Home In vitro antiproliferative efficacy of Annona muricata seed and fruit extracts on several cancer cell lines
Article Open Access

In vitro antiproliferative efficacy of Annona muricata seed and fruit extracts on several cancer cell lines

  • Bader O. Almutairi , Ahmed Sholiah Mater , Nael Abutaha EMAIL logo and Mikhlid H. Almutairi
Published/Copyright: June 14, 2023

Abstract

In Saudi Arabia, breast cancer is the second-most frequently identified common malignant cause of death for women. The present investigation was carried out to assess the impact of different Soxhlet solvent extracts of Annona muricata on apoptosis induction in breast cancer cells. Cell survival was estimated by post-incubation of cells with the extract for 24 h using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay. Acridine orange (AO)/propidium iodide (PI) and 4′,6-diamidino-2-phenylindole (DAPI) staining were employed to study cell apoptosis. qRT-PCR was also employed to assess apoptotic genes’ expression, such as BAX and P53 genes. The results of the MTT assay showed that the chloroform extract inhibited the proliferation of MDA-MB-231 and MCF-7 cells dose-dependently. AO/PI and DAPI staining showed chromatin condensation and fragmentation. In treated cells, P53 expression significantly increased, correlated with the increase in BAX activity. The findings suggest that apoptosis may have been triggered post-chloroform extract treatment. Combining chloroform extract of A. muricata and doxorubicin at a 1:1 ratio increased the IC50 value (292.3 µg/mL). The chloroform extract of A. muricata contained a variety of substances, including diethyl carbonate (7.38%), 4-acetoxy-2,11-dodecadiene (58.13%), and hexadecanoic acid (34.48%), according to the results of the gas chromatography-mass spectrometry analysis. As a result, future research on the A. muricata chloroform extract as a potential anticancer drug could be suggested.

1 Introduction

There were 10 million cancer-related deaths worldwide in 2020, making it the second most cause worldwide. In 2020, the cancer types that led to the highest number of fatalities were those affecting the breast, stomach, rectum, colon, lungs, and liver. Simultaneously, the cancer diagnoses that were most prevalent in 2020 encompassed breast, stomach, lungs, prostate, colon, rectum, and skin (WHO, https://www.who.int/news-room/fact-sheets/detail/cancer).

Technological advancements and understanding of neoplastic disease provide opportunities to lower the death rate but cancer-related deaths are continuously rising [1]. The available cancer treatments are complex and have adverse side effects. Thus, searching for novel medication options with low toxicity toward normal cells continues. Secondary metabolites from medicinal plants are seen as a promising resource for exploring new drug options for diseases, including cancer. This is due to their unique structures, the broad range of their chemical natures, and their generally low toxicity levels [2]. The therapeutic benefits of natural products used for medicinal purposes by humans date back to ancient civilizations [3]. Lack of success in treating conditions such as mental disorders, AIDS, hepatitis, diabetes, cancer, and allergies has prompted researchers to look for novel natural substances that can be utilized as drugs [4,5]. Medicinal plants contain many phytocompounds used in the food and pharmaceutical industries. Medicinal plants have a wide range of bioactive compounds with several biological activities [6].

Annona muricata L., a tree belonging to the Annonaceae family, is a traditional medicinal plant distributed and cultivated in subtropical and tropical climates. A. muricata is popularly consumed in India, Malaysia, South America, and tropical Africa for its ethnomedicinal values. In addition to ethnomedicinal uses, the fruits are used to manufacture beverages, candy, ice creams, shakes, and syrups [7,8,9]. The plant is reported to have various biological activities such as antiarthritic, anticancer, anticonvulsant, wound healing, molluscicidal, gastroprotective, insecticidal, bilirubin-lowering, hepatoprotective, antiplasmodial, antihypertensive, antiparasitic, antinociceptive, antioxidant, antidiabetic, hypolipidemic, and anti-inflammatory activities [9]. Phytochemical tests on A. muricata revealed the presence of various secondary metabolites, including alkaloids [10], flavonols [11], phenolics [12], cyclopeptides, essential oils, and annonaceous acetogenin compounds [13].

This study investigated the antiproliferative, apoptosis, and GC-MS analyses of the A. muricata bioactive extract.

2 Materials and methods

2.1 Collection of plant

A. muricata was acquired from a market located in Riyadh, King Saudi Arabia (KSA). It was classified by a taxonomist at KSA, Department of Botany, and a voucher specimen (KSU-BRC-052) was deposited at the same department. The seeds were separated from the fruit and then were kept for drying in an oven at 60°C. The dried seed (14.46 g) and fruit (45 g) were ground using a commercial grinder (Stardust, Japan). The dry powder samples were extracted using the Soxhlet extractor.

2.2 Soxhlet extraction

A thimble was filled with the dried plant powder, and 500 mL of n-hexane, chloroform, ethyl acetate, and methanol were employed in that order. The extraction was allowed to reflux for 18 h at 70°C. After each extraction cycle, the extracted plants were concentrated, weighed, and the solvent was rotary evaporated at 45°C. The stock solution was made by dissolving the extract in dimethyl sulfoxide (DMSO) and keeping it at −20°C. DMSO was used to dilute the stock solution to prepare extracts of varying strengths.

2.3 Source of cell lines

The human breast carcinoma (MDA-MB-231 and MCF-7) cell lines and human lung carcinoma (A-549) cell lines used in this study were sourced from the German Cell Cultures Collection (DSMZ), whereas the normal human umbilical vein endothelial cells (HUVECs) were provided by the Japanese Collection of Research Bioresources (JCRB Cell Bank).

2.4 Antiproliferative activity

Cytotoxic activity of A. muricata seed and fruit extracts was evaluated using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay on MCF7, MDA-MDA-MB-231, A549, and HUVECs. Basically, cells were seeded into 24-well culture plates (NIST, China) at a density of 50,000 cells/well and incubated for 24 h at 37°C with 5% CO2. Plant extracts were applied to the cells at various doses (200, 140, 100, 50, and 20 µg/mL). As a negative control, the final row of wells was treated with DMSO (0.1%). Cells were also exposed to doxorubicin (0.1–10 g/mL) as a positive control. Following a 24 h incubation period, the MTT reagent (5 mg/mL) was introduced and the mixtures were incubated again for 2 h. The resulting formazan was dissolved in DMSO (1,000 μL). The absorbance of formazan was then measured at 570 nm utilizing an automated microplate reader (ChroMate, England). Each experiment was conducted in triplicate. Cell viability (%) was determined by comparing the absorbance between the experimental samples and the negative control.

2.5 Morphological alterations

We evaluated morphological alterations of MDA-MB231 with and without extracts. As previously noted, the cells were grown and treated with a 2 × IC50 dose. The control group of cells received the DMSO treatment. Cells were examined at 200× after receiving the extract for 24 h using a phase-contrast microscope (EVOS, USA).

2.6 4′,6-Diamidino-2-phenylindole (DAPI) staining

DAPI (Thermo Fisher Scientific) staining was used to determine cell nuclear morphology changes. At the appropriate confluence, cells were treated with extracts (2 × IC50). The cells were washed with PBS, fixed in cold ethanol, stained with DAPI (1.0 µg/mL), and left to sit at 37°C for 30 min. Finally, the cells were washed with PBS before they were examined using fluorescence microscopy at 200× magnification.

