Home Anthocyanin extract from black rice attenuates chronic inflammation in DSS-induced colitis mouse model by modulating the gut microbiota
Article Open Access

Anthocyanin extract from black rice attenuates chronic inflammation in DSS-induced colitis mouse model by modulating the gut microbiota

  • Yanmei Li , Fahu Yuan , Xiaohong He , Shaohua Fu and Bolin Fan EMAIL logo
Published/Copyright: February 24, 2023
Download Article (PDF)
Open Chemistry
From the journal Open Chemistry Volume 21 Issue 1

Abstract

There is substantial evidence for the probiotic activity of anthocyanins, but the relationship between anthocyanins involved in the regulation of microbiota and intestinal inflammation has not been fully elucidated. The aim of this study was to investigate the regulatory effects of black rice anthocyanin extract (BRAE) on intestinal microbiota imbalance in mice with dextran sulfate sodium (DSS)-induced chronic colitis. DSS was added into drinking water to induce a mouse model of chronic experimental colitis, and BRAE was given by gavage (200 mg/kg/day) for 4 weeks. Body weight, fecal viscosity, and hematochezia were monitored during administration. After mice were sacrificed, the serum concentrations of TNF-α and IL-6 were detected by enzyme-linked immunosorbent assay, and the composition of intestinal flora was analyzed by 16S rDNA sequencing. The results showed that BRAE significantly suppressed DSS-induced colonic inflammatory phenotypes and maintained colon length in mice. In addition, BRAE reduced intestinal permeability and improved intestinal barrier dysfunction in mice with colitis. Gut microbiota analysis showed that BRAE significantly improved the imbalance of intestinal microecological diversity caused by DSS, inhibited the increase in the relative abundance of inflammatory bacteria, and promoted the abundance of anti-inflammatory probiotics including Akkermansia spp.

Keywords: black rice anthocyanin; inflammation; inflammatory bowel disease; microbiota

1 Introduction

Inflammatory bowel disease (IBD) is a chronic and recurrent inflammatory disease that occurs in the digestive tract and is classified as Crohn’s disease (CD) and ulcerative colitis (UC) [1]. Usually, the main drugs for the treatment of inflammatory diseases are sulfasalazine and corticosteroids, which mainly work by inhibiting the immune response of the body, but there are many side effects and poor compliance [2,3,4]. Rich natural products from food and herbs have a wide range of biological activities, including anti-inflammatory, antibacterial, and antioxidant activities [5,6,7,8]. Effective and evidence-based anti-inflammatory alternative therapy is currently an emerging field of IBD.

The maintenance of intestinal homeostasis depends on the balance between gut microbiota, on the intestinal epithelial barrier, and on the immune system [9,10,11]. Recently, the role of the microbiome and intestinal mucosal homeostasis has been elucidated in animal models of IBD [12]. A key factor in the development of IBD is the destruction of the mucus layer and intestinal epithelium as the first line of defense against microbial invasion [13]. The maintenance of intestinal homeostasis is based on an intact, microbially impermeable mucosal barrier, and disruption of this barrier increases the risk of colitis [14,15].

IBD patients have some common microbial patterns, such as reduced microbial diversity, lower relative abundance of Firmicutes, and more of Proteobacteria [16,17,18]. Biodiversity loss may lead to increased inflammation and immune responses, resulting in loss or reduction of key functions required by the host immune system to maintain gut barrier integrity and function [19]. On the other hand, the overproliferation of pathogenic bacteria leads to the degradation of the mucosal barrier, thus allowing more pathogens to break through the intestinal mucosal barrier and enter the intestinal tissue [20].

Anthocyanins are a kind of common secondary metabolite, belonging to flavonoids, widely existing in fruits, vegetables, and grains. There is ample research evidence that anthocyanins have many health benefits, including anti-inflammatory, antioxidant, anti-obesity, anti-cancer, anti-diabetes, and immunomodulatory properties [21]. Notably, most studies focus on its complex bioavailability, ignoring the fact that the primary site of absorption of anthocyanins is the colon. Experimental evidence in models of intestinal inflammation suggests that anthocyanins may have therapeutic potential in mice with dextran sulfate sodium (DSS)-induced colitis [22].

Most previous studies on the anti-colitis activity of anthocyanins have focused on berries derived from unacylated anthocyanins, rather than crops that contain predominantly heat-resistant acylated anthocyanins, such as black rice anthocyanin (BRA) [23]. There is sufficient evidence that intestinal flora imbalance associated with intestinal epithelial integrity leads to IBD in humans. Given the potential for interaction between intestinal flora and anthocyanins, we hypothesize that anthocyanin’s response to colitis is mediated by the regulation of intestinal flora, which in turn leads to host response to inflammation and oxidative stress. In this study, the palliative effect of oral anthocyanins extracted from black rice was tested for the first time in a mouse model of chronic colitis induced by DSS.

2 Materials and methods

2.1 Preparation of black rice anthocyanin-rich extract (BRAE)

According to the method of Bae et al. [24], a certain amount of crushed and sifted black rice powder was put into a flask, and 50% of ethanol solution (pH 2–3, adjusted with acetic acid solution) was added at the ratio of 1:8, and ultrasonic extraction was carried out for 30 min. After filtration, vacuum distillation, and concentration, the BRAE was obtained after freeze drying. The yield of BRAE was 1.89 mg/g of black rice. The BRAE powder was stored at −20°C prior to use.

2.2 Quantitation of anthocyanins in BRAE

High liquid chromatography-diode array detector (HPLC-DAD) was used to determine the purity of cyanidin 3-glucoside (C3G) in BRAE. The C3G of analytical standard (Shanghai Aladdin Biochemical Technology Co., Ltd., Cat No. C135886) or BRAE powder was dissolved in acidic methanol (1 mol/L HCl: methanol = 85:15, v/v) and loaded on Agilent Zorbax SB-C18 column (2.1 mm × 50 mm, 1.8 μm). The mobile phase of HPLC system consisted of eluent A (10% formic acid aqueous solution, v/v) and eluent B (methanol). The gradient elution procedure was 0–1 min, 2% B; 1–5 min, 10% B; and 5–20 min, 10–60% B. The column temperature was 25°C, the flow rate was 0.2 mL/min, and the wavelength was 520 nm measured by photodiode array detector.

