Home The influence of metallic ions from CoCr28Mo6 on the osteogenic differentiation and cytokine release of human osteoblasts
Article Open Access

The influence of metallic ions from CoCr28Mo6 on the osteogenic differentiation and cytokine release of human osteoblasts

  • A Jonitz-Heincke EMAIL logo , M Schröder , D Hansmann , S. Utzschneider , J.P. Kretzer and R. Bader
Published/Copyright: September 12, 2015
Download Article (PDF)
Become an author with De Gruyter Brill
Author Information Explore this Subject
Current Directions in Biomedical Engineering
From the journal Current Directions in Biomedical Engineering Volume 1 Issue 1

Abstract

Inflammatory reactions associated with osteolysis and implant loosening can be the result of generated CoCr particles and the simultaneous release of ions, which are the consequence of wear at the articulating surfaces of metallic implants. By now, there is little knowledge about the influence of CoCr ions on the viability of human osteoblasts (hOB).

Therefore, metallic ions were generated from solid CoCr28Mo6 alloys using electric potentials against hydrogen bridge electrodes. For the cell experiments, hOBs (n ≥ 4) in the third passage were used. Cells were cultured for 24 h before incubated with the generated ion solution in two different concentrations (100 µg/l and 500 µg/l in DMEM with 10 % FCS). Cells incubated without ions served as controls. After 48 h and 96 h cell viability was determined (WST-1 assay, live-dead-stainings). Additionally, gene expression levels of osteogenic markers and cytokines were analysed.

A significant increase of metabolic activity and vital cells could be shown for both ion concentrations. Gene expression of alkaline phosphatase and Col1 was highly induced after 96 h for 100 µg/l whereas Col1 protein was significantly reduced on both time points (48 h: p=0.008 (100 µg/l, 500 µg/l); 96 h: p=0,029 (500 µg/l)) compared to the control. Additionally, MMP1 expression was decreased after 48 h and 96 h. IL6 mRNA was concentration-dependent increased after 48 h whereas a significant decrease could be shown for the highest ion concentration (p=0.029). Compared to the lower ion concentration, IL8, MCP1 (p=0.029) and TNF mRNA were clearly reduced for the higher ion solution after 96 h. Our results suggest that ions from CoCr28Mo6 alloys have only marginal effects on osteoblast viability whereas Col1 expression is reduced and cytokine release is induced. In further studies, the effects of metallic ions and particles from CoCr28Mo6 on other cells will be examined.

Keywords: human osteoblasts; metal ions; CoCr28Mo6; differentiation; cytokines

1 Introduction

A standard technique for the treatment of degenerative injured joints is the artificial joint replacement with metallic endoprosthesis. Hereby, the aseptic loosening of implants is the most important complication in total joint replacement. Inflammation reactions to wear particles followed by osteolysis processes are the main reasons of implant failure [1]. In this context, metallic particles and ions from metal-on-metal prosthesis will be deposited in the periprosthetic tissue whereby cellular reactions will be induced. The release of pro-inflammatoric cytokines like IL6, TNF and MCP1 leads to the activation of bone resorbing osteoclasts [2]. Beside macrophages and osteoclasts, osteoblasts seem to be involved in osteolytic processes of the bone [3]. Therefore, the biocompatibility of metallic implant materials has to be considered as critical. Nevertheless, these materials tend to corrosion processes and ion release resulting in chemically active degradation products [4]. It is well known that, due to the binding of metallic ions to proteins, immunological reactions resulted in hypersensitivity [5] whereby a metal allergy could be supported. For this reason, it has been suggested that patients with metal allergy could have a shorter survival time of hip endoprosthesis [6].

As already mentioned, human osteoblasts are also involved in osteolytic processes after exposure to metallic wear particles. Hereby, the osteoblasts show a reduced collagen type 1 synthesis rate combined with a higher apoptosis rate and cytokine release [3]. So far, there is little known about the influence of metallic ions of CoCr28Mo6 alloys on human osteoblast. Therefore, we generated defined ion solutions of solid CoCr28Mo6 alloys for the exposure to human osteoblasts for analysing viability, bone formation activity and cytokine release.

2 Material and methods

2.1 Generation of metallic ions

Metallic ions were generated from solid CoCr28Mo6 alloys (ISO 5832-12, ASTM F1537) using electric potentials against hydrogen bridge electrodes. Phosphate buffered saline (PBS) was used as surrounding solution. The solved content of all metallic ions were determined by ultratrace analysis and was 13.7 mg/l for Co, 4.3 mg/l for Cr, 0.8 mg/l for Mo and 1.7 mg/l for Ni. For the elimination of endotoxins, the ion solution was heat treated.

2.2 Isolation and cultivation of human osteoblasts

Human primary osteoblasts (female: n = 2, mean age 75.5 ±2.1 years; male: n = 4, mean age 64.5 ±3.7 years) were isolated under sterile conditions from bone marrow derived from femoral heads of patients undergoing primary hip replacements (Local Ethical Committee AZ: 2010-10) [3]. For the in vitro tests, human osteoblasts were transferred to 24-well plates with 10000 cells/well (in duplicates) in 1 ml culture medium (DMEM, Biochrom AG, Berlin, Germany) containing 10 % fetal calf serum (FCS, Gibco® Invitrogen, Paisly, UK), 1 % penicillin/streptomycin, 1 % amphotericin B and osteogenic additives (50 µg/ml L-ascorbate-2-phosphate, 10 mM -glycerophosphat, 100 mM dexamethasone (all: Sigma-Aldrich, Munich, Germany)). After 24 h of adherence, the medium was changed and cells were incubated with a) 100 µg/l ion solution, b) 500 µg/l ion solution (both: in complete medium) and c) unstimulated control for 48 h and 96 h under standard culture conditions.

