further research.

Figure 4 
                  Key genes related to survival rate in sepsis. The red curve represents high expression (n = 239) and the green curve indicates low expression (n = 239. (a)–(f) ELANE, FCGR1A, IL1R2, TLR5, RAB13, and RNASE3 were expressed in sepsis using GSE65682 dataset.
Figure 4

Key genes related to survival rate in sepsis. The red curve represents high expression (n = 239) and the green curve indicates low expression (n = 239. (a)–(f) ELANE, FCGR1A, IL1R2, TLR5, RAB13, and RNASE3 were expressed in sepsis using GSE65682 dataset.

3.6 Meta-analysis for the six core genes location

To address the limited sample size, a meta-analysis was conducted using the sepsis-related datasets from the GEO database to validate our findings. Meta-random-effects model analysis showed that elevated expression levels of ELANE, FCGR1A, IL1R2, and RNASE3 were associated with sepsis (Figure 5a, c, e, f). Additionally, there was an increased expression of TLR5 and RAB13 in sepsis, although this change was not statistically significant and was not easily noticeable (Figure 5b and d).

Figure 5 
                  Meta-analysis verifying the expression of key genes using GEO database. (a)–(f) ELANE, FCGR1A, IL1R2, RNASE3, TLR5, and RAB13 were expressed in sepsis and control group, separately. The fixed-effect model was selected when the heterogeneity test was P ≥ 0.05; however, random effect model was selected when heterogeneity test was P < 0.05.
Figure 5

Meta-analysis verifying the expression of key genes using GEO database. (a)–(f) ELANE, FCGR1A, IL1R2, RNASE3, TLR5, and RAB13 were expressed in sepsis and control group, separately. The fixed-effect model was selected when the heterogeneity test was P ≥ 0.05; however, random effect model was selected when heterogeneity test was P < 0.05.

3.7 Expressed key genes in the monocyte

Given the diverse types of cells in human blood, sc-RNA-seq was performed to confirm the specific location of the key genes. To mitigate false-negative results, five samples were combined and the sequenced cells were categorized into nine different cell modules after dimension reduction. Cell modules were identified using specific markers. Clusters 1, 2, 6, and 8 were determined to be T cell lines, whereas cluster 4 was identified as NK cells. Clusters 3 and 5 were found to be monocytes and cluster 7 was identified as B cells (Figure 6a). Cells in clusters 3 and 5 expressed CD14, a common monocyte biomarker (Figure 6b). Cells in clusters 1, 2, 4, 6, and 8 expressed CD3E, a biomarker of the NK-T cell line (Figure 6c). Single-cell RNA sequencing analysis revealed that ELANE, FCGR1A, IL1R2, TLR5, RAB13, and RNASE3 were mainly present in monocyte cell lines (Figure 6d–j).

Figure 6 
                  Location of key genes confirmed by single-cell RNA sequencing. (a) Each dot represents a cell using tSNE two-dimensional general diagram after PCA dimensionality reduction: clusters 1,2,6, and 8 are T cell lines; cluster 4 is NK cells; clusters 3 and 5 are monocytes, and cluster 7 is B cells. (b) CD14 is a common biomarker of monocytes. (c) CD3E was a biomarker of the NK-T cell line. (d)–(i) ELANE, FCGR1A, IL1R2, TLR5, RAB13, and RNASE3 are mainly present with peripheral blood mononuclear cell. (j) The bubble map of gene expression indicated that the color represents the relative level of expression value, with red representing high expression and blue indicating low expression. Bubble size represents the expression ratio of cells in the cell line.
Figure 6

Location of key genes confirmed by single-cell RNA sequencing. (a) Each dot represents a cell using tSNE two-dimensional general diagram after PCA dimensionality reduction: clusters 1,2,6, and 8 are T cell lines; cluster 4 is NK cells; clusters 3 and 5 are monocytes, and cluster 7 is B cells. (b) CD14 is a common biomarker of monocytes. (c) CD3E was a biomarker of the NK-T cell line. (d)–(i) ELANE, FCGR1A, IL1R2, TLR5, RAB13, and RNASE3 are mainly present with peripheral blood mononuclear cell. (j) The bubble map of gene expression indicated that the color represents the relative level of expression value, with red representing high expression and blue indicating low expression. Bubble size represents the expression ratio of cells in the cell line.

3.8 LPS involvement in the expression of the six core genes

To investigate whether the transcription of these key genes is associated with sepsis, in vitro PCR was conducted. The mRNA expression levels of ELANE, FCGR1A, IL1R2, TLR5, RAB13, and RNASE3 were significantly higher in THP1 cells treated with LPS than those in the control group (Figure 7a–f). These findings were consistent with the data obtained from single-cell RNA sequencing in vivo.

Figure 7 
                  Increased expression of key genes in in vitro experiment. (a)–(f) ELANE, FCGR1A, IL1R2, RNASE3, TLR5, and RAB13 were respectively expressed in LPS-treated THP1 cells and control group and quantified with RT-qPCR.
Figure 7

Increased expression of key genes in in vitro experiment. (a)–(f) ELANE, FCGR1A, IL1R2, RNASE3, TLR5, and RAB13 were respectively expressed in LPS-treated THP1 cells and control group and quantified with RT-qPCR.

4 Discussion

Sepsis imposes a substantial incidence and mortality burden on society, leading to significant mental and economic consequences [27]. Although significant progress has been made in the diagnosis and management of sepsis, challenges persist in achieving early prevention and management to improve clinical outcomes [4]. The mechanisms underlying sepsis onset and progression are not yet fully understood, hindering the development of precisely targeted therapies. Therefore, comprehensive sequencing and screening of the entire genome is essential for advancing sepsis research [28].