2.3 Chronic colitis mice model and BRAE administration

Male C57BL/6 mice (8 weeks of age) obtained from Beijing Weitonglihua Experimental Animal Technology Co., Ltd, were randomly assigned to three groups as follows: control group (CON), chronic colitis model group (DSS), and black rice anthocyanidin treatment group (DSS + BRAE), with ten mice in each group, and adaptive feeding for 1 week before the experiment. The normal control group was given pure water during the whole process, and the remaining two groups were induced chronic colitis by repeated and periodical treatment of drinking water containing DSS. Briefly, drinking water with 2.5% DSS (MP Biomedicals, Cat No. 216011080) for 4 days, followed by drinking pure water for 6 days, formed a cycle lasting three times in total. The BRAE treatment group was given 0.2 mL of BRAE solution (20 mg/mL) every day, and the normal group and the chronic UC model group were given 0.2 mL of pure water, respectively, until the end of the experimental period. After the mice were given drinking water containing DSS for modeling, the body weight of the mice was measured every day, and the disease activity index (DAI) for IBD of the mice was evaluated until the end of the animal experiment. There was a good correlation between DAI score and pathological results of DSS-induced IBD model [25]. DAI is based on a composite score of weight loss, stool consistency, and bleeding as described previously [26]. Mice were exsanguinated under terminal anesthesia, and serum was collected by centrifuge phase separation. Colon was isolated, and its length was measured. About 1 cm of the distal colon was collected and fixed in 4% of paraformaldehyde solution for histopathological examination. The remaining colon tissue was rapidly frozen with liquid nitrogen and stored at −80°C. Ileocecal valve contents were collected and placed in a sterile centrifuge tube and stored at −80°C for subsequent microbiota analysis (Figure 1).

Figure 1 Schematic diagram of DSS-induced colitis in mice treated with BRAE (200 mg/kg).
Figure 1

Schematic diagram of DSS-induced colitis in mice treated with BRAE (200 mg/kg).

2.4 Pathological test

Colon tissue was collected, fixed in 10% formalin solution with PBS as buffer for 48 h, and then dehydrated with concentration gradient alcohol, and tissue blocks were placed in xylene to replace the alcohol in tissues and embedded in paraffin. Tissue sections with a thickness of 4 μm were prepared by the continuous section method and stained with hematoxylin–eosin (H&E) solution. The degree of lesion was compared according to ulcer size, inflammatory infiltration, and tissue damage degree.

2.5 Cytokine assay

According to the kit instructions, ELISA was used to detect the concentrations of IL-6 and TNF-α in the serum of each group of mice. Mouse IL-6 ELISA kit (Cat. No. ABS520004) and TNF-α ELISA kit (Cat. No. ABS520010) were purchased from Absin Bioscience Inc.

2.6 RT-qPCR

Total RNA was extracted from 10 mg frozen colon tissue by the Trizol method (RNApure Tissue&Cell Kit, CoWin Biosciences, Cat No. CW0560), and the reverse transcription synthesis of cDNA was carried out according to the instructions of the reverse transcription kit (Super RT cDNA Synthesis Kit, CoWin Biosciences, Cat No. CW0741). Hieff® qPCR SYBR Green Master Mix (Yeasen Biotechnology, 11201ES08) was used to amplify reverse transcription products from different samples. The primers used are shown in Table 1.

Table 1

Primer for real-time qPCR

Gene Forward primer sequence (5′ → 3′) Reverse primer sequence (5′ → 3′) Amplicon size (bp)
Il17a TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC 165
Il6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC 76
Il23a ATGCTGGATTGCAGAGCAGTA ACGGGGCACATTATTTTTAGTCT 213

2.7 Fecal 16S rDNA amplicon sequencing

The genomic DNA of the fecal flora was extracted from mouse feces by the SDS method, and DNA purity and concentration were detected by agarose gel electrophoresis. We take an appropriate amount of DNA and dilute to 1 ng/μL with sterile water in a centrifuge tube. The V3–V4 region of the 16S rDNA gene was amplified using the bar-coded universal primer 338F/806R using the diluted genomic DNA as a template. PCR was performed with Phusion® high-fidelity PCR Master Mix and high-fidelity enzymes purchased from New England Biology Laboratories to ensure amplification efficiency and accuracy.

PCR products were detected by 2% agarose gel electrophoresis. PCR-qualified products were mixed in equal amounts according to the PCR product concentration, purified by magnetic beads, and quantified by microplate labeling. After thorough mixing, the PCR products were tested by 2% agarose gel electrophoresis, and the target bands were recycled using the gel recovery kit provided by QIAGEN.

Libraries were constructed using TruSeq® DNA PCR-free Sample Preparation Kit. The library was quantified by Qubit and Q-PCR and sequenced on NovaSeq 6000 by Beijing Nuohe Zhiyuan Bioinformation Co., Ltd, China.

2.8 Bioinformatics analysis of 16S rDNA sequencing data

According to the barcode and primer sequence, data of each sample were obtained from the off-machine sequence. After truncating the barcode and primer sequences, the reads of each sample were spliced using FLASH (v1.2.7). The QIIME (v1.9.1) process was used for quality control and data processing.

The Uparse algorithm (v7.0.1001) was used for all samples with all valid cluster labels, and the sequences defaulted to 97% consistent clusters as operational taxonomic units (OTUs). At the same time, the OTU sequence is selected, which has a certain representativeness. The sequence with the highest frequency in the OTU is selected as the representative sequence of the OTU according to the algorithm principle. Species annotation of bacterial OTUs sequences was performed using the mothur method and the SSUrRNA database of SILVA138 to obtain taxonomic information. For analysis, multiple sequence alignments were performed using MUSCLE (version 3.8.31) software to obtain all OTUs representing systematic sequences. Finally, using the sample with the least amount of data as the homogenization standard, the data of each sample are homogenized for subsequent analysis.

2.9 Statistical analysis

The data are expressed as mean ± SD. Group-to-group comparisons were performed using one-way ANOVA. A P value ≤0.05 was considered statistically significant. All statistical analyses were performed using Prism software.

3 Results

3.1 Content of C3G in BRAE

The content of anthocyanins in BRAE was determined using an externally calibrated HPLC peak area integral. As shown in Figure 2b, two anthocyanins were detected in BRAE. The content of total anthocyanins in BRAE is 30.25%, while C3G accounts for 90.15% of all anthocyanins. Therefore, C3G is the main anthocyanins in BRAE. Crude protein, crude fat, and total carbohydrate of BRAE were analyzed by conventional laboratory techniques. In addition to anthocyanins, BRAE also contained water (7.86%), crude protein (4.22%), crude fat (5.13%), total carbohydrate (17.52%), and other components (35.02%).