2.3 Testing of cell viability

Viability of cells was determined using the metabolic activity test WST-1 (Roche, Penzberg, Germany). The test was performed both, after 48 h and 96 h. Therefore, the ion solutions were removed and cells were incubated with a defined volume of WST-1/medium reagent (ratio 1:10) at 37 °C and 5 % CO2 for 30 min. Afterwards, an aliquot of 100 µl was transferred to 96-well plates (in duplicates) to determine the absorption at 450 nm (reference: 630 nm) in a microplate reader (Dynex Technologies, Denkendorf, Germany).

In addition, a live-dead staining (Invitrogen) was carried out to distinguish between vital and dead cells. The staining reagent contains two fluorescence dyes (calcein AM and ethidium homodimer 1). As calcein is membrane-impermeable, it will remain into intact cells, which therefore fluorescent green (ex/em 495/515 nm). Ethidium homodimer enters damaged cells and binds at DNA resulting in a red fluorescent (ex/em 495/635 nm). Both dyes were dissolved in PBS. Afterwards, cells were incubated at room temperature in the dark. Cells were examined under a fluorescence microscope (Nikon ECLIPSE TS100, Nikon GmbH, Duesseldorf, Germany).

2.4 Gene expression analysis

2.4.1 RNA extraction and cDNA synthesis

Isolation of RNA was carried out using the Direct-zol Kit (Zymo Research, Freiburg, Germany) which combines a trizol treatment of cells and afterwards column purification of RNA probes according to the supplier’s recommendations. For cDNA synthesis, the High Capacity cDNA Kit (Applied Biosystems, Forster City, US) was used according to the manufacturer‘s instructions.

2.4.2 Quantitative real-time PCR (qRT PCR)

Relative quantification of target cDNA levels was done by qRT PCR (qTOWER 2.0, Analytik Jena, Jena, Germany) using the innuMIX qPCR MasterMix SyGreen (Analytik Jena) and the primers (Sigma-Aldrich) described in Table 1. Following the instructions of the manufacturer, PCR was performed under the following conditions: 95 °C for 2 min, 40 cycles of 95 °C for 5 sec and 65 °C for 25 sec. The reactions were done as duplicates. Relative expression of each mRNA compared with HPRT was calculated to the equation ΔCt=Cttarget-CtHPRT. The relative amount of target mRNA in unstimulated cells and treated cells was expressed as 2−(ΔΔCt), where ΔΔCttreatment = ΔCtgene-ΔCtcontrol.

Table 1

cDNA primers for qRT PCR

PrimerSequence 5’-3’ forward reverse
collagen type 1 (Col1)acgaagacatcccaccaatc
agatcacgtcatcgcacaac
alkaline phosphatase (ALP)cattgtgaccaccacgagag
ccatgatcacgtcaatgtcc
osteocalcin (OC)ggtgcagcctttgtgtcc
tcagccaactcgtcacagtc
matrix metalloproteinase 1 (MMP1)agagcagatgtggaccatgc
tcccgatgatctcccctgac
tissue inhibitor of metallo-proteinase 1 (TIMP1)attgctggaaaactgcaggatg
gtccacaagcaatgagtgcc
interleukin 6 (IL6)tggattcaatgaggagacttgcc
ctggcatttgtggttgggtc
interleukin 8 (IL8)tctgtgtgaaggtgcagttttg
atttctgtgttggcgcagtg
monocyte chemotactic protein 1 (MCP1)ccgagaggctgagactaacc
ggcattgattgcatctggctg
tumour necrosis factor α (TNF α)gttgtagcaaaccctcaagctg
gaggtacaggccctctgatg
hypoxanthine-guanine phosphoribosyltransferase (HPRT)ccctggcgtcgtgattagtg
tcgagcaagacgttcagtcc

2.5 Pro-collagen type 1 synthesis

The synthesis rate of pro-collagen type 1 protein was determined using an enzyme-linked immunosorbent assay (ELISA) (C1CP, Quidel, Marburg, Germany). Therefore, supernatants of each stimulation experiment were collected and stored at −20 °C. The test procedure was done according to the manufacturer instructions. Absorbance was analysed at 405 nm using a microplate reader (Dynex Technologies). Afterwards, the total protein content was relativised to DNA content. For this purpose, DNA of cells was isolated using the peqGOLD Tissue DNA Kit (Peqlab, Erlangen, Germany) according to the manufacturer’s instructions.

Figure 1 Live-dead staining of human osteoblasts after 96 h of incubation with metallic ions or in DMEM only (unstimulated control). Green=vital cells; red=dead cells; bar=50 µm)
Figure 1

Live-dead staining of human osteoblasts after 96 h of incubation with metallic ions or in DMEM only (unstimulated control). Green=vital cells; red=dead cells; bar=50 µm)

3 Results

3.1 Viability of human osteoblasts

Viability of human osteoblasts was not significantly influenced by metallic ions. More importantly, there was a significant increase of metabolic activity for each stimulation experiment from 48 h to 96 h (100 µg/l: 2-fold, p=0.03; 500 µg/l: 2.4-fold, p=0.017; control: 1.8-fold; p=0.03). Additionally, live-dead staining of cells revealed a clearly rise in cell number. Hereby, more vital cells could be shown after treatment with both ion solutions compared to the unstimulated control after 96 h (Figure 1).