2.7 Staining with acridine orange and ethidium bromide (AO/EB)

Cells were grown, as reported in the previous section. Through dual AO/EB fluorescence labeling, changes in the cell shape were evaluated (Abutaha [14]). Cells were exposed to extracts at 2 × IC50 concentrations for 24 h before being stained for 5 min with a 1 µL/mL AO/EB combination that contained 5 µg/mL EB and 5 µg/mL AO (Sigma-Aldrich, USA). Stained cells were observed under a fluorescence microscope at 200× magnification.

2.8 Isolation of RNA, cDNA synthesis, and qRT-PCR

The total RNA was extracted and reverse-transcribed using high-capacity cDNA reverse transcriptase kits (Applied Biosystems, United States) with an oligo-d(T) primer under standard conditions. qRT-PCR amplification was carried out using a Prime Q real-time PCR machine (Techine), and 2.5 μL of the purified cDNA product, 0.5 μL of sense primer (10 pmol/mL), 0.5 μL of antisense primer (10 pmol/mL) (Table 1), and 10 μL of SYBR Green I (GoTaq® qPCR; Promega). GAPDH served as an internal reference gene, and the relative change was calculated by relative quantification, by the 2−ΔΔCt method.

Table 1

Primer sequences of the studied genes

Gene Primer F sequence (5′→3′) Primer R sequence (5′→3′) PZ* (bp) T a** (°C)
Bax TGAAGCGACTGATGTCCCTG CAAAGATGGTCACGGTCTGC 82 58
P53 TGACACGCTTCCCTGGATTG GCTCGACGCTAGGATCTGAC 83 58
GAPDH AATGGGCAGCCGTTAGGAAA AAAAGCATCACCCGGAGGAG 133 58

*Product size; **Annealing temperature.

2.9 Gas chromatography-mass spectrometry (GC-MS)

The extracts’ constituents were examined by GC-MS analysis (Agilent Technologies, USA) in the College of Pharmacy in Riyadh, KSA, using a Perkin Elmer Clarus 600 gas chromatograph linked to a mass spectrometer. The following temperature program was used to inject aliquots of the extracts, each containing 1 L, onto the Elite 5MS capillary column, which has a 30 m length, 0.25 L film thickness, and 0.25 L internal diameter. The GC-MS system began with an initial oven temperature of 40°C and maintained it for 2 min before increasing the temperature to 200°C at a rate of 5°C/min and holding it for another 2 min. The temperature was increased from 200 to 300°C and maintained for 2 min. At 280°C, the injector temperature was maintained. The temperature at the source was 220°C, whereas the temperature at the interface was 240°C. Helium was also utilized as the mobile phase, flowing at a rate of 1.0 mL/min. By scanning between 40 and 600 m/z, mass spectral detection was carried out in the electron ionization mode. The process of identifying phytochemicals was carried out by correlating their mass spectra with the reference database from the National Institute of Standards and Technology (NIST, 2004).

2.10 Statistical analysis

SPSS 26.0 software (IBM) was employed to perform the statistical analyses, and the obtained results represent mean ± standard error of three different assays. Differences were calculated using a one-way ANOVA test. P values < 0.05 were considered statistically significant.

3 Results

3.1 Antiproliferative activity

The cytotoxic activity of extracts was tested against MCF7, MDA-MB-231, A549, and HUVECs (Figures 13). The results revealed that only the chloroform fruit extract of A. muricata (AF CHCl3) was significantly effective compared to other extracts (Figure 1). The other extracts were viewed as not cytotoxic on the cell lines under investigation. Therefore, all upcoming studies were conducted to learn more about the therapeutic potential of the A. muricata fruit extract. According to the screening results, the AF CHCl3 showed the best cytotoxic effect on MDA-MB-231 and MCF-7, with an IC50 (inhibitory dose reduced cell growth by 50%) value of 47.4 and 48.4 µg/mL, respectively. The extracts were also tested using HUVECs. The results showed that the HUVECs’ toxicity was above 100 µg/mL (Figure 1).

Figure 1 
                  The cytotoxicity effect of AF CHCl3 and AS CHCl3 extracts against MCF-7, MDA-MB-231, HUVEC, and A549 cells using MTT assays. Dose–response curve of the effects of different concentrations of CHCl3 extracts of A. muricata seed and fruit against tested cells following 24 h treatment. The MTT assay was used to assess the cytotoxicity at 540 nm using a microplate reader. (●) AF CHCl3, (■) AS CHCl3.
Figure 1

The cytotoxicity effect of AF CHCl3 and AS CHCl3 extracts against MCF-7, MDA-MB-231, HUVEC, and A549 cells using MTT assays. Dose–response curve of the effects of different concentrations of CHCl3 extracts of A. muricata seed and fruit against tested cells following 24 h treatment. The MTT assay was used to assess the cytotoxicity at 540 nm using a microplate reader. (●) AF CHCl3, (■) AS CHCl3.

Figure 2 
                  Morphological assessment of MDA-MB231 cells treated with the AF CHCl3 extract after 24 h using a phase-contrast microscope (a: control, b: treated with 100 µg/mL, and c: treated with 50 µg/mL). Morphological assessment of MDA-MB231 cells treated with AS CHCl3 extract after 24 h using a fluorescence microscope (d: control, e: treated with 100 µg/mL, and f: treated with 50 µg/mL). White arrows indicated fragmented DNA.
Figure 2

Morphological assessment of MDA-MB231 cells treated with the AF CHCl3 extract after 24 h using a phase-contrast microscope (a: control, b: treated with 100 µg/mL, and c: treated with 50 µg/mL). Morphological assessment of MDA-MB231 cells treated with AS CHCl3 extract after 24 h using a fluorescence microscope (d: control, e: treated with 100 µg/mL, and f: treated with 50 µg/mL). White arrows indicated fragmented DNA.

Figure 3 
                  AO/EB-stained MDA-MB231 cells treated with AF CHCl3 extract (2 × IC50 concentration) for 24 h. The treated cells exhibit early apoptotic cell characteristics such as membrane blebbing, DNA fragmentation, cell shrinkage, and fragmented nuclei.
Figure 3

AO/EB-stained MDA-MB231 cells treated with AF CHCl3 extract (2 × IC50 concentration) for 24 h. The treated cells exhibit early apoptotic cell characteristics such as membrane blebbing, DNA fragmentation, cell shrinkage, and fragmented nuclei.

Doxorubicin is a standard drug used for cancer treatment. In the present study, this drug was used as a positive control. Doxorubicin showed that the drug had a greater impact on MDA-MB231 cells and produced IC50 values of 9.2 µg/mL. Combining doxorubicin and the AF CHCl3 extract resulted in an IC50 value of 292.3 µg/mL, indicating the antagonistic potential of the drug and the extract.

3.2 Morphological changes

Morphological changes in MDA-MB231 cells were detected post-incubation with the AF CHCl3 extract (Figure 2). Exposure of cells to the AF CHCl3 extract showed apoptotic features such as loss of contact with adjacent cells, rounding, and shrinkage of cells. In contrast, control cells retained their original morphology and remained adhered to the tissue culturing plates.