Figure 2 HPLC chromatogram of BRAE detected at 520 nm for anthocyanins. (a) C3G HPLC grade standard chemical and (b) BRAE. Peak 1, C3G.
Figure 2

HPLC chromatogram of BRAE detected at 520 nm for anthocyanins. (a) C3G HPLC grade standard chemical and (b) BRAE. Peak 1, C3G.

3.2 Effect on general condition of mice with UC

Oral DSS can damage the integrity of the colon epithelial barrier, making it permeable to bacterial influx and thus stimulating inflammation. The body weight of the mice in the UC model induced by 2.5% of DSS water for three consecutive cycles was significantly decreased with obvious blood stools, while the symptoms of body weight loss were alleviated by BRAE intervention, with a statistically significant difference compared with the model group (Figure 3a).

Figure 3 BRAE improves the symptoms of DSS-induced colitis in mice. (a) Body weight in different groups, (b) spleen weight in different groups, (c) macroscopic observations of colon, and (d) colon length. Data represent mean ± SD (n = 10). *P < 0.05, ***P < 0.001.
Figure 3

BRAE improves the symptoms of DSS-induced colitis in mice. (a) Body weight in different groups, (b) spleen weight in different groups, (c) macroscopic observations of colon, and (d) colon length. Data represent mean ± SD (n = 10). *P < 0.05, ***P < 0.001.

The colon length of mice with DSS-induced colitis was shorter than that of the control mice, and the BRAE significantly shortened the colon length (Figure 3c and d). Oral DSS water can disrupt the integrity of the colonic epithelial barrier, allowing it to penetrate bacterial influx, thereby stimulating the inflammatory response. Splenomegaly often occurs in patients with IBD, and spleen weight is defined as an indicator of a systemic inflammatory phenotype. DSS induces splenomegaly in mice with colitis. As expected, BRAE significantly reversed splenomegaly in colitis mice (Figure 3b).

DAI reflects the degree of colitis injury. In the experiment, DSS was used to induce the mouse model of chronic UC and 200 mg/kg BRAE was used to treat it. As shown in Figure 4, the DAI score of BRAE-treated mice was significantly lower than that of the model group.

Figure 4 DAI. Data represent mean ± SD (n = 10). ***P < 0.001.
Figure 4

DAI. Data represent mean ± SD (n = 10). ***P < 0.001.

Histopathological images of the distal colon (Figure 5) showed significant inflammatory response in the DSS group with goblet cell loss, hyperemia, and mucosal damage. BRAE significantly improved crypt structure and reduced edema, mucosal damage, and inflammatory cell infiltration.

Figure 5 Representative pictures of H&E-stained colon tissue.
Figure 5

Representative pictures of H&E-stained colon tissue.

3.3 BRAE inhibits the release of pro-inflammatory cytokines

Cytokines play an important role in the etiology of IBD. To investigate systemic inflammatory pathways induced by intestinal inflammation, we examined serum levels of two major pro-inflammatory cytokines, IL-6 and TNF-α. After DSS treatment, serum levels of IL-6 and TNF-α were significantly upregulated, while BRAE significantly inhibited the production of these two pro-inflammatory cytokines (Figure 6).

Figure 6 Serum concentrations of inflammatory cytokines TNF-α (a) and IL-6 (b). Data represent mean ± SD (n = 10), ***P < 0.001.
Figure 6

Serum concentrations of inflammatory cytokines TNF-α (a) and IL-6 (b). Data represent mean ± SD (n = 10), ***P < 0.001.

The colorectal mucosa of patients with IBD is characterized by an increased number of T helper cell-17 (Th-17). We further detected the gene expression levels of Il-17a, Il-23a, and Il-6 in mouse colon tissues by fluorescence quantitative PCR and found that DSS treatment significantly increased the gene expression levels of Il-17a, Il-23a, and Il-6, while BRAE inhibited the expression of related genes (Figure 7).

Figure 7 BRAE alleviates colonic inflammation gene expression in DSS-induced colitis mice.
Figure 7

BRAE alleviates colonic inflammation gene expression in DSS-induced colitis mice.

3.4 Overall changes in gut microbiota

After high-throughput sequencing, the OTU petal diagram of each sample was drawn according to different groups. Different samples were represented by different colors. The petal part was OUT unique to each sample, and the flower center part was OUT common to all samples. As shown in Figure 8, there were 681 OTUs in the normal group, 603 OTUs in the model group, 605 OTUs in the BRAE group, and 448 OTUs in the same OTUs among the three groups, indicating that there was a great difference in the bacterial community structure among the groups, and the total OTUs of the bacterial community decreased after DSS induction and increased after BRAE administration.

Figure 8 BRAE inhibited DSS-induced decrease of gut microbiota diversity in mice. (a) OTU petal diagram, the petal part is OTU unique to each group, and the flower center is the OTU shared by all samples; (b) sample sparsity curve.
Figure 8

BRAE inhibited DSS-induced decrease of gut microbiota diversity in mice. (a) OTU petal diagram, the petal part is OTU unique to each group, and the flower center is the OTU shared by all samples; (b) sample sparsity curve.

The sparse curve can directly reflect the rationality of the amount of sequencing data and indirectly reflect the richness of the species in the sample. This sparse curve (Figure 8b) tends to be flattened, indicating that the amount of sequencing data is progressive and reasonable, and the more the data, the fewer the new OTUs generated. At the same sequencing depth, by comparing OTU numbers of different samples, the species abundance in the modeling group was lower than that in the normal group, while the species abundance increased after the BRAE treatment.

3.5 Changes in beta diversity of gut microbiota

In the beta diversity analysis, PCoA analysis and metric multidimensional NMDS analysis for dimensionality reduction were used to compare the differences between groups. The results in Figure 9 showed that the samples in each group could be significantly distinguished, indicating that modeling and BRAE treatment had a certain impact on the intestinal microflora structure of mice. The PCoA analysis showed that modeling factors had the greatest impact on intestinal microflora. Compared with the model group, it was obvious from the NMDS analysis chart that the gut microbiota structure of the treatment group had a certain deviation, and the flora structure of the BRAE treatment group had a trend of regression to the normal control group.

Figure 9 Beta diversity inter-group matrix. (a) PCoA bray_curtis and (b) NMDS bray_curtis.
Figure 9

Beta diversity inter-group matrix. (a) PCoA bray_curtis and (b) NMDS bray_curtis.