3.2 Influence of metallic ions on bone remodelling

Gene expression of collagen type 1 (Col1), alkaline phosphatase (ALP) and osteocalcin (ALP) was not induced in human osteoblast after the treatment with metallic ions after 48 h compared to the unstimulated control. After 96 h, a non-significant increase of gene expression levels could be determined for Col1 (100 µg/l: 4-fold; 500 µg/l: 2-fold) and ALP (100 µg/l: 2-fold; 500 µg/l: 1.5-fold) for both ion concentrations. Concerning the protein synthesis rate of Col1, a significant reduction of protein content was visible for the lower ion concentration after 48 h (0.45-fold, p=0.008) and for the higher ion concentration at both time points (48 h: 0.43-fold, p=0.008; 96 h: 0.5-fold, p=0.029) compared to the unstimulated control.

Additionally, we analysed the mRNA expression rate of MMP1 and its natural antagonist TIMP1. For MMP1, mRNA levels were decreased at both time points for iontreated cells compared to unstimulated ones (100 µg/l: 0.36-fold (48 h) and 0.44-fold, p=0.029 (96 h); 500 µg/l: 0.58-fold (48 h); 500 µg/l: 0.68-fold (96 h). For TIMP1, similar expression rates could be determined for both ion concentrations as well as time points compared to unstimulated cells.

3.3 Cytokine release

We analysed mRNA levels of different cytokines after the treatment with CoCr ions. After 48 h of incubation, there was a non-significant increase of IL6 gene expression for both ion concentrations (100 µg/l: 1.9-fold; 500 µg/l: 2.7-fold). For IL8, MCP1 and TNF, no differences in expression levels compared to unstimulated cells could be shown. After 96 h, an increase of IL6 mRNA (3.2-fold, p=0.029), TNF mRNA (2.2-fold, p=0.029) and MCP1 mRNA (1.9-fold) were detected for the lower ion concentration (Fig. 3). Incubating with 500 µg/l ion solution resulted in a significant reduced IL6 expression rate (p=0.029 compared to 100 µg/l) as well as IL8 (p=0.029), MCP1 (p=0.029 compared to 100 µg/l) and TNF gene expression (Figure 2).

Figure 2 Gene expression analysis of human osteoblasts stimulated with 100 µg/l and 500 µg/l CoCr ion solutions in relation to unstimulated cells after 96 h. Data are shown as median ±min/max. Significances between stimulated and unstimulated groups (#p<0.05) as well as between both ion concentrations (*p<0.05) were analysed with the Mann-Whitney-U-Test.
Figure 2

Gene expression analysis of human osteoblasts stimulated with 100 µg/l and 500 µg/l CoCr ion solutions in relation to unstimulated cells after 96 h. Data are shown as median ±min/max. Significances between stimulated and unstimulated groups (#p<0.05) as well as between both ion concentrations (*p<0.05) were analysed with the Mann-Whitney-U-Test.

4 Discussion

Inflammatory reactions associated with osteolysis and implant loosening are the result of generated CoCr particles and the simultaneous release of ions. By now, there are some studies dealing with the influence of ions from Co-Cr-Mo to human osteocytes [7] and osteosarcoma cell lines like MG-63 [8]. In the present study, we used human primary osteoblasts, which were exposed to generated ion solutions from CoCr28Mo6 alloys. In joint puncture studies, concentrations of 200-250 µg/l of Co- and Cr-ions were measured in patients undergoing revision surgeries [9]. However, in preliminary experiments, we could not determine significant effects of the reported concentration in human osteoblasts. In contrast, concentrations of 100 µg/l and 500 µg/l had influence bone formation processes and cytokine release significantly. Thereby, the ion concentration of 100 µg/l induced an increase of IL6-, MCP1- and TNF -mRNA expression in human osteoblasts. Furthermore, a reduced Col1 protein expression after exposure to both concentrations was detected. Consequently, CoCr ions could have an inhibiting effect on matrix assembly and therefore, trigger osteolytic processes. Another characteristic of osteolysis is matrix degradation, caused e.g. by special proteinases like MMP1 [3]. Surprisingly, in this study, MMP1 mRNA was clearly decreased compared to unstimulated cells. This result suggests that human osteoblasts are only rarely involved in matrix reduction.

Our results suggest that CoCr ions have only marginal effects on the viability of human osteoblasts. Nevertheless bone formation is limited and cytokine release induced, especially in lower ion concentrations. In further studies, the effects of the generated metallic ion solutions on other cells (e.g. macrophages) will be examined.

Funding: This study was supported by the German Research Foundation (DFG).

A. Jonitz-Heincke: University Medicine Rostock, Department of Orthopaedics, Doberaner Straße 142, 18057 Ro-stock, Germany, phone: +49 (0)381 494 9306, fax: +49 (0)381 494 9308

Author's Statement

  1. Conflict of interest: Authors state no conflict of interest. Material and Methods: Informed consent: Informed consent has been obtained from all individuals included in this study. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance the tenets of the Helsinki Declaration, and has been approved by the authors’ institutional review board or equivalent committee.

References

[1] Purdue PE, Koulouvaris P, Potter HG, et al. The cellular and molecular biology of periprosthetic osteolysis. Clin Orthop Relat Res 2007: 251-261.10.1097/01.blo.0000238813.95035.1bSearch in Google Scholar PubMed

[2] Al-Saffar N, Revell PA. Pathology of the bone-implant interfaces. J Long Term Eff Med Implants 1999: 319-347.Search in Google Scholar

[3] Lochner K, Fritsche A, Jonitz A, et al. The potential role of human osteoblasts for periprosthetic osteolysis following exposure to wear particles. Int J Mol Med 2011: 1055-1063.10.3892/ijmm.2011.778Search in Google Scholar PubMed

[4] Jacobs JJ, Hallab NJ, Skipor AK, Urban RM. Metal degradation products: a cause for concern in metal-metal bearings? Clin Orthop Relat Res 2003: 139-147.10.1097/01.blo.0000096810.78689.62Search in Google Scholar