In this study, we focused on proteins involved in cell–cell interactions, particularly those related to inflammatory mediator receptors and ligand–receptor interactions. These interactions can trigger inflammatory responses and cell death [29]. We identified 1,128 differential genes, with 721 upregulated and 407 downregulated genes in two peripheral blood samples. Immune cell–cell interactions facilitate functional enrichment in sepsis, aiding the identification of core functional genes in PPI networks.

Six core genes, ELANE, IL1R2, RAB13, RNASE3, FCGR1A, and TLR5, have been linked to sepsis prognosis. ELANE, IL1R2, RAB13, and RNASE3 promote cell death, whereas FCGR1A and TLR5 facilitate cell survival in sepsis. Notably, these six core genes were predominantly present in monocyte cell lines. In vitro, we observed a significant increase in the expression of the six core genes in LPS-treated THP1 cells compared with that in the control group. This provides clear evidence that cell–cell interactions in peripheral blood monocytes promote the enrichment of six core functional genes associated with the prognosis of patients with sepsis.

Understanding cell–cell interactions is crucial for mediating physiological processes, and leveraging tools such as sc-RNA-seq has enhanced our ability to combat diseases including sepsis [3032]. By examining the interaction between ligands and receptors in six mouse tumor models, we used a combination of sc-RNA-seq and clinical prognosis data to identify 1,128 differential genes. Subsequently, we filtered six core genes using a PPI network based on clinical databases [33,34]. The functional characteristics of the identified genes differed between cancer and sepsis. ELANE, a serine protease expressed in neutrophil granules, has potential implications for anticancer treatment [35]. FCGR1A has been proposed as a prognostic biomarker in various cancers and may be linked to immune infiltration levels [36]. IL1R2, a negative immune regulator, serves as a diagnostic marker for acute myocardial infarction and is implicated in promoting breast cancer cell proliferation and invasion [37,38]. TLR5 exacerbates airway inflammation and asthma symptoms, while RAB13 serves as a novel prognostic marker in gastric cancer [39,40]. RNase3, expressed in leukocytes, regulates macrophage defense mechanisms against infections, and its overexpression protects cells [41].

Importantly, our findings indicate that high expression levels of ELANE, IL1R2, RAB13, and RNASE3 promote death rates in sepsis, whereas high expression levels of FCGR1A and TLR5 improve the survival rate of patients with sepsis. These six key genes may serve as potential therapeutic targets for treating sepsis.

Despite potential limitations, such as the limited sample size used for sequencing and the inclusion of older patients with decreased immune function, our study offers valuable insights into potential therapeutic targets for sepsis treatment. Further studies are required to confirm and validate these results.


tel: +86-08303165120

  1. Funding information: This study was supported by grants from the Health Commission of Sichuan Province (Grant No. 20PJ138), the Project of Science and Technology Department of Sichuan Province (2022NSFSC1522), the Affiliated Hospital of Southwest Medical University that initiated the doctoral project (21069), and the Southwest Medical University Joint Science and Technology Research Fund (2021LZXNYD-J13).

  2. Author contributions: Shaolan Li: conceptualization, methodology, validation, investigation, data curation, resources, writing – original draft, review, and editing, and project administration. Wenhao Chen: conceptualization, formal analysis, investigation, data curation, writing – original draft, reviewing, and editing, and visualization. Zhihong Zhang: validation, formal analysis, investigation, data curation, writing – original draft, review, and editing, visualization, and project administration. Ling Yuan: validation, formal analysis, investigation, data curation, review, and editing. Yingchun Hu: validation, methodology, investigation, data curation, resources, review, and editing, visualization, supervision, and project administration; Muhu Chen: conceptualization, formal analysis, investigation, data curation, writing – original draft, review, and editing, and resources.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Martínez-García JJ, Martínez-Banaclocha H, Angosto-Bazarra D, de Torre-Minguela C, Baroja-Mazo A, Alarcón-Vila C, et al. P2X7 receptor induces mitochondrial failure in monocytes and compromises NLRP3 inflammasome activation during sepsis. Nat Commun. 2019;10(1):2711.10.1038/s41467-019-10626-xSearch in Google Scholar PubMed PubMed Central

[2] Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, et al. The third international consensus definitions for sepsis and septic shock (Sepsis-3). JAMA. 2016;315(8):801–10.10.1001/jama.2016.0287Search in Google Scholar PubMed PubMed Central

[3] Esposito S, De Simone G, Boccia G, De Caro F, Pagliano P. Sepsis and septic shock: New definitions, new diagnostic and therapeutic approaches. J Glob Antimicrob Resist. 2017;10:204–12.10.1016/j.jgar.2017.06.013Search in Google Scholar PubMed

[4] Liu AC, Patel K, Vunikili RD, Johnson KW, Abdu F, Belman SK, et al. Sepsis in the era of data-driven medicine: personalizing risks, diagnoses, treatments and prognoses. Brief Bioinform. 2020;21(4):1182–95.10.1093/bib/bbz059Search in Google Scholar PubMed PubMed Central

[5] Nedeva C. Inflammation and cell death of the innate and adaptive immune system during sepsis. Biomolecules. 2021;11(7):1011.10.3390/biom11071011Search in Google Scholar PubMed PubMed Central

[6] Rimmelé T, Payen D, Cantaluppi V, Marshall J, Gomez H, Gomez A, et al. Immune cell phenotype and function in sepsis. Shock. 2016;45(3):282–91.10.1097/SHK.0000000000000495Search in Google Scholar PubMed PubMed Central