3.3 Staining with DAPI

Regarding DAPI staining results, the chloroform extract of the A. muricata fruit (AF CHCl3) resulted in condensed nuclei and fragmented DNA, confirming that the cells underwent apoptosis (Figure 2). In the control group, the stained nuclei of MDA-MB231 cells were homogeneous and maintained a round shape.

3.4 Staining with AO/EB

To demonstrate that apoptosis was primarily responsible for the cytotoxicity shown in MDA-MB23, AO/EB staining was carried out on cells treated with the AF CHCl3 extract. This staining technique marked cells differentially depending on the state of apoptosis. Early-stage apoptotic cells display fragmented green nuclei but late-stage apoptotic cells show uneven and dense orange EB nucleus staining (Liu et al., [15]). The AO/EB fluorescence staining also revealed other morphological alterations. Comparing the treated cells to the control cells, it was clear that the number of apoptotic cells was high. The treated cells displayed DNA fragmentation, nuclear condensation, apoptotic body formation, and other hallmarks of the process (Figure 3).

3.5 Gene expression

The transcriptional level of pro-apoptotic genes P53 and BAX [16] was investigated in MDA-MB231 cells after being incubated with the AF CHCl3 extract for 24 h compared to control cells. We observed that the P53 RNA expression remained unchanged at 2.5 × IC50 concentration. However, a significant increase (Figure 4) was recorded in the following concentrations: 5 × IC50 and 10 × IC50 by 5.5- and 11-fold, respectively. Additionally, the BAX expression was slightly elevated in cells treated with 2.5 × IC50 of the extract concentration and significantly increased by 10-fold with 5 × IC50 and 9-fold with 10 × IC50 compared to control cells (Figure 5).

Figure 4 
                  Relative gene expression of P53 in MDA-MB-231 cells treated with the AF CHCl3 extract for 24 h. The significance level of the difference between treated and control cells is indicated in the graph (P < 0.05, *P < 0.01).
Figure 4

Relative gene expression of P53 in MDA-MB-231 cells treated with the AF CHCl3 extract for 24 h. The significance level of the difference between treated and control cells is indicated in the graph (P < 0.05, *P < 0.01).

Figure 5 
                  Fold difference of BAX expression between control and AF CHCl3-treated MDA-MB-231 cells post 24-h treatment. The significance level of the difference between treated and control cells is indicated in the graph (P < 0.05, *P < 0.01).
Figure 5

Fold difference of BAX expression between control and AF CHCl3-treated MDA-MB-231 cells post 24-h treatment. The significance level of the difference between treated and control cells is indicated in the graph (P < 0.05, *P < 0.01).

3.6 Composition analysis of the AP CHCl3 extract

Figure 6 and Table 2 display the chromatogram and the identified phytochemicals, respectively. Three different substances were found in the AF CHCl3 extract: diethyl carbonate (7.38%), 4-acetoxy-2,11-dodecadiene (58.13%), and hexadecanoic acid (34.48%).

Figure 6 
                  GC-MS chromatogram of AF CHCl3 extract obtained from A. muricata fruit.
Figure 6

GC-MS chromatogram of AF CHCl3 extract obtained from A. muricata fruit.

Table 2

Phytochemical profile of the CHCl3 fruit extract obtained from Annona muricata using GC-MS

Compounds Retention time Area (%) Formula Molecular weight
Diethyl carbonate 8.04 7.380 C5H10O3 118.13
4-Acetoxy-2,11-dodecadiene 13.62 58.130 C14H24O2 224.33916
Hexadecanoic acid 14.34 34.480 C16H32O2 256.4

4 Discussion

This study intended to assess the anticancer potential of the A. muricata extract against different cancer cells. Only the AF CHCl3 extract inhibited the proliferation of MDA-MB-231 (47.4 µg/mL) and MCF-7 (48.4 µg/mL) cells dose-dependently. Apoptosis was produced by the AF CHCl3 extract, as demonstrated by DAPI and AO/EB staining. Moreover, it induced P53 and Bax gene expression.

The reported IC50 values for various solvent extracts against MDA-MB-231 and MCF-7 cells show a vast disparity, ranging from 5.3 to 390.2 g/mL [17,18]. Because the plant extract contains a variety of various bioactive components resulting from seasonal variations, soil, climate, etc., the varied potencies of the A. muricata extract are likely caused by batch variation, which may result in some extract batches having more activity than others. The current study confirms that A. muricata extract has a growth-inhibitory effect on MDA-MB-231 and MCF-7 cells, despite the conflicting IC50 values for the extract reported in earlier research. The antiproliferative effect of the extract was found to be selective on breast cancer cell lines with low cytotoxic effects on normal HUVECs (IC50 > 300). This result is similar to the result reported by Hadisaputri et al. [17] on murine mesenchymal stem cells and by Younes et al. [18] on normal kidney cells CV1.

It has been shown that the AF CHCl3 extract-treated cancer cells significantly increase p53 and BAX gene expression by 10- and 11-fold, respectively.

P53 suppresses the Bcl-2 family and, as a result, pro-apoptotic proteins (Bak and Bax) are activated, increasing the permeability of the mitochondrial membrane [19]. However, in most cancer cells, p53 is ubiquitinated and subsequently either degraded or mutated to become functionally dysfunctional in most cancer cells [20]. It has been reported that p53 was significantly increased in different cancer cells (MCF7, MB MDA231, HeLa, and HL60) at the gene and protein levels. The upregulation of p53 was further substantiated by the observed increase in Bax in cancer cell lines exposed to various solvent extracts [21,22]. These results support earlier research on cytotoxicity and cell morphology changes and demonstrate that p53 activation caused by plant extracts induces apoptosis. As a result, activating p53 in cancer cells is one cancer therapy strategy that can be suggested. Bioactive natural compounds are reported to initiate p53 in cancer cells [23,24].

Natural anticancer remedies are popular because they are known to be efficient and have few adverse effects [25]. Hence, despite the ongoing need for research on anticancer substances derived from botanical products, it is important to highlight the significance of A. muricata.

Combination therapy is gaining popularity due to its significant improvement in patient survival [26]. Combining two or more drugs is a rational approach to increase cell killing in cancer, considering that cancer is caused by multiple mutations. Thus, doxorubicin and A. muricata CHCl3 extract were mixed to see if they could enhance the effect on cancer cells. Doxorubicin exerts its impact by inhibiting topoisomerase II and DNA synthesis activity [27], ultimately leading to the cells’ death. However, it is linked to negative side effects such as infection, higher risk of bleeding, appetite loss, heart failure, and cardiac damage. This study showed an antagonistic effect when the AF CHCl3 extract was combined with doxorubicin in MDA-MB-231 cells. The results are consistent with other studies showing that doxorubicin and the aqueous extract of A. muricata leaves had antagonistic effects on the T47D and MCF7 cancer cell lines [28]. Our results, however, differ from previous studies that claimed doxorubicin and soursop had a synergistic effect on 4T1 breast cancer cells [29]. This discrepancy could potentially be attributed to variations in tumor types or due to both drugs targeting the same receptor, causing competitive inhibition [30,31].