[5] Hallab NJ. Metal sensitivity in patients with orthopedic implants. J Clin Rheumatol 2001: 215-218.10.1097/00124743-200108000-00004Search in Google Scholar PubMed

[6] Granchi D, Cenni E, Trisolino G, et al. Sensitivity to implant materials in patients undergoing total hip replacement. J Biomed Mater Res B Appl Biomater 2006: 257-264.10.1002/jbm.b.30445Search in Google Scholar PubMed

[7] Kanaji A, Orhue V, Caiedo MS, et al. Cytotoxic effects of cobalt and nickel ions on osteocytes in vitro. J Orthop Surg Res 2014: 9:91.10.1186/s13018-014-0091-6Search in Google Scholar PubMed PubMed Central

[8] Hallab NJ, Anderson S, Caicedo M, et al. Effects of soluble metals on human peri-implant cells. J Biomed Mater Res A 2005: 124-140.10.1002/jbm.a.30345Search in Google Scholar PubMed

[9] De Smet K, De Haan R, Calistri A, et al. Metal ion measurement as a diagnostic tool to indent problems with metal-on-metal hip resurfacing. J Bone Joint Surg Am 2008: 202-208.10.2106/JBJS.H.00672Search in Google Scholar PubMed

Published Online: 2015-9-12
Published in Print: 2015-9-1

© 2015 by Walter de Gruyter GmbH, Berlin/Boston

This article is distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Articles in the same Issue