3.6 Species annotation and difference analysis of gut microbiota

By comparing the OTU representative sequences with the microbial reference database, the species classification information corresponding to each OTU can be obtained, and then, the community composition of each group at the phylum and genus levels can be counted, and the species abundance tables at different taxonomic levels can be generated to evaluate the differences in species composition of each group at the phylum and genus levels. The results are shown in Figure 10a and b, from the phylum-level species distribution map. The dominant phyla mainly include Bacteroidota, Verrucomicrobiota, Firmicutes, Proteobacteria, Campylobacterota, Desulfobacterota, and Cyanobacteria. Other bacteria accounted for a small proportion. Compared with the normal group, the abundance of Bacteroidota and Firmicutes decreased in the model group, while the abundance of Proteobacteria increased. Compared with the model group, the abundance of Verrucomicrobiota in the BRAE treatment group increased while that of Proteobacteria decreased.

Figure 10 Distribution map of species in each group. (a) Relative abundance of gut microbiota at the phylum level; (b) relative abundance of gut microbiota at the genus level.
Figure 10

Distribution map of species in each group. (a) Relative abundance of gut microbiota at the phylum level; (b) relative abundance of gut microbiota at the genus level.

The map of the subordinate horizontal species shows that at the genus level, the dominant species were Lachnospiraceae NK4A136 group, Akkermansia, Bacteroides, Parasutterella, Herbaspirillum and Rikenellaceae RC9 gut group, Lactobacillus, and Desulfovibrio. Compared with the normal group, the abundance of Bacteroides, Parasutterella, and Herbaspirillum in the model group increased, while the abundance of Lactobacillus and Desulfovibrio decreased. Compared with the model group, the abundance of Akkermansia and Candidatus Saccharimonas increased in the BRAE group, while the abundance of Bacteroides, Lachnospiraceae NK4A136 group, and Parasutterella decreased.

The LEfSe software was used to compare and analyze the species diversity of the gut microbiota of the three groups of mice. First, non-parametric Kruskal–Wallis (KW) rank sum test was used to detect the species with significant abundance differences between different groups. Then, Wilcoxon rank sum test of groups was used to judge the difference between groups. Finally, linear discriminant analysis (LDA) was used to evaluate the impact size of significantly different species. The value of LDA score represents the impact size of different species. In this study, LDA score was set to be greater than 3.5, and the LEfSe cladogram of the bacterial community was drawn (Figure 11). The inside-out circle represents the level of classification from the gate to the species. Each small circle represents a level of classification at a different classification level, and the diameter of the small circle is proportional to the relative abundance. Species with no significant differences are yellow, and the next group of biomarkers of different species is yellow. The green node represented the microbial group that played an important role in the normal control group, the blue node represented the microbial group that played a major role in the DSS-induced chronic UC model group, and the red nodes represented the microbiome that played an important role in the BRAE treatment group.

Figure 11 Species diversity of the gut microbiota analyzed by LEfSe based on LDA score. (a) LDA score for the bacterial taxa differentially abundant (LDA > 3.5); (b) cladograms generated by LEfSe indicating differences in the groups; (c–f) gut microbiota biomarker.
Figure 11

Species diversity of the gut microbiota analyzed by LEfSe based on LDA score. (a) LDA score for the bacterial taxa differentially abundant (LDA > 3.5); (b) cladograms generated by LEfSe indicating differences in the groups; (c–f) gut microbiota biomarker.

The LEfSe analysis based on LDA found that, at the genus level, Lactobacillus, Eubacterium brachy group, and Peptococcus were relatively abundant in the normal control group. The abundance of Bacteroides, Rikenellaceae RC9 gut group, and Parabacteroides was higher in the chronic colitis model group. However, the abundance of Akkermansia, Defluviitaleaceae UCG-011, and Acetitomaculum was higher in the BRAE group.

4 Discussion

IBD has become a global disease, and there is an urgent need to develop effective drugs to treat it. At present, there is no cure for IBD. Aminosalicylate, corticosteroids, biological immunomodulatory drugs are used clinically to reduce inflammation and relieve symptoms of IBD. Long-term medication in patients with IBD is important for the maintenance of efficacy, but long-term side effects are worrisome [27]. In contrast, alternative medicine therapy has unique advantages in the treatment of UC, especially in the prevention of recurrence [28]. Anthocyanins have significant potential in the treatment of IBD. Due to the very low oral bioavailability, the mechanism of action of anthocyanins in the treatment of IBD is still unclear, which greatly hinders the development of new drugs for the treatment of IBD by anthocyanins in clinical practice [29]. Given how poorly anthocyanins are absorbed in the body, the amount of the drug in feces is much higher than that in mouse plasma, so the gut may be the primary site where anthocyanins work.

As we know, the gut microbiota is important to sustain human health. Under physiological conditions, symbiotic physiological anaerobic bacteria, symbiotic conditional pathogenic bacteria and other harmful bacteria co-exist in the intestinal tract in a stable proportion [30]. Under normal circumstances, microbiota in dynamic equilibrium, once the flora imbalance, will lead to conditional pathogenic bacteria group or pathogenic bacteria group increased to the extent of the disease, and this leads to the development of intestinal diseases. Therefore, the balance of gut microbiota acts as a natural barrier to prevent the invasion of foreign pathogens. It is estimated that trillions of microbes live in a symbiotic relationship with their hosts in the human gut, performing basic functions of healthy individuals such as nutrition, host defense, and immune development [31]. In most healthy individuals, 99% of the gut microbiota consists of Firmicutes, Bacteroidetes, proteobacteria, and actinobacteria, of which Firmicutes and Bacteroidetes together account for about 90% [15]. Intestinal dysregulation occurs when the diversity, composition, or function of the gut microbiome is disrupted, negatively affecting the individual, for example, loss of microbiota homeostasis and inappropriate immune activation [32].

Gut microbiota plays an important role in the pathogenesis, development, and recovery of UC. Related studies have shown that the changes of gut microbiota in UC patients are closely related to the degree of inflammation [33]. The imbalance of gut microbiota is mainly manifested in the increase of pathogenic bacteria. The intestinal toxins secreted by UC patients increase the permeability of intestinal epithelium, and the bacteria and their products in the intestinal lumen enter the lamina propria of intestinal mucosa, resulting in mucosal immune disorders and damage to the intestinal mucosal barrier [34]. Furthermore, it affects and alters the diversity and composition of the gut microbiome.