[7] Dusabimana T, Je J, Yun SP, Kim HJ, Kim H, Park SW. GOLPH3 promotes endotoxemia-induced liver and kidney injury through Golgi stress-mediated apoptosis and inflammatory response. Cell Death Dis. 2023;14(7):458.10.1038/s41419-023-05975-xSearch in Google Scholar PubMed PubMed Central

[8] Janosevic D, Myslinski J, McCarthy TW, Zollman A, Syed F, Xuei X, et al. The orchestrated cellular and molecular responses of the kidney to endotoxin define a precise sepsis timeline. Elife. 2021;10:e62270.10.7554/eLife.62270Search in Google Scholar PubMed PubMed Central

[9] Hato T, Maier B, Syed F, Myslinski J, Zollman A, Plotkin Z, et al. Bacterial sepsis triggers an antiviral response that causes translation shutdown. J Clin Invest. 2019;129(1):296–309.10.1172/JCI123284Search in Google Scholar PubMed PubMed Central

[10] Wu YL, Li HF, Chen HH, Lin H. MicroRNAs as biomarkers and therapeutic targets in inflammation- and ischemia-reperfusion-related acute renal injury. Int J Mol Sci. 2020;21(18):6738.10.3390/ijms21186738Search in Google Scholar PubMed PubMed Central

[11] Venet F, Monneret G. Advances in the understanding and treatment of sepsis-induced immunosuppression. Nat Rev Nephrol. 2018;14(2):121–37.10.1038/nrneph.2017.165Search in Google Scholar PubMed

[12] McBride MA, Patil TK, Bohannon JK, Hernandez A, Sherwood ER, Patil NK. Immune checkpoints: novel therapeutic targets to attenuate sepsis-induced immunosuppression. Front Immunol. 2020;11:624272.10.3389/fimmu.2020.624272Search in Google Scholar PubMed PubMed Central

[13] van der Poll T, Shankar-Hari M, Wiersinga WJ. The immunology of sepsis. Immunity. 2021;54(11):2450–64.10.1016/j.immuni.2021.10.012Search in Google Scholar PubMed

[14] Patil NK, Bohannon JK, Sherwood ER. Immunotherapy: A promising approach to reverse sepsis-induced immunosuppression. Pharmacol Res. 2016;111:688–702.10.1016/j.phrs.2016.07.019Search in Google Scholar PubMed PubMed Central

[15] Unsinger J, Walton AH, Blood T, Tenney DJ, Quigley M, Drewry AM, et al. Frontline Science: OX40 agonistic antibody reverses immune suppression and improves survival in sepsis. J Leukoc Biol. 2021;109(4):697–708.10.1002/JLB.5HI0720-043RSearch in Google Scholar PubMed PubMed Central

[16] Evans L, Rhodes A, Alhazzani W, Antonelli M, Coopersmith CM, French C, et al. Surviving sepsis campaign: international guidelines for management of sepsis and septic shock 2021. Intensive Care Med. 2021;47(11):1181–247.10.1007/s00134-021-06506-ySearch in Google Scholar PubMed PubMed Central

[17] Sweeney TE, Khatri P. Benchmarking sepsis gene expression diagnostics using public data. Crit Care Med. 2017;45(1):1–10.10.1097/CCM.0000000000002021Search in Google Scholar PubMed PubMed Central

[18] Seymour CW, Kennedy JN, Wang S, Chang CH, Elliott CF, Xu Z, et al. Derivation, validation, and potential treatment implications of novel clinical phenotypes for sepsis. JAMA. 2019;321(20):2003–17.10.1001/jama.2019.5791Search in Google Scholar PubMed PubMed Central

[19] Reyes M, Filbin MR, Bhattacharyya RP, Billman K, Eisenhaure T, Hung DT, et al. An immune-cell signature of bacterial sepsis. Nat Med. 2020;26(3):333–40.10.1038/s41591-020-0752-4Search in Google Scholar PubMed PubMed Central

[20] Andrews TS, Kiselev VY, McCarthy D, Hemberg M. Tutorial: guidelines for the computational analysis of single-cell RNA sequencing data. Nat Protoc. 2021;16(1):1–9.10.1038/s41596-020-00409-wSearch in Google Scholar PubMed

[21] Papalexi E, Satija R. Single-cell RNA sequencing to explore immune cell heterogeneity. Nat Rev Immunol. 2018;18(1):35–45.10.1038/nri.2017.76Search in Google Scholar PubMed

[22] Peng Y, Fang Y, Li Z, Liu C, Zhang W. Saa3 promotes pro-inflammatory macrophage differentiation and contributes to sepsis-induced AKI. Int Immunopharmacol. 2023;21(127):111417.10.1016/j.intimp.2023.111417Search in Google Scholar PubMed

[23] Yamada S, Nomura S. Review of single-cell RNA sequencing in the heart. Int J Mol Sci. 2020;21(21):8345.10.3390/ijms21218345Search in Google Scholar PubMed PubMed Central

[24] Alkan F, Erten C. RedNemo: topology-based PPI network reconstruction via repeated diffusion with neighborhood modifications. Bioinformatics. 2017;33(4):537–44.10.1093/bioinformatics/btw655Search in Google Scholar PubMed

[25] Xin Z, Cai Y, Dang LT, Burke HMS, Revote J, Charitakis N, et al. MonaGO: a novel gene ontology enrichment analysis visualisation system. BMC Bioinf. 2022;23(1):69.10.1186/s12859-022-04594-1Search in Google Scholar PubMed PubMed Central