  1. Research Article
  2. Development and characterization of superparamagnetic coatings
  3. Research Article
  4. The development of an experimental setup to measure acousto-electric interaction signal
  5. Research Article
  6. Stability analysis of ferrofluids
  7. Research Article
  8. Investigation of endothelial growth using a sensors-integrated microfluidic system to simulate physiological barriers
  9. Research Article
  10. Energy harvesting for active implants: powering a ruminal pH-monitoring system
  11. Research Article
  12. New type of fluxgate magnetometer for the heart’s magnetic fields detection
  13. Research Article
  14. Field mapping of ballistic pressure pulse sources
  15. Research Article
  16. Development of a new homecare sleep monitor using body sounds and motion tracking
  17. Research Article
  18. Noise properties of textile, capacitive EEG electrodes
  19. Research Article
  20. Detecting phase singularities and rotor center trajectories based on the Hilbert transform of intraatrial electrograms in an atrial voxel model
  21. Research Article
  22. Spike sorting: the overlapping spikes challenge
  23. Research Article
  24. Separating the effect of respiration from the heart rate variability for cases of constant harmonic breathing
  25. Research Article
  26. Locating regions of arrhythmogenic substrate by analyzing the duration of triggered atrial activities
  27. Research Article
  28. Combining different ECG derived respiration tracking methods to create an optimal reconstruction of the breathing pattern
  29. Research Article
  30. Atrial and ventricular signal averaging electrocardiography in pacemaker and cardiac resynchronization therapy
  31. Research Article
  32. Estimation of a respiratory signal from a single-lead ECG using the 4th order central moments
  33. Research Article
  34. Compressed sensing of multi-lead ECG signals by compressive multiplexing
  35. Research Article
  36. Heart rate monitoring in ultra-high-field MRI using frequency information obtained from video signals of the human skin compared to electrocardiography and pulse oximetry
  37. Research Article
  38. Synchronization in wireless biomedical-sensor networks with Bluetooth Low Energy
  39. Research Article
  40. Automated classification of stages of anaesthesia by populations of evolutionary optimized fuzzy rules
  41. Research Article
  42. Effects of sampling rate on automated fatigue recognition in surface EMG signals
  43. Research Article
  44. Closed-loop transcranial alternating current stimulation of slow oscillations
  45. Research Article
  46. Cardiac index in atrio- and interventricular delay optimized cardiac resynchronization therapy and cardiac contractility modulation
  47. Research Article
  48. The role of expert evaluation for microsleep detection
  49. Research Article
  50. The impact of baseline wander removal techniques on the ST segment in simulated ischemic 12-lead ECGs
  51. Research Article
  52. Metal artifact reduction by projection replacements and non-local prior image integration
  53. Research Article
  54. A novel coaxial nozzle for in-process adjustment of electrospun scaffolds’ fiber diameter
  55. Research Article
  56. Processing of membranes for oxygenation using the Bellhouse-effect
  57. Research Article
  58. Inkjet printing of viable human dental follicle stem cells
  59. Research Article
  60. The use of an icebindingprotein out of the snowflea Hypogastrura harveyi as a cryoprotectant in the cryopreservation of mesenchymal stem cells
  61. Research Article
  62. New NIR spectroscopy based method to determine ischemia in vivo in liver – a first study on rats
  63. Research Article
  64. QRS and QT ventricular conduction times and permanent pacemaker therapy after transcatheter aortic valve implantation
  65. Research Article
  66. Adopting oculopressure tonometry as a transient in vivo rabbit glaucoma model
  67. Research Article
  68. Next-generation vision testing: the quick CSF
  69. Research Article
  70. Improving tactile sensation in laparoscopic surgery by overcoming size restrictions
  71. Research Article
  72. Design and control of a 3-DOF hydraulic driven surgical instrument
  73. Research Article
  74. Evaluation of endourological tools to improve the diagnosis and therapy of ureteral tumors – from model development to clinical application
  75. Research Article
  76. Frequency based assessment of surgical activities
  77. Research Article
  78. “Hands free for intervention”, a new approach for transoral endoscopic surgery
  79. Research Article
  80. Pseudo-haptic feedback in medical teleoperation
  81. Research Article
  82. Feasibility of interactive gesture control of a robotic microscope
  83. Research Article
  84. Towards structuring contextual information for workflow-driven surgical assistance functionalities
  85. Research Article
  86. Towards a framework for standardized semantic workflow modeling and management in the surgical domain
  87. Research Article
  88. Closed-loop approach for situation awareness of medical devices and operating room infrastructure
  89. Research Article
  90. Kinect based physiotherapy system for home use
  91. Research Article
  92. Evaluating the microsoft kinect skeleton joint tracking as a tool for home-based physiotherapy
  93. Research Article
  94. Integrating multimodal information for intraoperative assistance in neurosurgery
  95. Research Article
  96. Respiratory motion tracking using Microsoft’s Kinect v2 camera
  97. Research Article
  98. Using smart glasses for ultrasound diagnostics
  99. Research Article
  100. Measurement of needle susceptibility artifacts in magnetic resonance images
  101. Research Article
  102. Dimensionality reduction of medical image descriptors for multimodal image registration
  103. Research Article
  104. Experimental evaluation of different weighting schemes in magnetic particle imaging reconstruction
  105. Research Article
  106. Evaluation of CT capability for the detection of thin bone structures
  107. Research Article
  108. Towards contactless optical coherence elastography with acoustic tissue excitation
  109. Research Article
  110. Development and implementation of algorithms for automatic and robust measurement of the 2D:4D digit ratio using image data
  111. Research Article
  112. Automated high-throughput analysis of B cell spreading on immobilized antibodies with whole slide imaging
  113. Research Article
  114. Tissue segmentation from head MRI: a ground truth validation for feature-enhanced tracking
  115. Research Article
  116. Video tracking of swimming rodents on a reflective water surface
  117. Research Article
  118. MR imaging of model drug distribution in simulated vitreous
  119. Research Article
  120. Studying the extracellular contribution to the double wave vector diffusion-weighted signal
  121. Research Article
  122. Artifacts in field free line magnetic particle imaging in the presence of inhomogeneous and nonlinear magnetic fields
  123. Research Article
  124. Introducing a frequency-tunable magnetic particle spectrometer
  125. Research Article
  126. Imaging of aortic valve dynamics in 4D OCT
  127. Research Article
  128. Intravascular optical coherence tomography (OCT) as an additional tool for the assessment of stent structures
  129. Research Article
  130. Simple concept for a wide-field lensless digital holographic microscope using a laser diode
  131. Research Article
  132. Intraoperative identification of somato-sensory brain areas using optical imaging and standard RGB camera equipment – a feasibility study
  133. Research Article
  134. Respiratory surface motion measurement by Microsoft Kinect
  135. Research Article
  136. Improving image quality in EIT imaging by measurement of thorax excursion
  137. Research Article