In this study, OTU petal plot, species accumulation curve, beta diversity, and other results showed that DSS modeling significantly reduced the abundance and diversity of gut microbiota in mice, and the imbalance of gut microbiota was an important cause of intestinal mucosal inflammation. After treatment with BRAE, intestinal inflammation may be alleviated by restoring the abundance and diversity of gut microbiota. According to the species annotation and difference analysis results of gut microbiota, there were significant differences in phylum and the genus classification of gut microbiota before and after modeling and treatment. Changes in the abundance of Firmicutes and Bacteroides can be used as an important indicator to measure the structural changes of gut microbiota and can be used to evaluate whether the bacterial structure of UC tends to balance after drug intervention [35]. After treatment, Firmicutes were significantly increased and bacteroidetes were inhibited. Similarly, Fang et al. [36] found in clinical studies that the gut microbiota structure of IBD patients showed a decrease in the proportion of Firmicutes and an increase in the proportion of Bacteroidetes, both of which were consistent with the results of this study.

IBD patients showed decreased biodiversity (mainly firmicutes), decreased stability, and increased proteobacteria, such as Enterobacteriaceae and choleophilia [37]. Reduced microbial diversity results in the loss or reduction of important functions that maintain the integrity of the intestinal barrier and regulate the host immune system. At the same time, mucilage-dissolving bacteria and pathogenic bacteria also increase, leading to the damage of the mucosal barrier, allowing more pathogens to invade the intestinal tissue. In this study, 16S rDNA high-throughput sequencing was used to analyze the gut microbiota. The results showed that, similar to clinical IBD patients, the abundance of Bacteroides increased in the DSS-induced colitis mouse model, while the ratio of Firmicutes to Bacteroides decreased. After continuous intervention, BRAE can significantly improve the intestinal microflora disorder associated with colitis, especially increase the relative abundance of probiotics Akkermansia, suggesting that BRAE has certain prebiotic function.

5 Conclusion

The interaction between intestinal flora and intestinal mucosa is essential for maintaining immune system homeostasis. UC occurs due to the atrophy of beneficial bacteria in the gut and the increase of pathogenic bacteria, which leads to mucosal inflammation of the colon. According to the aforementioned experimental results, It is speculated that BRAE achieves the effect of treating UC by adjusting the abundance and diversity of bacteria to restore the normal structure of the bacteria to promote the increase of anti-inflammatory factors and the decrease of pro-inflammatory factors to reduce intestinal inflammatory response and promote the recovery of colonic mucosa.

# These authors contributed equally to this work.

Acknowledgements

The authors thank the technical engineers at Novogene (Beijing, China) for their help in interpreting the Metagenomic data.

  1. Funding information: This work was supported by the Natural Science Foundation of Hubei Province (2020CFB835).

  2. Author contributions: Yanmei Li: conceptualization, funding acquisition, investigation and writing – original draft; Fahu Yuan: methodology, data curation, investigation, project administration, validation, and visualization; Xiaohong He: formal analysis, methodology, and resources; Shaohua Fu: data curation, resources, validation, and visualization; Bolin Fan: data curation, formal analysis, methodology, and writing – review and editing.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Ethical approval: The breeding and the use of animals involved in this study were in accordance with the regulations of the Animal Ethics Committee of Jianghan University and were permitted (license number: JHDXLL2022-085).

  5. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Letizia M, Wang Y, Kaufmann U, Gerbeth L, Sand A, Brunkhorst M, et al. Store-operated calcium entry controls innate and adaptive immune cell function in inflammatory bowel disease. EMBO Mol Med. 2022;14(9):e15687.10.15252/emmm.202215687Search in Google Scholar PubMed PubMed Central

[2] Pena-Rodríguez E, Lajarin-Reinares M, Mata-Ventosa A, Pérez-Torras S, Fernández-Campos F. Dexamethasone-loaded lipomers: Development, characterization, and skin biodistribution studies. Pharmaceutics. 2021;13(4):533.10.3390/pharmaceutics13040533Search in Google Scholar PubMed PubMed Central

[3] Cars T, Wettermark B, Löfberg R, Eriksson I, Sundström J, Lördal M. Healthcare utilisation and drug treatment in a large cohort of patients with inflammatory bowel disease. J Crohn’s Colitis. 2016;10(5):556–65.10.1093/ecco-jcc/jjv243Search in Google Scholar PubMed PubMed Central

[4] Meserve J, Facciorusso A, Holmer A, Annese V, Sandborn W, Singh S. Systematic review with meta-analysis: Safety and tolerability of immune checkpoint inhibitors in patients with pre-existing inflammatory bowel diseases. Aliment Pharmacol Ther. 2021;53(3):374–82.10.1111/apt.16217Search in Google Scholar

[5] Almeida V, Dias Ê, Souza B, Cruz J, Santos C, Leite F, et al. Methoxylated flavonols from Seub ethyl acetate active myeloperoxidase extract: in vitro and in silico assays. J Biomol Struct Dyn. 2022;40(16):7574–83.10.1080/07391102.2021.1900916Search in Google Scholar PubMed

[6] Pinto V, Araújo J, Silva R, da Costa G, Cruz J, De A, et al. In silico study to identify new antituberculosis molecules from natural sources by hierarchical virtual screening and molecular dynamics simulations. Pharm (Basel, Switz). 2019;12:1.10.3390/ph12010036Search in Google Scholar PubMed PubMed Central

[7] Vale VV, Cruz JN, Viana GMR, Póvoa MM, Brasil DDSB, Dolabela MF. Naphthoquinones isolated from Eleutherine plicata herb: In vitro antimalarial activity and molecular modeling to investigate their binding modes. Med Chem Res. 2020;29(3):487–94.10.1007/s00044-019-02498-zSearch in Google Scholar

[8] da Rocha Galucio NC, de Araújo Moysés D, Pina JRS, Marinho PSB, Gomes Júnior PC, Cruz JN, et al. Antiproliferative, genotoxic activities and quantification of extracts and cucurbitacin B obtained from Luffa operculata (L.) Cogn. Arab J Chem. 2022;15(2):103589.10.1016/j.arabjc.2021.103589Search in Google Scholar

[9] Sanderlin E, Marie M, Velcicky J, Loetscher P, Yang L. Pharmacological inhibition of GPR4 remediates intestinal inflammation in a mouse colitis model. Eur J Pharmacol. 2019;852:218–30.10.1016/j.ejphar.2019.03.038Search in Google Scholar PubMed PubMed Central

[10] Kotla N, Isa I, Rasala S, Demir S, Singh R, Baby B, et al. Modulation of gut barrier functions in ulcerative colitis by hyaluronic acid system. Adv Sci (Weinheim, Baden-Wurttemberg, Germany). 2022;9(4):e2103189.10.1002/advs.202103189Search in Google Scholar PubMed PubMed Central