Studies conducted in vivo on Wistar albino rats with 1,2-dimethyl hydrazine-induced colon cancer revealed significant apoptosis induction when they were treated with an ethanolic leaf extract of A. muricata (at a dosage of 300 mg/kg). This was marked by the upregulation of caspase-3 [32]. Furthermore, the A. muricata leaf extract, administered at a dose of 400 mg/kg, was evaluated for its potential to inhibit cell proliferation and prevent cancer in two mouse models. These models included benzo[a]pyrene-induced lung carcinoma and Ehrlich ascites carcinoma. The findings indicated that the leaf extract markedly reduced lung cancer in the tested mice. Moreover, in the Ehrlich ascites carcinoma model, the leaf extract diminished the count of viable cells and normalized various hematological parameters [33].

In this study, GC-MS analysis was carried out on the AF CHCl3 extract. The GC-MS study identified three compounds in the AF CHCl3 extract, as depicted in Figure 6 and Table 1. Seasons, phases of plant development, and numerous environmental conditions can all affect the phytochemical content of a plant. These elements could prevent the active compound(s) from being present. Additionally, photodegradation, oxidation, hydrolysis, degradation, and thermal instability may result in solubility changes and activity loss of the compound(s).

Consequently, the ideal way to solve this problem is to develop an extract fingerprint that can be used to track the stability, production, and similarity of the extract when recollection occurs. Such quality control is a significant problem in herbal medicine development. The fingerprinting approach has gained widespread acceptance for monitoring and assessing the quality of herbal extracts [32]. Natural products can be fingerprinted using various techniques, including high-performance thin layer chromatography (HPTLC), high-performance liquid chromatography (HPLC), infrared (IR) spectroscopy, and GC-MS.

Houttuynia cordata was fingerprinted using GC-MS. Eggadi et al. discovered 15 compounds that might be utilized as indicators to recognize and assess the consistency in 40 factories and batches [32]. Palá et al. examined the volatile compounds of Meum athamanticum to generate a profile of 46 compounds to track geographic and seasonal chemical changes [34].

To conclude, the findings of this study indicate that the chloroform extract of A. muricata inhibits the growth of MDA-MB-231 and MCF-7 cells by inducing apoptosis, as supported by fluorescence microscopy and RT-PCR analysis. The GC-MS analysis identified diethyl carbonate, 4-acetoxy-2,11-dodecadiene, and hexadecanoic acid as potential contributors to the anticancer properties of the extract. However, it should be noted that other unidentified compounds in the extract may also play a role in its anticancer effects. Further research is needed to identify additional bioactive compounds with potential anticancer effects and evaluate their efficacy. Furthermore, conducting in vivo studies will provide a better understanding of the chloroform extract’s anticancer effects and mechanisms of action.

Acknowledgements

The authors extend their appreciation to the Deputyship for Research and Innovation, “Ministry of Education” in Saudi Arabia for funding this research (IFKSUOR3-243-1).

  1. Funding information: The authors extend their appreciation to the Deputyship for Research and Innovation, “Ministry of Education” in Saudi Arabia for funding this research (IFKSUOR3-243-1).

  2. Author contributions: BA and NA contributed to the conception and design of the study; MA and NA performed the statistical analysis; NA and BA wrote the first draft; and AS and MA wrote a section of the manuscript. All authors reviewed the results and approved the final version of the manuscript.

  3. Conflict of interest: The authors declare that the research was conducted without any commercial or financial relationships that could be construed as a potential conflict of interest.

  4. Ethical approval: The conducted research is not related to either human or animal use.

References

[1] Gothai S, Muniandy K, Esa NM, Subbiah SK, Arulselvan P. Anticancer potential of Alternanthera sessilis extract on HT-29 human colon cancer cells. Asian Pac J Trop Biomed. 2018;8(8):394.10.4103/2221-1691.239427Search in Google Scholar

[2] Zaman A, Khan MSS, Akter L, Syeed SH, Akter J, Al Mamun A, et al. Exploring new pharmacology and toxicological screening and safety evaluation of one widely used formulation of Nidrakar Bati from South Asia region. BMC Complem Altern Med. 2015;15(1):1–22.10.1186/s12906-015-0635-2Search in Google Scholar PubMed PubMed Central

[3] Potenza MA, Montagnani M, Santacroce L, Charitos IA, Bottalico L. Ancient herbal therapy: A brief history of Panax ginseng. J Ginseng Res. 202210.1016/j.jgr.2022.03.004Search in Google Scholar PubMed PubMed Central

[4] Graça VC, Ferreira IC, Santos PF. Phytochemical composition and biological activities of Geranium robertianum L.: A review. Ind Crop Prod. 2016;87:363–78.10.1016/j.indcrop.2016.04.058Search in Google Scholar

[5] Camejo-Rodrigues J, Ascensao L, Bonet MÀ, Valles J. An ethnobotanical study of medicinal and aromatic plants in the Natural Park of “Serra de São Mamede”(Portugal). J Ethnopharmacol. 2003;89(2–3):199–209.10.1016/S0378-8741(03)00270-8Search in Google Scholar PubMed

[6] Mustafa G, Arif R, Atta A, Sharif S, Jamil A. Bioactive compounds from medicinal plants and their importance in drug discovery in Pakistan. Matrix Sci Pharma. 2017;1(1):17–26.10.26480/msp.01.2017.17.26Search in Google Scholar

[7] Jaramillo-Flores ME, Hernandez-Sanchez H. Thermal diffusivity of soursop (Annona muricata L.) pulp. J Food Eng. 2000;46(2):139–43.10.1016/S0260-8774(00)00074-1Search in Google Scholar

[8] Wu FE, Gu ZM, Zeng L, Zhao GX, Zhang Y, McLaughlin JL, et al. Two new cytotoxic monotetrahydrofuran Annonaceous acetogenins, annomuricins A and B, from the leaves of Annona muricata. J Nat Prod. 1995;58(6):830–6.10.1021/np50120a002Search in Google Scholar PubMed

[9] Moghadamtousi SZ, Fadaeinasab M, Nikzad S, Mohan G, Ali HM, Kadir HA. Annona muricata (Annonaceae): a review of its traditional uses, isolated acetogenins and biological activities. Int J Mol Sci. 2015;16(7):15625–58.10.3390/ijms160715625Search in Google Scholar PubMed PubMed Central

[10] Matsushige A, Matsunami K, Kotake Y, Otsuka H, Ohta S. Three new megastigmanes from the leaves of Annona muricata. J Nat Prod. 2012;66:284–91.10.1007/s11418-011-0583-1Search in Google Scholar PubMed

[11] Nawwar M, Ayoub N, Hussein S, Hashim A, El-Sharawy R, Wende K, et al. Flavonol triglycoside and investigation of the antioxidant and cell stimulating activities of Annona muricata Linn. Arch Pharm Res. 2012;35:761–7.10.1007/s12272-012-0501-4Search in Google Scholar PubMed

[12] Jimenez VM, Gruschwitz M, Schweiggert RM, Carle R, Esquivel P. Identification of phenolic compounds in soursop (Annona muricata) pulp by high-performance liquid chromatography with diode array and electrospray ionization mass spectrometric detection. Food Res Int. 2014;65:42–6.10.1016/j.foodres.2014.05.051Search in Google Scholar

[13] Kossouoh C, Moudachirou M, Adjakidje V, Chalchat JC, Figuérédo G. Essential oil chemical composition of Annona muricata L. leaves from Benin. J Essent Oil Res. 2007;19(4):307–9.10.1080/10412905.2007.9699288Search in Google Scholar