  138. A clustering based dual model framework for EIT imaging: first experimental results
  139. Research Article
  140. Three-dimensional anisotropic regularization for limited angle tomography
  141. Research Article
  142. GPU-based real-time generation of large ultrasound volumes from freehand 3D sweeps
  143. Research Article
  144. Experimental computer tomograph
  145. Research Article
  146. US-tracked steered FUS in a respiratory ex vivo ovine liver phantom
  147. Research Article
  148. Contribution of brownian rotation and particle assembly polarisation to the particle response in magnetic particle spectrometry
  149. Research Article
  150. Preliminary investigations of magnetic modulated nanoparticles for microwave breast cancer detection
  151. Research Article
  152. Construction of a device for magnetic separation of superparamagnetic iron oxide nanoparticles
  153. Research Article
  154. An IHE-conform telecooperation platform supporting the treatment of dementia patients
  155. Research Article
  156. Automated respiratory therapy system based on the ARDSNet protocol with systemic perfusion control
  157. Research Article
  158. Identification of surgical instruments using UHF-RFID technology
  159. Research Article
  160. A generic concept for the development of model-guided clinical decision support systems
  161. Research Article
  162. Evaluation of local alterations in femoral bone mineral density measured via quantitative CT
  163. Research Article
  164. Creating 3D gelatin phantoms for experimental evaluation in biomedicine
  165. Research Article
  166. Influence of short-term fixation with mixed formalin or ethanol solution on the mechanical properties of human cortical bone
  167. Research Article
  168. Analysis of the release kinetics of surface-bound proteins via laser-induced fluorescence
  169. Research Article
  170. Tomographic particle image velocimetry of a water-jet for low volume harvesting of fat tissue for regenerative medicine
  171. Research Article
  172. Wireless medical sensors – context, robustness and safety
  173. Research Article
  174. Sequences for real-time magnetic particle imaging
  175. Research Article
  176. Speckle-based off-axis holographic detection for non-contact photoacoustic tomography
  177. Research Article
  178. A machine learning approach for planning valve-sparing aortic root reconstruction
  179. Research Article
  180. An in-ear pulse wave velocity measurement system using heart sounds as time reference
  181. Research Article
  182. Measuring different oxygenation levels in a blood perfusion model simulating the human head using NIRS
  183. Research Article
  184. Multisegmental fusion of the lumbar spine a curse or a blessing?
  185. Research Article
  186. Numerical analysis of the biomechanical complications accompanying the total hip replacement with NANOS-Prosthetic: bone remodelling and prosthesis migration
  187. Research Article
  188. A muscle model for hybrid muscle activation
  189. Research Article
  190. Mathematical, numerical and in-vitro investigation of cooling performance of an intra-carotid catheter for selective brain hypothermia
  191. Research Article
  192. An ideally parameterized unscented Kalman filter for the inverse problem of electrocardiography
  193. Research Article
  194. Interactive visualization of cardiac anatomy and atrial excitation for medical diagnosis and research
  195. Research Article
  196. Virtualizing clinical cases of atrial flutter in a fast marching simulation including conduction velocity and ablation scars
  197. Research Article
  198. Mesh structure-independent modeling of patient-specific atrial fiber orientation
  199. Research Article
  200. Accelerating mono-domain cardiac electrophysiology simulations using OpenCL
  201. Research Article
  202. Understanding the cellular mode of action of vernakalant using a computational model: answers and new questions
  203. Research Article
  204. A java based simulator with user interface to simulate ventilated patients
  205. Research Article
  206. Evaluation of an algorithm to choose between competing models of respiratory mechanics
  207. Research Article
  208. Numerical simulation of low-pulsation gerotor pumps for use in the pharmaceutical industry and in biomedicine
  209. Research Article
  210. Numerical and experimental flow analysis in centifluidic systems for rapid allergy screening tests
  211. Research Article
  212. Biomechanical parameter determination of scaffold-free cartilage constructs (SFCCs) with the hyperelastic material models Yeoh, Ogden and Demiray
  213. Research Article
  214. FPGA controlled artificial vascular system
  215. Research Article
  216. Simulation based investigation of source-detector configurations for non-invasive fetal pulse oximetry
  217. Research Article
  218. Test setup for characterizing the efficacy of embolic protection devices
  219. Research Article
  220. Impact of electrode geometry on force generation during functional electrical stimulation
  221. Research Article
  222. 3D-based visual physical activity assessment of children
  223. Research Article
  224. Realtime assessment of foot orientation by Accelerometers and Gyroscopes
  225. Research Article
  226. Image based reconstruction for cystoscopy
  227. Research Article
  228. Image guided surgery innovation with graduate students - a new lecture format
  229. Research Article
  230. Multichannel FES parameterization for controlling foot motion in paretic gait
  231. Research Article
  232. Smartphone supported upper limb prosthesis
  233. Research Article
  234. Use of quantitative tremor evaluation to enhance target selection during deep brain stimulation surgery for essential tremor
  235. Research Article
  236. Evaluation of adhesion promoters for Parylene C on gold metallization
  237. Research Article
  238. The influence of metallic ions from CoCr28Mo6 on the osteogenic differentiation and cytokine release of human osteoblasts
  239. Research Article
  240. Increasing the visibility of thin NITINOL vascular implants
  241. Research Article
  242. Possible reasons for early artificial bone failure in biomechanical tests of ankle arthrodesis systems
  243. Research Article
  244. Development of a bending test procedure for the characterization of flexible ECoG electrode arrays
  245. Research Article
  246. Tubular manipulators: a new concept for intracochlear positioning of an auditory prosthesis
  247. Research Article
  248. Investigation of the dynamic diameter deformation of vascular stents during fatigue testing with radial loading
  249. Research Article
  250. Electrospun vascular grafts with anti-kinking properties
  251. Research Article
  252. Integration of temperature sensors in polyimide-based thin-film electrode arrays
  253. Research Article
  254. Use cases and usability challenges for head-mounted displays in healthcare
  255. Research Article
  256. Device- and service profiles for integrated or systems based on open standards
  257. Research Article
  258. Risk management for medical devices in research projects
  259. Research Article
  260. Simulation of varying femoral attachment sites of medial patellofemoral ligament using a musculoskeletal multi-body model
  261. Research Article
  262. Does enhancing consciousness for strategic planning processes support the effectiveness of problem-based learning concepts in biomedical education?
  263. Research Article
  264. SPIO processing in macrophages for MPI: The breast cancer MPI-SNLB-concept
  265. Research Article
  266. Numerical simulations of airflow in the human pharynx of OSAHS patients
https://doi.org/10.1515/cdbme-2015-0119
Keywords for this article
human osteoblasts; metal ions; CoCr28Mo6; differentiation; cytokines
Creative Commons
BY-NC-ND 3.0