[11] Cui M, Xiao H, Li Y, Zhou L, Zhao S, Luo D, et al. Faecal microbiota transplantation protects against radiation-induced toxicity. EMBO Mol Med. 2017;9(4):448–61.10.15252/emmm.201606932Search in Google Scholar PubMed PubMed Central

[12] Yang S, Liang X, Song J, Li C, Liu A, Luo Y, et al. A novel therapeutic approach for inflammatory bowel disease by exosomes derived from human umbilical cord mesenchymal stem cells to repair intestinal barrier via TSG-6. Stem Cell Res Ther. 2021;12(1):315.10.1186/s13287-021-02404-8Search in Google Scholar PubMed PubMed Central

[13] García-Díaz M, Cendra M, Alonso-Roman R, Urdániz M, Torrents E, Martínez E. Mimicking the intestinal host-pathogen interactions in a 3D in vitro model: The role of the mucus layer. Pharmaceutics. 2022;14(8):1552.10.3390/pharmaceutics14081552Search in Google Scholar PubMed PubMed Central

[14] Lechuga S, Naydenov N, Feygin A, Cruise M, Ervasti J, Ivanov A. Loss of β-cytoplasmic actin in the intestinal epithelium increases gut barrier permeability and exaggerates the severity of experimental colitis. Front Cell Dev Biol. 2020;8:588836.10.3389/fcell.2020.588836Search in Google Scholar PubMed PubMed Central

[15] Guo J, Ma B, Wang Z, Chen Y, Tian W, Dong Y. Royal jelly protected against dextran-sulfate-sodium-induced colitis by improving the colonic mucosal barrier and gut microbiota. Nutrients. 2022;14(10):2069.10.3390/nu14102069Search in Google Scholar PubMed PubMed Central

[16] Sabater C, Calvete-Torre I, Ruiz L, Margolles A. Arabinoxylan and pectin metabolism in Crohn’s disease microbiota: An study. Int J Mol Sci. 2022;23(13):7093.10.3390/ijms23137093Search in Google Scholar PubMed PubMed Central

[17] Grabinger T, Glaus Garzon J, Hausmann M, Geirnaert A, Lacroix C, Hennet T. Alleviation of intestinal inflammation by oral supplementation with 2-Fucosyllactose in mice. Front Microbiol. 2019;10:1385.10.3389/fmicb.2019.01385Search in Google Scholar PubMed PubMed Central

[18] Čipčić Paljetak H, Barešić A, Panek M, Perić M, Matijašić M, Lojkić I, et al. Gut microbiota in mucosa and feces of newly diagnosed, treatment-naïve adult inflammatory bowel disease and irritable bowel syndrome patients. Gut Microbes. 2022;14(1):2083419.10.1080/19490976.2022.2083419Search in Google Scholar PubMed PubMed Central

[19] Ju J, Cho Y, Park K, Kwak H, Jin H, Park S, et al. Activation, deficiency, and reduced IFN-γ production of mucosal-associated invariant T cells in patients with inflammatory bowel disease. J Innate Immun. 2020;12(5):422–34.10.1159/000507931Search in Google Scholar PubMed PubMed Central

[20] Xu S, Zhang X, Liu S, Feng S, Xiang G, Xu C, et al. Multi-omic analysis in a metabolic syndrome porcine model implicates arachidonic acid metabolism disorder as a risk factor for atherosclerosis. Front Nutr. 2022;9:807118.10.3389/fnut.2022.807118Search in Google Scholar PubMed PubMed Central

[21] Grosso G, Godos J, Currenti W, Micek A, Falzone L, Libra M, et al. The effect of dietary polyphenols on vascular health and hypertension: Current evidence and mechanisms of action. Nutrients. 2022;14(3):545.10.3390/nu14030545Search in Google Scholar PubMed PubMed Central

[22] Mu J, Xu J, Wang L, Chen C, Chen P. Anti-inflammatory effects of purple sweet potato anthocyanin extract in DSS-induced colitis: Modulation of commensal bacteria and attenuated bacterial intestinal infection. Food Funct. 2021;12(22):11503–14.10.1039/D1FO02454JSearch in Google Scholar

[23] Song H, Shen X, Zhou Y, Zheng X. Black rice anthocyanins alleviate hyperlipidemia, liver steatosis and insulin resistance by regulating lipid metabolism and gut microbiota in obese mice. Food Funct. 2021;12(20):10160–70.10.1039/D1FO01394GSearch in Google Scholar PubMed

[24] Bae I, An J, Oh I, Lee H. Optimized preparation of anthocyanin-rich extract from black rice and its effects on in vitro digestibility. Food Sci Biotechnol. 2017;26(5):1415–22.10.1007/s10068-017-0188-xSearch in Google Scholar PubMed PubMed Central

[25] Ghia J, Blennerhassett P, Collins S. Impaired parasympathetic function increases susceptibility to inflammatory bowel disease in a mouse model of depression. J Clin Invest. 2008;118(6):2209–18.10.1172/JCI32849Search in Google Scholar PubMed PubMed Central

[26] Khounlotham M, Kim W, Peatman E, Nava P, Medina-Contreras O, Addis C, et al. Compromised intestinal epithelial barrier induces adaptive immune compensation that protects from colitis. Immunity. 2012;37(3):563–73.10.1016/j.immuni.2012.06.017Search in Google Scholar PubMed PubMed Central

[27] Sarkate A, Dhaneshwar S. Investigation of mitigating effect of colon-specific prodrugs of boswellic acid on 2,4,6-trinitrobenzene sulfonic acid-induced colitis in Wistar rats: Design, kinetics and biological evaluation. World J Gastroenterol. 2017;23(7):1147–62.10.3748/wjg.v23.i7.1147Search in Google Scholar PubMed PubMed Central

[28] Moura F, de Andrade K, de Araújo O, Nunes-Souza V, Santos J, Rabelo L, et al. Colonic and hepatic modulation by lipoic acid and/or N-acetylcysteine supplementation in mild ulcerative colitis induced by dextran sodium sulfate in rats. Oxid Med Cell Longev. 2016;2016:4047362.10.1155/2016/4047362Search in Google Scholar PubMed PubMed Central

[29] Hidalgo J, Teuber S, Morera F, Ojeda C, Flores C, Hidalgo M, et al. Delphinidin reduces glucose uptake in mice jejunal tissue and human intestinal cells lines through FFA1/GPR40. Int J Mol Sci. 2017;18(4):750.10.3390/ijms18040750Search in Google Scholar PubMed PubMed Central