[26] Stoeckius M, Zheng S, Houck-Loomis B, Hao S, Yeung BZ, Mauck WM, et al. Cell Hashing with barcoded antibodies enables multiplexing and doublet detection for single cell genomics. Genome Biol. 2018;19(1):224.10.1186/s13059-018-1603-1Search in Google Scholar PubMed PubMed Central

[27] Lo AH, Kee AC, Li A, Rubulotta F. Controversies in sepsis management-what is the way forward? Ann Acad Med. 2020;49(9):661–8.10.47102/annals-acadmedsg.202090Search in Google Scholar

[28] Moriyama K, Nishida O. Targeting cytokines, pathogen-associated molecular patterns, and damage-associated molecular patterns in sepsis via blood purification. Int J Mol Sci. 2021;22(16):8882.10.3390/ijms22168882Search in Google Scholar PubMed PubMed Central

[29] Kayagaki N, Wong MT, Stowe IB, Ramani SR, Gonzalez LC, Akashi-Takamura S, et al. Noncanonical inflammasome activation by intracellular LPS independent of TLR4. Science. 2013;341(6151):1246–9.10.1126/science.1240248Search in Google Scholar PubMed

[30] Bechtel TJ, Reyes-Robles T, Fadeyi OO, Oslund RC. Strategies for monitoring cell-cell interactions. Nat Chem Biol. 2021;17(6):641–52.10.1038/s41589-021-00790-xSearch in Google Scholar PubMed

[31] Norgeot B, Glicksberg BS, Butte AJ. A call for deep-learning healthcare. Nat Med. 2019;25(1):14–5.10.1038/s41591-018-0320-3Search in Google Scholar PubMed

[32] Choi JR. Advances in single cell technologies in immunology. BioTechniques. 2020;69(3):226–36.10.2144/btn-2020-0047Search in Google Scholar PubMed

[33] Kumar MP, Du J, Lagoudas G, Jiao Y, Sawyer A, Drummond DC, et al. Analysis of single-cell RNa-seq identifies cell-cell communication associated with tumor characteristics. Cell Rep. 2018;25(6):1458–68.e1454.10.1016/j.celrep.2018.10.047Search in Google Scholar PubMed PubMed Central

[34] Zhou J, Xiong W, Wang Y, Guan J. Protein function prediction based on PPI networks: network reconstruction vs edge enrichment. Front Genet. 2021;12:758131.10.3389/fgene.2021.758131Search in Google Scholar PubMed PubMed Central

[35] Peng B, Hu J, Fu X. ELANE: an emerging lane to selective anticancer therapy. Signal Transduct Target Ther. 2021;6(1):358.10.1038/s41392-021-00766-2Search in Google Scholar PubMed PubMed Central

[36] Xu JL, Guo Y. FCGR1A serves as a novel biomarker and correlates with immune infiltration in four cancer types. Front Mol Biosci. 2020;7:581615.10.3389/fmolb.2020.581615Search in Google Scholar PubMed PubMed Central

[37] Zhang L, Qiang J, Yang X, Wang D, Rehman AU, He X, et al. IL1R2 blockade suppresses breast tumorigenesis and progression by impairing USP15-dependent BMI1 stability. Adv Sci. 2020;7(1):1901728.10.1002/advs.201901728Search in Google Scholar PubMed PubMed Central

[38] Zhao E, Xie H, Zhang Y. Predicting diagnostic gene biomarkers associated with immune infiltration in patients with acute myocardial infarction. Front Cardiovasc Med. 2020;7:586871.10.3389/fcvm.2020.586871Search in Google Scholar PubMed PubMed Central

[39] Chen P, Chen G, Wang C, Mao C. RAB13 as a novel prognosis marker promotes proliferation and chemotherapeutic resistance in gastric cancer. Biochem Biophys Res Commun. 2019;519(1):113–20.10.1016/j.bbrc.2019.08.141Search in Google Scholar PubMed

[40] Whitehead GS, Hussain S, Fannin R, Trempus CS, Innes CL, Schurman SH, et al. TLR5 activation exacerbates airway inflammation in asthma. Lung. 2020;198(2):289–98.10.1007/s00408-020-00337-2Search in Google Scholar PubMed PubMed Central

[41] Lu L, Wei R, Prats-Ejarque G, Goetz M, Wang G, Torrent M, et al. Human RNase3 immune modulation by catalytic-dependent and independent modes in a macrophage-cell line infection model. Cell Mol Life Sci. 2021;78(6):2963–85.10.1007/s00018-020-03695-5Search in Google Scholar PubMed PubMed Central

Received: 2024-05-22
Revised: 2024-10-10
Accepted: 2024-10-14
Published Online: 2024-11-26