[14] Abutaha N. Apoptotic potential and chemical composition of Jordanian propolis extract against different cancer cell lines. J Microbiol Biotechnol. 2020;30(6):893–902.10.4014/jmb.1905.05027Search in Google Scholar PubMed PubMed Central

[15] Liu K, Liu P-c, Liu R, Wu X. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med Sci Monit Basic Res. 2015;21:15–20.10.12659/MSMBR.893327Search in Google Scholar PubMed PubMed Central

[16] Almutairi B, Ali D, Yaseen KN, Alothman NS, Alyami N, Almukhlafi H, et al. Mechanisms of apoptotic cell death by stainless steel nanoparticle through reactive oxygen species and caspase-3 activities on human liver cells. Front Mol Biosci. 2021;8:729590.10.3389/fmolb.2021.729590Search in Google Scholar PubMed PubMed Central

[17] Hadisaputri YE, Habibah U, Abdullah FF, Halimah E, Mutakin M, Megantara S, et al. Antiproliferation activity and apoptotic mechanism of soursop (Annona muricata L.) leaves extract and fractions on MCF7 breast cancer cells. Breast Cancer Targets Ther. 2021;13:447–57.10.2147/BCTT.S317682Search in Google Scholar PubMed PubMed Central

[18] Younes M, Ammoury C, Haykal T, Nasr L, Sarkis R, Rizk S. The selective anti-proliferative and pro-apoptotic effect of A. cherimola on MDA-MB-231 breast cancer cell line. BMC complement. Med Ther. 2020;20(1):1–10.10.1186/s12906-020-03120-1Search in Google Scholar PubMed PubMed Central

[19] Peña‐Blanco A, García‐Sáez AJ. Bax, Bak and beyond—mitochondrial performance in apoptosis. FEBS J. 2018;285(3):416–31.10.1111/febs.14186Search in Google Scholar PubMed

[20] Park E, Lee CG, Kim J, Kang JH, Cho YG, Jeong SY. Efficacy and safety of combined extracts of cornus officinalis and Ribes fasciculatum for body fat reduction in overweight women. Jpn J Clin Med. 2020;9(11):3629.10.3390/jcm9113629Search in Google Scholar PubMed PubMed Central

[21] Sung MH, Kwon OK, Oh SR, Lee J, Park SH, Han SB, et al. Azorella compacta methanolic extract induces apoptosis via activation of mitogen-activated protein kinase. Mol Med Rep. 2015;12(5):6821–8.10.3892/mmr.2015.4317Search in Google Scholar PubMed

[22] Motadi LR, Choene MS, Mthembu NN. Anticancer properties of Tulbaghia violacea regulate the expression of p53-dependent mechanisms in cancer cell lines. Sci Rep-Uk. 2020;10(1):1–11.10.1038/s41598-020-69722-4Search in Google Scholar PubMed PubMed Central

[23] Nam GH, Jo KJ, Park YS, Kawk HW, Kim SY, Kim YM. In vitro and in vivo induction of p53-dependent apoptosis by extract of Euryale ferox Salisb in A549 human Caucasian lung carcinoma cancer cells is mediated through Akt signaling pathway. Front Oncol. 2019;9:406.10.3389/fonc.2019.00406Search in Google Scholar PubMed PubMed Central

[24] Park YS, Nam GH, Jo KJ, Kawk HW, Kim SY, Kim YM. Extract from zanthoxylum piperitum induces apoptosis of AGS gastric cancer cells through akt/MDM2/p53 signaling pathway. Chin J Integr Med. 2021;27:752–9.10.1007/s11655-021-3486-8Search in Google Scholar PubMed

[25] Singh S, Sharma B, Kanwar SS, Kumar A. Lead phytochemicals for anticancer drug development. Front Plant Sci. 2016;7:1667.10.3389/fpls.2016.01667Search in Google Scholar PubMed PubMed Central

[26] Rasoanaivo P, Wright CW, Willcox ML, Gilbert B. Whole plant extracts versus single compounds for the treatment of malaria: synergy and positive interactions. Malaria J. 2011;10(1):1–12.10.1186/1475-2875-10-S1-S4Search in Google Scholar PubMed PubMed Central

[27] Rang H, Dale MM, Ritter J, Moore P. Pharmacology. New York: Churchill Livingstone; 2003. p. 3–4.Search in Google Scholar

[28] Dewi MK, Trusda SAD, Yuniarti L. Antagonic effect of soursop leaf aqueous extract and doxorubicin combination in MCF7 and T47D breast cancer cell. Global Med Health Commun. 2021;9(3):233–8.10.29313/gmhc.v9i3.8525Search in Google Scholar

[29] Salsabila IA, Nugraheni N, Ahlina FN, Haryanti S, Meiyanto E. Synergistic cotreatment potential of soursop (Annona muricata L.) leaves extract with Doxorubicin on 4T1 cells with antisenescence and anti-reactive-oxygen-species properties. Iran J Pharm Res. 2021;20(2):57.Search in Google Scholar

[30] van Leeuwen RW, Jansman FG, van den Bemt PM, de Man F, Piran F, Vincenten I, et al. Drug–drug interactions in patients treated for cancer: A prospective study on clinical interventions. Ann Oncol. 2015;26(5):992–7.10.1093/annonc/mdv029Search in Google Scholar PubMed

[31] Van Leeuwen R, Brundel D, Neef C, van Gelder T, Mathijssen R, Burger D, et al. Prevalence of potential drug–drug interactions in cancer patients treated with oral anticancer drugs. Brit J Cancer. 2013;108(5):1071–8.10.1038/bjc.2013.48Search in Google Scholar PubMed PubMed Central

[32] Eggadi V, Gundamedi S, Sheshagiri SBB, Revoori SK, Jupally VR, Kulandaivelu U. Evaluation of anticancer activity of Annona muricata in 1, 2-dimethyl hydrazine induced colon cancer. World Appl Sci J. 2014;32(3):444–50.Search in Google Scholar

[33] Rajesh V, Baby Kala M. Antiproliferative and chemopreventive effect of Annona muricata Linn. on Ehrlich ascites carcinoma and Benzo [a] pyrene induced lung carcinoma. Orient Pharm Exp Med. 2015;15:239–56.10.1007/s13596-015-0199-1Search in Google Scholar

[34] Palá-Paúl J, García-Jiménez R, Pérez-Alonso MJ, Velasco-Negueruela A, Sanz J. Essential oil composition of the leaves and stems of Meum athamanticum Jacq., from Spain. J Chromatogr A. 2004;1036(2):245–7.10.1016/j.chroma.2004.02.064Search in Google Scholar PubMed

Received: 2023-05-03
Revised: 2023-05-22
Accepted: 2023-05-29
Published Online: 2023-06-14