[30] Fu R, Li Z, Zhou R, Li C, Shao S, Li J. The mechanism of intestinal flora dysregulation mediated by intestinal bacterial biofilm to induce constipation. Bioengineered. 2021;12(1):6484–98.10.1080/21655979.2021.1973356Search in Google Scholar PubMed PubMed Central

[31] Bindels L, Neyrinck A, Claus S, Le Roy C, Grangette C, Pot B, et al. Synbiotic approach restores intestinal homeostasis and prolongs survival in leukaemic mice with cachexia. ISME J. 2016;10(6):1456–70.10.1038/ismej.2015.209Search in Google Scholar PubMed PubMed Central

[32] Tang S, Zhong R, Yin C, Su D, Xie J, Chen L, et al. Exposure to high aerial ammonia causes hindgut dysbiotic microbiota and alterations of microbiota-derived metabolites in growing pigs. Front Nutr. 2021;8:689818.10.3389/fnut.2021.689818Search in Google Scholar PubMed PubMed Central

[33] Xu X, Gao Z, Yang F, Yang Y, Chen L, Han L, et al. Antidiabetic effects of gegen qinlian decoction via the gut microbiota are attributable to its key ingredient berberine. Genomics Proteom Bioinforma. 2020;18(6):721–36.10.1016/j.gpb.2019.09.007Search in Google Scholar PubMed PubMed Central

[34] Fedorov A, Chelombitko M, Chernyavskij D, Galkin I, Pletjushkina O, Vasilieva T, et al. Mitochondria-targeted antioxidant SkQ1 prevents the development of experimental colitis in mice and impairment of the barrier function of the intestinal epithelium. Cells. 2022;11(21):3441.10.3390/cells11213441Search in Google Scholar PubMed PubMed Central

[35] Ma X, Hu Y, Li X, Zheng X, Wang Y, Zhang J, et al. Periplaneta americana ameliorates dextran sulfate sodium-induced ulcerative colitis in rats by Keap1/Nrf-2 activation, intestinal barrier function, and gut microbiota regulation. Front Pharmacol. 2018;9:944.10.3389/fphar.2018.00944Search in Google Scholar PubMed PubMed Central

[36] Fang H, Fu L, Li X, Lu C, Su Y, Xiong K, et al. Long-term efficacy and safety of monotherapy with a single fresh fecal microbiota transplant for recurrent active ulcerative colitis: a prospective randomized pilot study. Microb Cell Fact. 2021;20(1):18.10.1186/s12934-021-01513-6Search in Google Scholar PubMed PubMed Central

[37] Davenport M, Poles J, Leung J, Wolff M, Abidi W, Ullman T, et al. Metabolic alterations to the mucosal microbiota in inflammatory bowel disease. Inflamm Bowel Dis. 2014;20(4):723–31.10.1097/MIB.0000000000000011Search in Google Scholar PubMed PubMed Central

Received: 2022-12-06
Revised: 2023-01-31
Accepted: 2023-02-06
Published Online: 2023-02-24