Articles in the same Issue

  1. Research Article
  2. Development and characterization of superparamagnetic coatings
  3. Research Article
  4. The development of an experimental setup to measure acousto-electric interaction signal
  5. Research Article
  6. Stability analysis of ferrofluids
  7. Research Article
  8. Investigation of endothelial growth using a sensors-integrated microfluidic system to simulate physiological barriers
  9. Research Article
  10. Energy harvesting for active implants: powering a ruminal pH-monitoring system
  11. Research Article
  12. New type of fluxgate magnetometer for the heart’s magnetic fields detection
  13. Research Article
  14. Field mapping of ballistic pressure pulse sources
  15. Research Article
  16. Development of a new homecare sleep monitor using body sounds and motion tracking
  17. Research Article
  18. Noise properties of textile, capacitive EEG electrodes
  19. Research Article
  20. Detecting phase singularities and rotor center trajectories based on the Hilbert transform of intraatrial electrograms in an atrial voxel model
  21. Research Article
  22. Spike sorting: the overlapping spikes challenge
  23. Research Article
  24. Separating the effect of respiration from the heart rate variability for cases of constant harmonic breathing
  25. Research Article
  26. Locating regions of arrhythmogenic substrate by analyzing the duration of triggered atrial activities
  27. Research Article
  28. Combining different ECG derived respiration tracking methods to create an optimal reconstruction of the breathing pattern
  29. Research Article
  30. Atrial and ventricular signal averaging electrocardiography in pacemaker and cardiac resynchronization therapy
  31. Research Article
  32. Estimation of a respiratory signal from a single-lead ECG using the 4th order central moments
  33. Research Article
  34. Compressed sensing of multi-lead ECG signals by compressive multiplexing
  35. Research Article
  36. Heart rate monitoring in ultra-high-field MRI using frequency information obtained from video signals of the human skin compared to electrocardiography and pulse oximetry
  37. Research Article
  38. Synchronization in wireless biomedical-sensor networks with Bluetooth Low Energy
  39. Research Article
  40. Automated classification of stages of anaesthesia by populations of evolutionary optimized fuzzy rules
  41. Research Article
  42. Effects of sampling rate on automated fatigue recognition in surface EMG signals
  43. Research Article
  44. Closed-loop transcranial alternating current stimulation of slow oscillations
  45. Research Article
  46. Cardiac index in atrio- and interventricular delay optimized cardiac resynchronization therapy and cardiac contractility modulation
  47. Research Article
  48. The role of expert evaluation for microsleep detection
  49. Research Article
  50. The impact of baseline wander removal techniques on the ST segment in simulated ischemic 12-lead ECGs
  51. Research Article
  52. Metal artifact reduction by projection replacements and non-local prior image integration
  53. Research Article
  54. A novel coaxial nozzle for in-process adjustment of electrospun scaffolds’ fiber diameter
  55. Research Article
  56. Processing of membranes for oxygenation using the Bellhouse-effect
  57. Research Article
  58. Inkjet printing of viable human dental follicle stem cells
  59. Research Article
  60. The use of an icebindingprotein out of the snowflea Hypogastrura harveyi as a cryoprotectant in the cryopreservation of mesenchymal stem cells
  61. Research Article
  62. New NIR spectroscopy based method to determine ischemia in vivo in liver – a first study on rats
  63. Research Article
  64. QRS and QT ventricular conduction times and permanent pacemaker therapy after transcatheter aortic valve implantation
  65. Research Article
  66. Adopting oculopressure tonometry as a transient in vivo rabbit glaucoma model
  67. Research Article
  68. Next-generation vision testing: the quick CSF
  69. Research Article
  70. Improving tactile sensation in laparoscopic surgery by overcoming size restrictions
  71. Research Article
  72. Design and control of a 3-DOF hydraulic driven surgical instrument
  73. Research Article
  74. Evaluation of endourological tools to improve the diagnosis and therapy of ureteral tumors – from model development to clinical application
  75. Research Article
  76. Frequency based assessment of surgical activities
  77. Research Article
  78. “Hands free for intervention”, a new approach for transoral endoscopic surgery
  79. Research Article
  80. Pseudo-haptic feedback in medical teleoperation
  81. Research Article
  82. Feasibility of interactive gesture control of a robotic microscope
  83. Research Article
  84. Towards structuring contextual information for workflow-driven surgical assistance functionalities
  85. Research Article
  86. Towards a framework for standardized semantic workflow modeling and management in the surgical domain
  87. Research Article
  88. Closed-loop approach for situation awareness of medical devices and operating room infrastructure
  89. Research Article
  90. Kinect based physiotherapy system for home use
  91. Research Article
  92. Evaluating the microsoft kinect skeleton joint tracking as a tool for home-based physiotherapy
  93. Research Article
  94. Integrating multimodal information for intraoperative assistance in neurosurgery
  95. Research Article
  96. Respiratory motion tracking using Microsoft’s Kinect v2 camera
  97. Research Article
  98. Using smart glasses for ultrasound diagnostics
  99. Research Article
  100. Measurement of needle susceptibility artifacts in magnetic resonance images
  101. Research Article
  102. Dimensionality reduction of medical image descriptors for multimodal image registration
  103. Research Article
  104. Experimental evaluation of different weighting schemes in magnetic particle imaging reconstruction
  105. Research Article
  106. Evaluation of CT capability for the detection of thin bone structures
  107. Research Article
  108. Towards contactless optical coherence elastography with acoustic tissue excitation
  109. Research Article
  110. Development and implementation of algorithms for automatic and robust measurement of the 2D:4D digit ratio using image data
  111. Research Article
  112. Automated high-throughput analysis of B cell spreading on immobilized antibodies with whole slide imaging
  113. Research Article
  114. Tissue segmentation from head MRI: a ground truth validation for feature-enhanced tracking
  115. Research Article
  116. Video tracking of swimming rodents on a reflective water surface
  117. Research Article
  118. MR imaging of model drug distribution in simulated vitreous
  119. Research Article
  120. Studying the extracellular contribution to the double wave vector diffusion-weighted signal
  121. Research Article
  122. Artifacts in field free line magnetic particle imaging in the presence of inhomogeneous and nonlinear magnetic fields
  123. Research Article
  124. Introducing a frequency-tunable magnetic particle spectrometer
  125. Research Article
  126. Imaging of aortic valve dynamics in 4D OCT
  127. Research Article
  128. Intravascular optical coherence tomography (OCT) as an additional tool for the assessment of stent structures
  129. Research Article
  130. Simple concept for a wide-field lensless digital holographic microscope using a laser diode
  131. Research Article
  132. Intraoperative identification of somato-sensory brain areas using optical imaging and standard RGB camera equipment – a feasibility study
  133. Research Article
  134. Respiratory surface motion measurement by Microsoft Kinect
  135. Research Article
  136. Improving image quality in EIT imaging by measurement of thorax excursion