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Characteristics, source, and health risk assessment of aerosol polyaromatic hydrocarbons in the rural and urban regions of western Saudi Arabia
  2. Regular Articles
  3. A network-based correlation research between element electronegativity and node importance
  4. Pomegranate attenuates kidney injury in cyclosporine-induced nephrotoxicity in rats by suppressing oxidative stress
  5. Ab initio study of fundamental properties of XInO3 (X = K, Rb, Cs) perovskites
  6. Responses of feldspathic sandstone and sand-reconstituted soil C and N to freeze–thaw cycles
  7. Robust fractional control based on high gain observers design (RNFC) for a Spirulina maxima culture interfaced with an advanced oxidation process
  8. Study on arsenic speciation and redistribution mechanism in Lonicera japonica plants via synchrotron techniques
  9. Optimization of machining Nilo 36 superalloy parameters in turning operation
  10. Vacuum impregnation pre-treatment: A novel method for incorporating mono- and divalent cations into potato strips to reduce the acrylamide formation in French fries
  11. Characterization of effective constituents in Acanthopanax senticosus fruit for blood deficiency syndrome based on the chinmedomics strategy
  12. Comparative analysis of the metabolites in Pinellia ternata from two producing regions using ultra-high-performance liquid chromatography–electrospray ionization–tandem mass spectrometry
  13. The assessment of environmental parameter along the desalination plants in the Kingdom of Saudi Arabia
  14. Effects of harpin and carbendazim on antioxidant accumulation in young jujube leaves
  15. The effects of in ovo injected with sodium borate on hatching performance and small intestine morphology in broiler chicks
  16. Optimization of cutting forces and surface roughness via ANOVA and grey relational analysis in machining of In718
  17. Essential oils of Origanum compactum Benth: Chemical characterization, in vitro, in silico, antioxidant, and antibacterial activities
  18. Translocation of tungsten(vi) oxide/gadolinium(iii) fluoride in tellurite glasses towards improvement of gamma-ray attenuation features in high-density glass shields
  19. Mechanical properties, elastic moduli, and gamma ray attenuation competencies of some TeO2–WO3–GdF3 glasses: Tailoring WO3–GdF3 substitution toward optimum behavioral state range
  20. Comparison between the CIDR or sponge with hormone injection to induce estrus synchronization for twining and sex preselection in Naimi sheep
  21. Exergetic performance analyses of three different cogeneration plants
  22. Psoralea corylifolia (babchi) seeds enhance proliferation of normal human cultured melanocytes: GC–MS profiling and biological investigation
  23. A novel electrochemical micro-titration method for quantitative evaluation of the DPPH free radical scavenging capacity of caffeic acid
  24. Comparative study between supported bimetallic catalysts for nitrate remediation in water
  25. Persicaline, an alkaloid from Salvadora persica, inhibits proliferation and induces apoptosis and cell-cycle arrest in MCF-7 cells
  26. Determination of nicotine content in locally produced smokeless tobacco (Shammah) samples from Jazan region of Saudi Arabia using a convenient HPLC-MS/MS method
  27. Changes in oxidative stress markers in pediatric burn injury over a 1-week period
  28. Integrated geophysical techniques applied for petroleum basins structural characterization in the central part of the Western Desert, Egypt
  29. The impact of chemical modifications on gamma-ray attenuation properties of some WO3-reinforced tellurite glasses
  30. Microwave and Cs+-assisted chemo selective reaction protocol for synthesizing 2-styryl quinoline biorelevant molecules
  31. Structural, physical, and radiation absorption properties of a significant nuclear power plant component: A comparison between REX-734 and 316L SS austenitic stainless steels
  32. Effect of Moringa oleifera on serum YKL-40 level: In vivo rat periodontitis model
  33. Investigating the impact of CO2 emissions on the COVID-19 pandemic by generalized linear mixed model approach with inverse Gaussian and gamma distributions
  34. Influence of WO3 content on gamma rays attenuation characteristics of phosphate glasses at low energy range
  35. Study on CO2 absorption performance of ternary DES formed based on DEA as promoting factor
  36. Performance analyses of detonation engine cogeneration cycles
  37. Sterols from Centaurea pumilio L. with cell proliferative activity: In vitro and in silico studies
  38. Untargeted metabolomics revealing changes in aroma substances in flue-cured tobacco
  39. Effect of pumpkin enriched with calcium lactate on iron status in an animal model of postmenopausal osteoporosis
  40. Energy consumption, mechanical and metallographic properties of cryogenically treated tool steels
  41. Optimization of ultra-high pressure-assisted extraction of total phenols from Eucommia ulmoides leaves by response surface methodology
  42. Harpin enhances antioxidant nutrient accumulation and decreases enzymatic browning in stored soybean sprouts
  43. Physicochemical and biological properties of carvacrol
  44. Radix puerariae in the treatment of diabetic nephropathy: A network pharmacology analysis and experimental validation
  45. Anti-Alzheimer, antioxidants, glucose-6-phosphate dehydrogenase effects of Taverniera glabra mediated ZnO and Fe2O3 nanoparticles in alloxan-induced diabetic rats
  46. Experimental study on photocatalytic CO2 reduction performance of ZnS/CdS-TiO2 nanotube array thin films
  47. Epoxy-reinforced heavy metal oxides for gamma ray shielding purposes
  48. Black mulberry (Morus nigra L.) fruits: As a medicinal plant rich in human health-promoting compounds
  49. Promising antioxidant and antimicrobial effects of essential oils extracted from fruits of Juniperus thurifera: In vitro and in silico investigations
  50. Chloramine-T-induced oxidation of Rizatriptan Benzoate: An integral chemical and spectroscopic study of products, mechanisms and kinetics
  51. Study on antioxidant and antimicrobial potential of chemically profiled essential oils extracted from Juniperus phoenicea (L.) by use of in vitro and in silico approaches
  52. Screening and characterization of fungal taxol-producing endophytic fungi for evaluation of antimicrobial and anticancer activities
  53. Mineral composition, principal polyphenolic components, and evaluation of the anti-inflammatory, analgesic, and antioxidant properties of Cytisus villosus Pourr leaf extracts
  54. In vitro antiproliferative efficacy of Annona muricata seed and fruit extracts on several cancer cell lines
  55. An experimental study for chemical characterization of artificial anterior cruciate ligament with coated chitosan as biomaterial
  56. Prevalence of residual risks of the transfusion-transmitted infections in Riyadh hospitals: A two-year retrospective study
  57. Computational and experimental investigation of antibacterial and antifungal properties of Nicotiana tabacum extracts
  58. Reinforcement of cementitious mortars with hemp fibers and shives
  59. X-ray shielding properties of bismuth-borate glass doped with rare earth ions
  60. Green supported silver nanoparticles over modified reduced graphene oxide: Investigation of its antioxidant and anti-ovarian cancer effects
  61. Orthogonal synthesis of a versatile building block for dual functionalization of targeting vectors
  62. Thymbra spicata leaf extract driven biogenic synthesis of Au/Fe3O4 nanocomposite and its bio-application in the treatment of different types of leukemia
  63. The role of Ag2O incorporation in nuclear radiation shielding behaviors of the Li2O–Pb3O4–SiO2 glass system: A multi-step characterization study