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Constitutive and evoked release of ATP in adult mouse olfactory epithelium
  3. LARP1 knockdown inhibits cultured gastric carcinoma cell cycle progression and metastatic behavior
  4. PEGylated porcine–human recombinant uricase: A novel fusion protein with improved efficacy and safety for the treatment of hyperuricemia and renal complications
  5. Research progress on ocular complications caused by type 2 diabetes mellitus and the function of tears and blepharons
  6. The role and mechanism of esketamine in preventing and treating remifentanil-induced hyperalgesia based on the NMDA receptor–CaMKII pathway
  7. Brucella infection combined with Nocardia infection: A case report and literature review
  8. Detection of serum interleukin-18 level and neutrophil/lymphocyte ratio in patients with antineutrophil cytoplasmic antibody-associated vasculitis and its clinical significance
  9. Ang-1, Ang-2, and Tie2 are diagnostic biomarkers for Henoch-Schönlein purpura and pediatric-onset systemic lupus erythematous
  10. PTTG1 induces pancreatic cancer cell proliferation and promotes aerobic glycolysis by regulating c-myc
  11. Role of serum B-cell-activating factor and interleukin-17 as biomarkers in the classification of interstitial pneumonia with autoimmune features
  12. Effectiveness and safety of a mumps containing vaccine in preventing laboratory-confirmed mumps cases from 2002 to 2017: A meta-analysis
  13. Low levels of sex hormone-binding globulin predict an increased breast cancer risk and its underlying molecular mechanisms
  14. A case of Trousseau syndrome: Screening, detection and complication
  15. Application of the integrated airway humidification device enhances the humidification effect of the rabbit tracheotomy model
  16. Preparation of Cu2+/TA/HAP composite coating with anti-bacterial and osteogenic potential on 3D-printed porous Ti alloy scaffolds for orthopedic applications
  17. Aquaporin-8 promotes human dermal fibroblasts to counteract hydrogen peroxide-induced oxidative damage: A novel target for management of skin aging
  18. Current research and evidence gaps on placental development in iron deficiency anemia
  19. Single-nucleotide polymorphism rs2910829 in PDE4D is related to stroke susceptibility in Chinese populations: The results of a meta-analysis
  20. Pheochromocytoma-induced myocardial infarction: A case report
  21. Kaempferol regulates apoptosis and migration of neural stem cells to attenuate cerebral infarction by O‐GlcNAcylation of β-catenin
  22. Sirtuin 5 regulates acute myeloid leukemia cell viability and apoptosis by succinylation modification of glycine decarboxylase
  23. Apigenin 7-glucoside impedes hypoxia-induced malignant phenotypes of cervical cancer cells in a p16-dependent manner
  24. KAT2A changes the function of endometrial stromal cells via regulating the succinylation of ENO1
  25. Current state of research on copper complexes in the treatment of breast cancer
  26. Exploring antioxidant strategies in the pathogenesis of ALS
  27. Helicobacter pylori causes gastric dysbacteriosis in chronic gastritis patients
  28. IL-33/soluble ST2 axis is associated with radiation-induced cardiac injury
  29. The predictive value of serum NLR, SII, and OPNI for lymph node metastasis in breast cancer patients with internal mammary lymph nodes after thoracoscopic surgery
  30. Carrying SNP rs17506395 (T > G) in TP63 gene and CCR5Δ32 mutation associated with the occurrence of breast cancer in Burkina Faso
  31. P2X7 receptor: A receptor closely linked with sepsis-associated encephalopathy
  32. Probiotics for inflammatory bowel disease: Is there sufficient evidence?
  33. Identification of KDM4C as a gene conferring drug resistance in multiple myeloma
  34. Microbial perspective on the skin–gut axis and atopic dermatitis
  35. Thymosin α1 combined with XELOX improves immune function and reduces serum tumor markers in colorectal cancer patients after radical surgery
  36. Highly specific vaginal microbiome signature for gynecological cancers
  37. Sample size estimation for AQP4-IgG seropositive optic neuritis: Retinal damage detection by optical coherence tomography
  38. The effects of SDF-1 combined application with VEGF on femoral distraction osteogenesis in rats
  39. Fabrication and characterization of gold nanoparticles using alginate: In vitro and in vivo assessment of its administration effects with swimming exercise on diabetic rats
  40. Mitigating digestive disorders: Action mechanisms of Mediterranean herbal active compounds
  41. Distribution of CYP2D6 and CYP2C19 gene polymorphisms in Han and Uygur populations with breast cancer in Xinjiang, China
  42. VSP-2 attenuates secretion of inflammatory cytokines induced by LPS in BV2 cells by mediating the PPARγ/NF-κB signaling pathway
  43. Factors influencing spontaneous hypothermia after emergency trauma and the construction of a predictive model
  44. Long-term administration of morphine specifically alters the level of protein expression in different brain regions and affects the redox state
  45. Application of metagenomic next-generation sequencing technology in the etiological diagnosis of peritoneal dialysis-associated peritonitis
  46. Clinical diagnosis, prevention, and treatment of neurodyspepsia syndrome using intelligent medicine
  47. Case report: Successful bronchoscopic interventional treatment of endobronchial leiomyomas
  48. Preliminary investigation into the genetic etiology of short stature in children through whole exon sequencing of the core family
  49. Cystic adenomyoma of the uterus: Case report and literature review
  50. Mesoporous silica nanoparticles as a drug delivery mechanism
  51. Dynamic changes in autophagy activity in different degrees of pulmonary fibrosis in mice
  52. Vitamin D deficiency and inflammatory markers in type 2 diabetes: Big data insights
  53. Lactate-induced IGF1R protein lactylation promotes proliferation and metabolic reprogramming of lung cancer cells