  137. Research Article
  138. A clustering based dual model framework for EIT imaging: first experimental results
  139. Research Article
  140. Three-dimensional anisotropic regularization for limited angle tomography
  141. Research Article
  142. GPU-based real-time generation of large ultrasound volumes from freehand 3D sweeps
  143. Research Article
  144. Experimental computer tomograph
  145. Research Article
  146. US-tracked steered FUS in a respiratory ex vivo ovine liver phantom
  147. Research Article
  148. Contribution of brownian rotation and particle assembly polarisation to the particle response in magnetic particle spectrometry
  149. Research Article
  150. Preliminary investigations of magnetic modulated nanoparticles for microwave breast cancer detection
  151. Research Article
  152. Construction of a device for magnetic separation of superparamagnetic iron oxide nanoparticles
  153. Research Article
  154. An IHE-conform telecooperation platform supporting the treatment of dementia patients
  155. Research Article
  156. Automated respiratory therapy system based on the ARDSNet protocol with systemic perfusion control
  157. Research Article
  158. Identification of surgical instruments using UHF-RFID technology
  159. Research Article
  160. A generic concept for the development of model-guided clinical decision support systems
  161. Research Article
  162. Evaluation of local alterations in femoral bone mineral density measured via quantitative CT
  163. Research Article
  164. Creating 3D gelatin phantoms for experimental evaluation in biomedicine
  165. Research Article
  166. Influence of short-term fixation with mixed formalin or ethanol solution on the mechanical properties of human cortical bone
  167. Research Article
  168. Analysis of the release kinetics of surface-bound proteins via laser-induced fluorescence
  169. Research Article
  170. Tomographic particle image velocimetry of a water-jet for low volume harvesting of fat tissue for regenerative medicine
  171. Research Article
  172. Wireless medical sensors – context, robustness and safety
  173. Research Article
  174. Sequences for real-time magnetic particle imaging
  175. Research Article
  176. Speckle-based off-axis holographic detection for non-contact photoacoustic tomography
  177. Research Article
  178. A machine learning approach for planning valve-sparing aortic root reconstruction
  179. Research Article
  180. An in-ear pulse wave velocity measurement system using heart sounds as time reference
  181. Research Article
  182. Measuring different oxygenation levels in a blood perfusion model simulating the human head using NIRS
  183. Research Article
  184. Multisegmental fusion of the lumbar spine a curse or a blessing?
  185. Research Article
  186. Numerical analysis of the biomechanical complications accompanying the total hip replacement with NANOS-Prosthetic: bone remodelling and prosthesis migration
  187. Research Article
  188. A muscle model for hybrid muscle activation
  189. Research Article
  190. Mathematical, numerical and in-vitro investigation of cooling performance of an intra-carotid catheter for selective brain hypothermia
  191. Research Article
  192. An ideally parameterized unscented Kalman filter for the inverse problem of electrocardiography
  193. Research Article
  194. Interactive visualization of cardiac anatomy and atrial excitation for medical diagnosis and research
  195. Research Article
  196. Virtualizing clinical cases of atrial flutter in a fast marching simulation including conduction velocity and ablation scars
  197. Research Article
  198. Mesh structure-independent modeling of patient-specific atrial fiber orientation
  199. Research Article
  200. Accelerating mono-domain cardiac electrophysiology simulations using OpenCL
  201. Research Article
  202. Understanding the cellular mode of action of vernakalant using a computational model: answers and new questions
  203. Research Article
  204. A java based simulator with user interface to simulate ventilated patients
  205. Research Article
  206. Evaluation of an algorithm to choose between competing models of respiratory mechanics
  207. Research Article
  208. Numerical simulation of low-pulsation gerotor pumps for use in the pharmaceutical industry and in biomedicine
  209. Research Article
  210. Numerical and experimental flow analysis in centifluidic systems for rapid allergy screening tests
  211. Research Article
  212. Biomechanical parameter determination of scaffold-free cartilage constructs (SFCCs) with the hyperelastic material models Yeoh, Ogden and Demiray
  213. Research Article
  214. FPGA controlled artificial vascular system
  215. Research Article
  216. Simulation based investigation of source-detector configurations for non-invasive fetal pulse oximetry
  217. Research Article
  218. Test setup for characterizing the efficacy of embolic protection devices
  219. Research Article
  220. Impact of electrode geometry on force generation during functional electrical stimulation
  221. Research Article
  222. 3D-based visual physical activity assessment of children
  223. Research Article
  224. Realtime assessment of foot orientation by Accelerometers and Gyroscopes
  225. Research Article
  226. Image based reconstruction for cystoscopy
  227. Research Article
  228. Image guided surgery innovation with graduate students - a new lecture format
  229. Research Article
  230. Multichannel FES parameterization for controlling foot motion in paretic gait
  231. Research Article
  232. Smartphone supported upper limb prosthesis
  233. Research Article
  234. Use of quantitative tremor evaluation to enhance target selection during deep brain stimulation surgery for essential tremor
  235. Research Article
  236. Evaluation of adhesion promoters for Parylene C on gold metallization
  237. Research Article
  238. The influence of metallic ions from CoCr28Mo6 on the osteogenic differentiation and cytokine release of human osteoblasts
  239. Research Article
  240. Increasing the visibility of thin NITINOL vascular implants
  241. Research Article
  242. Possible reasons for early artificial bone failure in biomechanical tests of ankle arthrodesis systems
  243. Research Article
  244. Development of a bending test procedure for the characterization of flexible ECoG electrode arrays
  245. Research Article
  246. Tubular manipulators: a new concept for intracochlear positioning of an auditory prosthesis
  247. Research Article
  248. Investigation of the dynamic diameter deformation of vascular stents during fatigue testing with radial loading
  249. Research Article
  250. Electrospun vascular grafts with anti-kinking properties
  251. Research Article
  252. Integration of temperature sensors in polyimide-based thin-film electrode arrays
  253. Research Article
  254. Use cases and usability challenges for head-mounted displays in healthcare
  255. Research Article
  256. Device- and service profiles for integrated or systems based on open standards
  257. Research Article
  258. Risk management for medical devices in research projects
  259. Research Article
  260. Simulation of varying femoral attachment sites of medial patellofemoral ligament using a musculoskeletal multi-body model
  261. Research Article
  262. Does enhancing consciousness for strategic planning processes support the effectiveness of problem-based learning concepts in biomedical education?
  263. Research Article
  264. SPIO processing in macrophages for MPI: The breast cancer MPI-SNLB-concept
  265. Research Article
  266. Numerical simulations of airflow in the human pharynx of OSAHS patients
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 7.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/cdbme-2015-0119/html
Scroll to top button