  64. A stimuli-responsive in situ spray hydrogel co-loaded with naringenin and gentamicin for chronic wounds
  65. Assessment of the impact of γ-irradiation on the piperine content and microbial quality of black pepper
  66. Antioxidant, sensory, and functional properties of low-alcoholic IPA beer with Pinus sylvestris L. shoots addition fermented using unconventional yeast
  67. Screening and optimization of extracellular pectinase produced by Bacillus thuringiensis SH7
  68. Determination of polyphenols in Chinese jujube using ultra-performance liquid chromatography–mass spectrometry
  69. Synergistic effects of harpin and NaCl in determining soybean sprout quality under non-sterile conditions
  70. Field evaluation of different eco-friendly alternative control methods against Panonychus citri [Acari: Tetranychidae] spider mite and its predators in citrus orchards
  71. Exploring the antimicrobial potential of biologically synthesized zero valent iron nanoparticles
  72. NaCl regulates goldfish growth and survival at three food supply levels under hypoxia
  73. An exploration of the physical, optical, mechanical, and radiation shielding properties of PbO–MgO–ZnO–B2O3 glasses
  74. A novel statistical modeling of air pollution and the COVID-19 pandemic mortality data by Poisson, geometric, and negative binomial regression models with fixed and random effects
  75. Treatment activity of the injectable hydrogels loaded with dexamethasone In(iii) complex on glioma by inhibiting the VEGF signaling pathway
  76. An alternative approach for the excess lifetime cancer risk and prediction of radiological parameters
  77. Panax ginseng leaf aqueous extract mediated green synthesis of AgNPs under ultrasound condition and investigation of its anti-lung adenocarcinoma effects
  78. Study of hydrolysis and production of instant ginger (Zingiber officinale) tea
  79. Novel green synthesis of zinc oxide nanoparticles using Salvia rosmarinus extract for treatment of human lung cancer
  80. Evaluation of second trimester plasma lipoxin A4, VEGFR-1, IL-6, and TNF-α levels in pregnant women with gestational diabetes mellitus
  81. Antidiabetic, antioxidant and cytotoxicity activities of ortho- and para-substituted Schiff bases derived from metformin hydrochloride: Validation by molecular docking and in silico ADME studies
  82. Antioxidant, antidiabetic, antiglaucoma, and anticholinergic effects of Tayfi grape (Vitis vinifera): A phytochemical screening by LC-MS/MS analysis
  83. Identification of genetic polymorphisms in the stearoyl CoA desaturase gene and its association with milk quality traits in Najdi sheep
  84. Cold-acclimation effect on cadmium absorption and biosynthesis of polyphenolics, and free proline and photosynthetic pigments in Spirogyra aequinoctialis
  85. Analysis of secondary metabolites in Xinjiang Morus nigra leaves using different extraction methods with UPLC-Q/TOF-MS/MS technology
  86. Nanoarchitectonics and performance evaluation of a Fe3O4-stabilized Pickering emulsion-type differential pressure plugging agent
  87. Investigating pyrolysis characteristics of Shengdong coal through Py-GC/MS
  88. Extraction, phytochemical characterization, and antifungal activity of Salvia rosmarinus extract
  89. Introducing a novel and natural antibiotic for the treatment of oral pathogens: Abelmoschus esculentus green-formulated silver nanoparticles
  90. Optimization of gallic acid-enriched ultrasonic-assisted extraction from mango peels
  91. Effect of gamma rays irradiation in the structure, optical, and electrical properties of samarium doped bismuth titanate ceramics
  92. Combinatory in silico investigation for potential inhibitors from Curcuma sahuynhensis Škorničk. & N.S. Lý volatile phytoconstituents against influenza A hemagglutinin, SARS-CoV-2 main protease, and Omicron-variant spike protein
  93. Physical, mechanical, and gamma ray shielding properties of the Bi2O3–BaO–B2O3–ZnO–As2O3–MgO–Na2O glass system
  94. Twofold interpenetrated 3D Cd(ii) complex: Crystal structure and luminescent property
  95. Study on the microstructure and soil quality variation of composite soil with soft rock and sand
  96. Ancient spring waters still emerging and accessible in the Roman Forum area: Chemical–physical and microbiological characterization
  97. Extraction and characterization of type I collagen from scales of Mexican Biajaiba fish
  98. Finding small molecular compounds to decrease trimethylamine oxide levels in atherosclerosis by virtual screening
  99. Prefatory in silico studies and in vitro insecticidal effect of Nigella sativa (L.) essential oil and its active compound (carvacrol) against the Callosobruchus maculatus adults (Fab), a major pest of chickpea
  100. Polymerized methyl imidazole silver bromide (CH3C6H5AgBr)6: Synthesis, crystal structures, and catalytic activity
  101. Using calcined waste fish bones as a green solid catalyst for biodiesel production from date seed oil
  102. Influence of the addition of WO3 on TeO2–Na2O glass systems in view of the feature of mechanical, optical, and photon attenuation
  103. Naringin ameliorates 5-fluorouracil elicited neurotoxicity by curtailing oxidative stress and iNOS/NF-ĸB/caspase-3 pathway
  104. GC-MS profile of extracts of an endophytic fungus Alternaria and evaluation of its anticancer and antibacterial potentialities
  105. Green synthesis, chemical characterization, and antioxidant and anti-colorectal cancer effects of vanadium nanoparticles
  106. Determination of caffeine content in coffee drinks prepared in some coffee shops in the local market in Jeddah City, Saudi Arabia
  107. A new 3D supramolecular Cu(ii) framework: Crystal structure and photocatalytic characteristics
  108. Bordeaux mixture accelerates ripening, delays senescence, and promotes metabolite accumulation in jujube fruit
  109. Important application value of injectable hydrogels loaded with omeprazole Schiff base complex in the treatment of pancreatitis
  110. Color tunable benzothiadiazole-based small molecules for lightening applications
  111. Investigation of structural, dielectric, impedance, and mechanical properties of hydroxyapatite-modified barium titanate composites for biomedical applications
  112. Metal gel particles loaded with epidermal cell growth factor promote skin wound repair mechanism by regulating miRNA
  113. In vitro exploration of Hypsizygus ulmarius (Bull.) mushroom fruiting bodies: Potential antidiabetic and anti-inflammatory agent
  114. Alteration in the molecular structure of the adenine base exposed to gamma irradiation: An ESR study
  115. Comprehensive study of optical, thermal, and gamma-ray shielding properties of Bi2O3–ZnO–PbO–B2O3 glasses
  116. Lewis acids as co-catalysts in Pd-based catalyzed systems of the octene-1 hydroethoxycarbonylation reaction
  117. Synthesis, Hirshfeld surface analysis, thermal, and selective α-glucosidase inhibitory studies of Schiff base transition metal complexes
  118. Protective properties of AgNPs green-synthesized by Abelmoschus esculentus on retinal damage on the virtue of its anti-inflammatory and antioxidant effects in diabetic rat
  119. Effects of green decorated AgNPs on lignin-modified magnetic nanoparticles mediated by Cydonia on cecal ligation and puncture-induced sepsis
  120. Treatment of gastric cancer by green mediated silver nanoparticles using Pistacia atlantica bark aqueous extract
  121. Preparation of newly developed porcelain ceramics containing WO3 nanoparticles for radiation shielding applications
  122. Utilization of computational methods for the identification of new natural inhibitors of human neutrophil elastase in inflammation therapy
  123. Some anticancer agents as effective glutathione S-transferase (GST) inhibitors
  124. Clay-based bricks’ rich illite mineral for gamma-ray shielding applications: An experimental evaluation of the effect of pressure rates on gamma-ray attenuation parameters