  54. Meta-analysis on the efficacy of allogeneic hematopoietic stem cell transplantation to treat malignant lymphoma
  55. Mitochondrial DNA drives neuroinflammation through the cGAS-IFN signaling pathway in the spinal cord of neuropathic pain mice
  56. Application value of artificial intelligence algorithm-based magnetic resonance multi-sequence imaging in staging diagnosis of cervical cancer
  57. Embedded monitoring system and teaching of artificial intelligence online drug component recognition
  58. Investigation into the association of FNDC1 and ADAMTS12 gene expression with plumage coloration in Muscovy ducks
  59. Yak meat content in feed and its impact on the growth of rats
  60. A rare case of Richter transformation with breast involvement: A case report and literature review
  61. First report of Nocardia wallacei infection in an immunocompetent patient in Zhejiang province
  62. Rhodococcus equi and Brucella pulmonary mass in immunocompetent: A case report and literature review
  63. Downregulation of RIP3 ameliorates the left ventricular mechanics and function after myocardial infarction via modulating NF-κB/NLRP3 pathway
  64. Evaluation of the role of some non-enzymatic antioxidants among Iraqi patients with non-alcoholic fatty liver disease
  65. The role of Phafin proteins in cell signaling pathways and diseases
  66. Ten-year anemia as initial manifestation of Castleman disease in the abdominal cavity: A case report
  67. Coexistence of hereditary spherocytosis with SPTB P.Trp1150 gene variant and Gilbert syndrome: A case report and literature review
  68. Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells
  69. Exploratory evaluation supported by experimental and modeling approaches of Inula viscosa root extract as a potent corrosion inhibitor for mild steel in a 1 M HCl solution
  70. Imaging manifestations of ductal adenoma of the breast: A case report
  71. Gut microbiota and sleep: Interaction mechanisms and therapeutic prospects
  72. Isomangiferin promotes the migration and osteogenic differentiation of rat bone marrow mesenchymal stem cells
  73. Prognostic value and microenvironmental crosstalk of exosome-related signatures in human epidermal growth factor receptor 2 positive breast cancer
  74. Circular RNAs as potential biomarkers for male severe sepsis
  75. Knockdown of Stanniocalcin-1 inhibits growth and glycolysis in oral squamous cell carcinoma cells
  76. The expression and biological role of complement C1s in esophageal squamous cell carcinoma
  77. A novel GNAS mutation in pseudohypoparathyroidism type 1a with articular flexion deformity: A case report
  78. Predictive value of serum magnesium levels for prognosis in patients with non-small cell lung cancer undergoing EGFR-TKI therapy
  79. HSPB1 alleviates acute-on-chronic liver failure via the P53/Bax pathway
  80. IgG4-related disease complicated by PLA2R-associated membranous nephropathy: A case report
  81. Baculovirus-mediated endostatin and angiostatin activation of autophagy through the AMPK/AKT/mTOR pathway inhibits angiogenesis in hepatocellular carcinoma
  82. Metformin mitigates osteoarthritis progression by modulating the PI3K/AKT/mTOR signaling pathway and enhancing chondrocyte autophagy
  83. Evaluation of the activity of antimicrobial peptides against bacterial vaginosis
  84. Atypical presentation of γ/δ mycosis fungoides with an unusual phenotype and SOCS1 mutation
  85. Analysis of the microecological mechanism of diabetic kidney disease based on the theory of “gut–kidney axis”: A systematic review
  86. Omega-3 fatty acids prevent gestational diabetes mellitus via modulation of lipid metabolism
  87. Refractory hypertension complicated with Turner syndrome: A case report
  88. Interaction of ncRNAs and the PI3K/AKT/mTOR pathway: Implications for osteosarcoma
  89. Association of low attenuation area scores with pulmonary function and clinical prognosis in patients with chronic obstructive pulmonary disease
  90. Long non-coding RNAs in bone formation: Key regulators and therapeutic prospects
  91. The deubiquitinating enzyme USP35 regulates the stability of NRF2 protein
  92. Neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio as potential diagnostic markers for rebleeding in patients with esophagogastric variceal bleeding
  93. G protein-coupled receptor 1 participating in the mechanism of mediating gestational diabetes mellitus by phosphorylating the AKT pathway
  94. LL37-mtDNA regulates viability, apoptosis, inflammation, and autophagy in lipopolysaccharide-treated RLE-6TN cells by targeting Hsp90aa1
  95. The analgesic effect of paeoniflorin: A focused review
  96. Chemical composition’s effect on Solanum nigrum Linn.’s antioxidant capacity and erythrocyte protection: Bioactive components and molecular docking analysis
  97. Knockdown of HCK promotes HREC cell viability and inner blood–retinal barrier integrity by regulating the AMPK signaling pathway
  98. The role of rapamycin in the PINK1/Parkin signaling pathway in mitophagy in podocytes
  99. Laryngeal non-Hodgkin lymphoma: Report of four cases and review of the literature
  100. Clinical value of macrogenome next-generation sequencing on infections
  101. Overview of dendritic cells and related pathways in autoimmune uveitis
  102. TAK-242 alleviates diabetic cardiomyopathy via inhibiting pyroptosis and TLR4/CaMKII/NLRP3 pathway
  103. Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
  104. Profile and antimicrobial susceptibility patterns of bacteria isolated from effluents of Kolladiba and Debark hospitals
  105. The expression and clinical significance of syncytin-1 in serum exosomes of hepatocellular carcinoma patients
  106. A histomorphometric study to evaluate the therapeutic effects of biosynthesized silver nanoparticles on the kidneys infected with Plasmodium chabaudi
  107. PGRMC1 and PAQR4 are promising molecular targets for a rare subtype of ovarian cancer
  108. Analysis of MDA, SOD, TAOC, MNCV, SNCV, and TSS scores in patients with diabetes peripheral neuropathy
  109. SLIT3 deficiency promotes non-small cell lung cancer progression by modulating UBE2C/WNT signaling
  110. The relationship between TMCO1 and CALR in the pathological characteristics of prostate cancer and its effect on the metastasis of prostate cancer cells
  111. Heterogeneous nuclear ribonucleoprotein K is a potential target for enhancing the chemosensitivity of nasopharyngeal carcinoma
  112. PHB2 alleviates retinal pigment epithelium cell fibrosis by suppressing the AGE–RAGE pathway
  113. Anti-γ-aminobutyric acid-B receptor autoimmune encephalitis with syncope as the initial symptom: Case report and literature review
  114. Comparative analysis of chloroplast genome of Lonicera japonica cv. Damaohua
  115. Human umbilical cord mesenchymal stem cells regulate glutathione metabolism depending on the ERK–Nrf2–HO-1 signal pathway to repair phosphoramide mustard-induced ovarian cancer cells
  116. Electroacupuncture on GB acupoints improves osteoporosis via the estradiol–PI3K–Akt signaling pathway
  117. Renalase protects against podocyte injury by inhibiting oxidative stress and apoptosis in diabetic nephropathy
  118. Review: Dicranostigma leptopodum: A peculiar plant of Papaveraceae
  119. Combination effect of flavonoids attenuates lung cancer cell proliferation by inhibiting the STAT3 and FAK signaling pathway
  120. Renal microangiopathy and immune complex glomerulonephritis induced by anti-tumour agents: A case report
  121. Correlation analysis of AVPR1a and AVPR2 with abnormal water and sodium and potassium metabolism in rats
  122. Gastrointestinal health anti-diarrheal mixture relieves spleen deficiency-induced diarrhea through regulating gut microbiota
  123. Myriad factors and pathways influencing tumor radiotherapy resistance
  124. Exploring the effects of culture conditions on Yapsin (YPS) gene expression in Nakaseomyces glabratus
  125. Screening of prognostic core genes based on cell–cell interaction in the peripheral blood of patients with sepsis
  126. Coagulation factor II thrombin receptor as a promising biomarker in breast cancer management
  127. Ileocecal mucinous carcinoma misdiagnosed as incarcerated hernia: A case report
  128. Methyltransferase like 13 promotes malignant behaviors of bladder cancer cells through targeting PI3K/ATK signaling pathway
  129. The debate between electricity and heat, efficacy and safety of irreversible electroporation and radiofrequency ablation in the treatment of liver cancer: A meta-analysis
  130. ZAG promotes colorectal cancer cell proliferation and epithelial–mesenchymal transition by promoting lipid synthesis
  131. Baicalein inhibits NLRP3 inflammasome activation and mitigates placental inflammation and oxidative stress in gestational diabetes mellitus
  132. Impact of SWCNT-conjugated senna leaf extract on breast cancer cells: A potential apoptotic therapeutic strategy
  133. MFAP5 inhibits the malignant progression of endometrial cancer cells in vitro
  134. Major ozonated autohemotherapy promoted functional recovery following spinal cord injury in adult rats via the inhibition of oxidative stress and inflammation
  135. Axodendritic targeting of TAU and MAP2 and microtubule polarization in iPSC-derived versus SH-SY5Y-derived human neurons
  136. Differential expression of phosphoinositide 3-kinase/protein kinase B and Toll-like receptor/nuclear factor kappa B signaling pathways in experimental obesity Wistar rat model
  137. The therapeutic potential of targeting Oncostatin M and the interleukin-6 family in retinal diseases: A comprehensive review
  138. BA inhibits LPS-stimulated inflammatory response and apoptosis in human middle ear epithelial cells by regulating the Nf-Kb/Iκbα axis
  139. Role of circRMRP and circRPL27 in chronic obstructive pulmonary disease
  140. Investigating the role of hyperexpressed HCN1 in inducing myocardial infarction through activation of the NF-κB signaling pathway
  141. Characterization of phenolic compounds and evaluation of anti-diabetic potential in Cannabis sativa L. seeds: In vivo, in vitro, and in silico studies
  142. Quantitative immunohistochemistry analysis of breast Ki67 based on artificial intelligence
  143. Ecology and Environmental Science
  144. Screening of different growth conditions of Bacillus subtilis isolated from membrane-less microbial fuel cell toward antimicrobial activity profiling
  145. Degradation of a mixture of 13 polycyclic aromatic hydrocarbons by commercial effective microorganisms
  146. Evaluation of the impact of two citrus plants on the variation of Panonychus citri (Acari: Tetranychidae) and beneficial phytoseiid mites
  147. Prediction of present and future distribution areas of Juniperus drupacea Labill and determination of ethnobotany properties in Antalya Province, Türkiye
  148. Population genetics of Todarodes pacificus (Cephalopoda: Ommastrephidae) in the northwest Pacific Ocean via GBS sequencing
  149. A comparative analysis of dendrometric, macromorphological, and micromorphological characteristics of Pistacia atlantica subsp. atlantica and Pistacia terebinthus in the middle Atlas region of Morocco
  150. Macrofungal sporocarp community in the lichen Scots pine forests
  151. Assessing the proximate compositions of indigenous forage species in Yemen’s pastoral rangelands
  152. Food Science
  153. Gut microbiota changes associated with low-carbohydrate diet intervention for obesity
  154. Reexamination of Aspergillus cristatus phylogeny in dark tea: Characteristics of the mitochondrial genome
  155. Differences in the flavonoid composition of the leaves, fruits, and branches of mulberry are distinguished based on a plant metabolomics approach
  156. Investigating the impact of wet rendering (solventless method) on PUFA-rich oil from catfish (Clarias magur) viscera
  157. Non-linear associations between cardiovascular metabolic indices and metabolic-associated fatty liver disease: A cross-sectional study in the US population (2017–2020)
  158. Knockdown of USP7 alleviates atherosclerosis in ApoE-deficient mice by regulating EZH2 expression