  125. Stability kinetics of orevactaene pigments produced by Epicoccum nigrum in solid-state fermentation
  126. Treatment of denture stomatitis using iron nanoparticles green-synthesized by Silybum marianum extract
  127. Characterization and antioxidant potential of white mustard (Brassica hirta) leaf extract and stabilization of sunflower oil
  128. Characteristics of Langmuir monomolecular monolayers formed by the novel oil blends
  129. Strategies for optimizing the single GdSrFeO4 phase synthesis
  130. Oleic acid and linoleic acid nanosomes boost immunity and provoke cell death via the upregulation of beta-defensin-4 at genetic and epigenetic levels
  131. Unraveling the therapeutic potential of Bombax ceiba roots: A comprehensive study of chemical composition, heavy metal content, antibacterial activity, and in silico analysis
  132. Green synthesis of AgNPs using plant extract and investigation of its anti-human colorectal cancer application
  133. The adsorption of naproxen on adsorbents obtained from pepper stalk extract by green synthesis
  134. Treatment of gastric cancer by silver nanoparticles encapsulated by chitosan polymers mediated by Pistacia atlantica extract under ultrasound condition
  135. In vitro protective and anti-inflammatory effects of Capparis spinosa and its flavonoids profile
  136. Wear and corrosion behavior of TiC and WC coatings deposited on high-speed steels by electro-spark deposition
  137. Therapeutic effects of green-formulated gold nanoparticles by Origanum majorana on spinal cord injury in rats
  138. Melanin antibacterial activity of two new strains, SN1 and SN2, of Exophiala phaeomuriformis against five human pathogens
  139. Evaluation of the analgesic and anesthetic properties of silver nanoparticles supported over biodegradable acacia gum-modified magnetic nanoparticles
  140. Review Articles
  141. Role and mechanism of fruit waste polyphenols in diabetes management
  142. A comprehensive review of non-alkaloidal metabolites from the subfamily Amaryllidoideae (Amaryllidaceae)
  143. Discovery of the chemical constituents, structural characteristics, and pharmacological functions of Chinese caterpillar fungus
  144. Eco-friendly green approach of nickel oxide nanoparticles for biomedical applications
  145. Advances in the pharmaceutical research of curcumin for oral administration
  146. Rapid Communication
  147. Determination of the contents of bioactive compounds in St. John’s wort (Hypericum perforatum): Comparison of commercial and wild samples
  148. Retraction
  149. Retraction of “Two mixed-ligand coordination polymers based on 2,5-thiophenedicarboxylic acid and flexible N-donor ligands: The protective effect on periodontitis via reducing the release of IL-1β and TNF-α”
  150. Topical Issue on Phytochemicals, biological and toxicological analysis of aromatic medicinal plants
  151. Anti-plasmodial potential of selected medicinal plants and a compound Atropine isolated from Eucalyptus obliqua
  152. Anthocyanin extract from black rice attenuates chronic inflammation in DSS-induced colitis mouse model by modulating the gut microbiota
  153. Evaluation of antibiofilm and cytotoxicity effect of Rumex vesicarius methanol extract
  154. Chemical compositions of Litsea umbellata and inhibition activities
  155. Green synthesis, characterization of silver nanoparticles using Rhynchosia capitata leaf extract and their biological activities
  156. GC-MS analysis and antibacterial activities of some plants belonging to the genus Euphorbia on selected bacterial isolates
  157. The abrogative effect of propolis on acrylamide-induced toxicity in male albino rats: Histological study
  158. A phytoconstituent 6-aminoflavone ameliorates lipopolysaccharide-induced oxidative stress mediated synapse and memory dysfunction via p-Akt/NF-kB pathway in albino mice
  159. Anti-diabetic potentials of Sorbaria tomentosa Lindl. Rehder: Phytochemistry (GC-MS analysis), α-amylase, α-glucosidase inhibitory, in vivo hypoglycemic, and biochemical analysis
  160. Assessment of cytotoxic and apoptotic activities of the Cassia angustifolia aqueous extract against SW480 colon cancer
  161. Biochemical analysis, antioxidant, and antibacterial efficacy of the bee propolis extract (Hymenoptera: Apis mellifera) against Staphylococcus aureus-induced infection in BALB/c mice: In vitro and in vivo study
  162. Assessment of essential elements and heavy metals in Saudi Arabian rice samples underwent various processing methods
  163. Two new compounds from leaves of Capparis dongvanensis (Sy, B. H. Quang & D. V. Hai) and inhibition activities
  164. Hydroxyquinoline sulfanilamide ameliorates STZ-induced hyperglycemia-mediated amyleoid beta burden and memory impairment in adult mice
  165. An automated reading of semi-quantitative hemagglutination results in microplates: Micro-assay for plant lectins
  166. Inductively coupled plasma mass spectrometry assessment of essential and toxic trace elements in traditional spices consumed by the population of the Middle Eastern region in their recipes
  167. Phytochemical analysis and anticancer activity of the Pithecellobium dulce seed extract in colorectal cancer cells
  168. Impact of climatic disturbances on the chemical compositions and metabolites of Salvia officinalis
  169. Physicochemical characterization, antioxidant and antifungal activities of essential oils of Urginea maritima and Allium sativum
  170. Phytochemical analysis and antifungal efficiency of Origanum majorana extracts against some phytopathogenic fungi causing tomato damping-off diseases
  171. Special Issue on 4th IC3PE
  172. Graphene quantum dots: A comprehensive overview
  173. Studies on the intercalation of calcium–aluminium layered double hydroxide-MCPA and its controlled release mechanism as a potential green herbicide
  174. Synergetic effect of adsorption and photocatalysis by zinc ferrite-anchored graphitic carbon nitride nanosheet for the removal of ciprofloxacin under visible light irradiation
  175. Exploring anticancer activity of the Indonesian guava leaf (Psidium guajava L.) fraction on various human cancer cell lines in an in vitro cell-based approach
  176. The comparison of gold extraction methods from the rock using thiourea and thiosulfate
  177. Special Issue on Marine environmental sciences and significance of the multidisciplinary approaches
  178. Sorption of alkylphenols and estrogens on microplastics in marine conditions
  179. Cytotoxic ketosteroids from the Red Sea soft coral Dendronephthya sp.
  180. Antibacterial and biofilm prevention metabolites from Acanthophora spicifera
  181. Characteristics, source, and health risk assessment of aerosol polyaromatic hydrocarbons in the rural and urban regions of western Saudi Arabia
  182. Special Issue on Advanced Nanomaterials for Energy, Environmental and Biological Applications - Part II
  183. Green synthesis, characterization, and evaluation of antibacterial activities of cobalt nanoparticles produced by marine fungal species Periconia prolifica
  184. Combustion-mediated sol–gel preparation of cobalt-doped ZnO nanohybrids for the degradation of acid red and antibacterial performance
  185. Perinatal supplementation with selenium nanoparticles modified with ascorbic acid improves hepatotoxicity in rat gestational diabetes
  186. Evaluation and chemical characterization of bioactive secondary metabolites from endophytic fungi associated with the ethnomedicinal plant Bergenia ciliata
  187. Enhancing photovoltaic efficiency with SQI-Br and SQI-I sensitizers: A comparative analysis
  188. Nanostructured p-PbS/p-CuO sulfide/oxide bilayer heterojunction as a promising photoelectrode for hydrogen gas generation
Downloaded on 1.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/chem-2022-0350/html?lang=en
Scroll to top button