  159. Utility of dairy microbiome as a tool for authentication and traceability
  160. Agriculture
  161. Enhancing faba bean (Vicia faba L.) productivity through establishing the area-specific fertilizer rate recommendation in southwest Ethiopia
  162. Impact of novel herbicide based on synthetic auxins and ALS inhibitor on weed control
  163. Perspectives of pteridophytes microbiome for bioremediation in agricultural applications
  164. Fertilizer application parameters for drip-irrigated peanut based on the fertilizer effect function established from a “3414” field trial
  165. Improving the productivity and profitability of maize (Zea mays L.) using optimum blended inorganic fertilization
  166. Application of leaf multispectral analyzer in comparison to hyperspectral device to assess the diversity of spectral reflectance indices in wheat genotypes
  167. Animal Sciences
  168. Knockdown of ANP32E inhibits colorectal cancer cell growth and glycolysis by regulating the AKT/mTOR pathway
  169. Development of a detection chip for major pathogenic drug-resistant genes and drug targets in bovine respiratory system diseases
  170. Exploration of the genetic influence of MYOT and MB genes on the plumage coloration of Muscovy ducks
  171. Transcriptome analysis of adipose tissue in grazing cattle: Identifying key regulators of fat metabolism
  172. Comparison of nutritional value of the wild and cultivated spiny loaches at three growth stages
  173. Transcriptomic analysis of liver immune response in Chinese spiny frog (Quasipaa spinosa) infected with Proteus mirabilis
  174. Disruption of BCAA degradation is a critical characteristic of diabetic cardiomyopathy revealed by integrated transcriptome and metabolome analysis
  175. Plant Sciences
  176. Effect of long-term in-row branch covering on soil microorganisms in pear orchards
  177. Photosynthetic physiological characteristics, growth performance, and element concentrations reveal the calcicole–calcifuge behaviors of three Camellia species
  178. Transcriptome analysis reveals the mechanism of NaHCO3 promoting tobacco leaf maturation
  179. Bioinformatics, expression analysis, and functional verification of allene oxide synthase gene HvnAOS1 and HvnAOS2 in qingke
  180. Water, nitrogen, and phosphorus coupling improves gray jujube fruit quality and yield
  181. Improving grape fruit quality through soil conditioner: Insights from RNA-seq analysis of Cabernet Sauvignon roots
  182. Role of Embinin in the reabsorption of nucleus pulposus in lumbar disc herniation: Promotion of nucleus pulposus neovascularization and apoptosis of nucleus pulposus cells
  183. Revealing the effects of amino acid, organic acid, and phytohormones on the germination of tomato seeds under salinity stress
  184. Combined effects of nitrogen fertilizer and biochar on the growth, yield, and quality of pepper
  185. Comprehensive phytochemical and toxicological analysis of Chenopodium ambrosioides (L.) fractions
  186. Impact of “3414” fertilization on the yield and quality of greenhouse tomatoes
  187. Exploring the coupling mode of water and fertilizer for improving growth, fruit quality, and yield of the pear in the arid region
  188. Metagenomic analysis of endophytic bacteria in seed potato (Solanum tuberosum)
  189. Antibacterial, antifungal, and phytochemical properties of Salsola kali ethanolic extract
  190. Exploring the hepatoprotective properties of citronellol: In vitro and in silico studies on ethanol-induced damage in HepG2 cells
  191. Enhanced osmotic dehydration of watermelon rind using honey–sucrose solutions: A study on pre-treatment efficacy and mass transfer kinetics
  192. Effects of exogenous 2,4-epibrassinolide on photosynthetic traits of 53 cowpea varieties under NaCl stress
  193. Comparative transcriptome analysis of maize (Zea mays L.) seedlings in response to copper stress
  194. An optimization method for measuring the stomata in cassava (Manihot esculenta Crantz) under multiple abiotic stresses
  195. Fosinopril inhibits Ang II-induced VSMC proliferation, phenotype transformation, migration, and oxidative stress through the TGF-β1/Smad signaling pathway
  196. Antioxidant and antimicrobial activities of Salsola imbricata methanolic extract and its phytochemical characterization
  197. Bioengineering and Biotechnology
  198. Absorbable calcium and phosphorus bioactive membranes promote bone marrow mesenchymal stem cells osteogenic differentiation for bone regeneration
  199. New advances in protein engineering for industrial applications: Key takeaways
  200. An overview of the production and use of Bacillus thuringiensis toxin
  201. Research progress of nanoparticles in diagnosis and treatment of hepatocellular carcinoma
  202. Bioelectrochemical biosensors for water quality assessment and wastewater monitoring
  203. PEI/MMNs@LNA-542 nanoparticles alleviate ICU-acquired weakness through targeted autophagy inhibition and mitochondrial protection
  204. Unleashing of cytotoxic effects of thymoquinone-bovine serum albumin nanoparticles on A549 lung cancer cells
  205. Erratum
  206. Erratum to “Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM”
  207. Erratum to “Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation”
  208. Retraction
  209. Retraction to “MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB”
  210. Retraction to “A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis”
  211. Special Issue on Advances in Neurodegenerative Disease Research and Treatment
  212. Transplantation of human neural stem cell prevents symptomatic motor behavior disability in a rat model of Parkinson’s disease
  213. Special Issue on Multi-omics
  214. Inflammasome complex genes with clinical relevance suggest potential as therapeutic targets for anti-tumor drugs in clear cell renal cell carcinoma
  215. Gastroesophageal varices in primary biliary cholangitis with anti-centromere antibody positivity: Early onset?
Downloaded on 26.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0999/html?lang=en
Scroll to top button