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Characteristics, source, and health risk assessment of aerosol polyaromatic hydrocarbons in the rural and urban regions of western Saudi Arabia
  2. Regular Articles
  3. A network-based correlation research between element electronegativity and node importance
  4. Pomegranate attenuates kidney injury in cyclosporine-induced nephrotoxicity in rats by suppressing oxidative stress
  5. Ab initio study of fundamental properties of XInO3 (X = K, Rb, Cs) perovskites
  6. Responses of feldspathic sandstone and sand-reconstituted soil C and N to freeze–thaw cycles
  7. Robust fractional control based on high gain observers design (RNFC) for a Spirulina maxima culture interfaced with an advanced oxidation process
  8. Study on arsenic speciation and redistribution mechanism in Lonicera japonica plants via synchrotron techniques
  9. Optimization of machining Nilo 36 superalloy parameters in turning operation
  10. Vacuum impregnation pre-treatment: A novel method for incorporating mono- and divalent cations into potato strips to reduce the acrylamide formation in French fries
  11. Characterization of effective constituents in Acanthopanax senticosus fruit for blood deficiency syndrome based on the chinmedomics strategy
  12. Comparative analysis of the metabolites in Pinellia ternata from two producing regions using ultra-high-performance liquid chromatography–electrospray ionization–tandem mass spectrometry
  13. The assessment of environmental parameter along the desalination plants in the Kingdom of Saudi Arabia
  14. Effects of harpin and carbendazim on antioxidant accumulation in young jujube leaves
  15. The effects of in ovo injected with sodium borate on hatching performance and small intestine morphology in broiler chicks
  16. Optimization of cutting forces and surface roughness via ANOVA and grey relational analysis in machining of In718
  17. Essential oils of Origanum compactum Benth: Chemical characterization, in vitro, in silico, antioxidant, and antibacterial activities
  18. Translocation of tungsten(vi) oxide/gadolinium(iii) fluoride in tellurite glasses towards improvement of gamma-ray attenuation features in high-density glass shields
  19. Mechanical properties, elastic moduli, and gamma ray attenuation competencies of some TeO2–WO3–GdF3 glasses: Tailoring WO3–GdF3 substitution toward optimum behavioral state range
  20. Comparison between the CIDR or sponge with hormone injection to induce estrus synchronization for twining and sex preselection in Naimi sheep
  21. Exergetic performance analyses of three different cogeneration plants
  22. Psoralea corylifolia (babchi) seeds enhance proliferation of normal human cultured melanocytes: GC–MS profiling and biological investigation
  23. A novel electrochemical micro-titration method for quantitative evaluation of the DPPH free radical scavenging capacity of caffeic acid
  24. Comparative study between supported bimetallic catalysts for nitrate remediation in water
  25. Persicaline, an alkaloid from Salvadora persica, inhibits proliferation and induces apoptosis and cell-cycle arrest in MCF-7 cells
  26. Determination of nicotine content in locally produced smokeless tobacco (Shammah) samples from Jazan region of Saudi Arabia using a convenient HPLC-MS/MS method
  27. Changes in oxidative stress markers in pediatric burn injury over a 1-week period
  28. Integrated geophysical techniques applied for petroleum basins structural characterization in the central part of the Western Desert, Egypt
  29. The impact of chemical modifications on gamma-ray attenuation properties of some WO3-reinforced tellurite glasses
  30. Microwave and Cs+-assisted chemo selective reaction protocol for synthesizing 2-styryl quinoline biorelevant molecules
  31. Structural, physical, and radiation absorption properties of a significant nuclear power plant component: A comparison between REX-734 and 316L SS austenitic stainless steels
  32. Effect of Moringa oleifera on serum YKL-40 level: In vivo rat periodontitis model
  33. Investigating the impact of CO2 emissions on the COVID-19 pandemic by generalized linear mixed model approach with inverse Gaussian and gamma distributions
  34. Influence of WO3 content on gamma rays attenuation characteristics of phosphate glasses at low energy range
  35. Study on CO2 absorption performance of ternary DES formed based on DEA as promoting factor
  36. Performance analyses of detonation engine cogeneration cycles
  37. Sterols from Centaurea pumilio L. with cell proliferative activity: In vitro and in silico studies
  38. Untargeted metabolomics revealing changes in aroma substances in flue-cured tobacco
  39. Effect of pumpkin enriched with calcium lactate on iron status in an animal model of postmenopausal osteoporosis
  40. Energy consumption, mechanical and metallographic properties of cryogenically treated tool steels
  41. Optimization of ultra-high pressure-assisted extraction of total phenols from Eucommia ulmoides leaves by response surface methodology
  42. Harpin enhances antioxidant nutrient accumulation and decreases enzymatic browning in stored soybean sprouts
  43. Physicochemical and biological properties of carvacrol
  44. Radix puerariae in the treatment of diabetic nephropathy: A network pharmacology analysis and experimental validation
  45. Anti-Alzheimer, antioxidants, glucose-6-phosphate dehydrogenase effects of Taverniera glabra mediated ZnO and Fe2O3 nanoparticles in alloxan-induced diabetic rats
  46. Experimental study on photocatalytic CO2 reduction performance of ZnS/CdS-TiO2 nanotube array thin films
  47. Epoxy-reinforced heavy metal oxides for gamma ray shielding purposes
  48. Black mulberry (Morus nigra L.) fruits: As a medicinal plant rich in human health-promoting compounds
  49. Promising antioxidant and antimicrobial effects of essential oils extracted from fruits of Juniperus thurifera: In vitro and in silico investigations
  50. Chloramine-T-induced oxidation of Rizatriptan Benzoate: An integral chemical and spectroscopic study of products, mechanisms and kinetics
  51. Study on antioxidant and antimicrobial potential of chemically profiled essential oils extracted from Juniperus phoenicea (L.) by use of in vitro and in silico approaches
  52. Screening and characterization of fungal taxol-producing endophytic fungi for evaluation of antimicrobial and anticancer activities
  53. Mineral composition, principal polyphenolic components, and evaluation of the anti-inflammatory, analgesic, and antioxidant properties of Cytisus villosus Pourr leaf extracts
  54. In vitro antiproliferative efficacy of Annona muricata seed and fruit extracts on several cancer cell lines
  55. An experimental study for chemical characterization of artificial anterior cruciate ligament with coated chitosan as biomaterial
  56. Prevalence of residual risks of the transfusion-transmitted infections in Riyadh hospitals: A two-year retrospective study
  57. Computational and experimental investigation of antibacterial and antifungal properties of Nicotiana tabacum extracts
  58. Reinforcement of cementitious mortars with hemp fibers and shives
  59. X-ray shielding properties of bismuth-borate glass doped with rare earth ions
  60. Green supported silver nanoparticles over modified reduced graphene oxide: Investigation of its antioxidant and anti-ovarian cancer effects
  61. Orthogonal synthesis of a versatile building block for dual functionalization of targeting vectors
  62. Thymbra spicata leaf extract driven biogenic synthesis of Au/Fe3O4 nanocomposite and its bio-application in the treatment of different types of leukemia
  63. The role of Ag2O incorporation in nuclear radiation shielding behaviors of the Li2O–Pb3O4–SiO2 glass system: A multi-step characterization study
  64. A stimuli-responsive in situ spray hydrogel co-loaded with naringenin and gentamicin for chronic wounds
  65. Assessment of the impact of γ-irradiation on the piperine content and microbial quality of black pepper
  66. Antioxidant, sensory, and functional properties of low-alcoholic IPA beer with Pinus sylvestris L. shoots addition fermented using unconventional yeast
  67. Screening and optimization of extracellular pectinase produced by Bacillus thuringiensis SH7
  68. Determination of polyphenols in Chinese jujube using ultra-performance liquid chromatography–mass spectrometry
  69. Synergistic effects of harpin and NaCl in determining soybean sprout quality under non-sterile conditions
  70. Field evaluation of different eco-friendly alternative control methods against Panonychus citri [Acari: Tetranychidae] spider mite and its predators in citrus orchards
  71. Exploring the antimicrobial potential of biologically synthesized zero valent iron nanoparticles
  72. NaCl regulates goldfish growth and survival at three food supply levels under hypoxia
  73. An exploration of the physical, optical, mechanical, and radiation shielding properties of PbO–MgO–ZnO–B2O3 glasses
  74. A novel statistical modeling of air pollution and the COVID-19 pandemic mortality data by Poisson, geometric, and negative binomial regression models with fixed and random effects
  75. Treatment activity of the injectable hydrogels loaded with dexamethasone In(iii) complex on glioma by inhibiting the VEGF signaling pathway
  76. An alternative approach for the excess lifetime cancer risk and prediction of radiological parameters
  77. Panax ginseng leaf aqueous extract mediated green synthesis of AgNPs under ultrasound condition and investigation of its anti-lung adenocarcinoma effects
  78. Study of hydrolysis and production of instant ginger (Zingiber officinale) tea
  79. Novel green synthesis of zinc oxide nanoparticles using Salvia rosmarinus extract for treatment of human lung cancer
  80. Evaluation of second trimester plasma lipoxin A4, VEGFR-1, IL-6, and TNF-α levels in pregnant women with gestational diabetes mellitus
  81. Antidiabetic, antioxidant and cytotoxicity activities of ortho- and para-substituted Schiff bases derived from metformin hydrochloride: Validation by molecular docking and in silico ADME studies
  82. Antioxidant, antidiabetic, antiglaucoma, and anticholinergic effects of Tayfi grape (Vitis vinifera): A phytochemical screening by LC-MS/MS analysis
  83. Identification of genetic polymorphisms in the stearoyl CoA desaturase gene and its association with milk quality traits in Najdi sheep
  84. Cold-acclimation effect on cadmium absorption and biosynthesis of polyphenolics, and free proline and photosynthetic pigments in Spirogyra aequinoctialis
  85. Analysis of secondary metabolites in Xinjiang Morus nigra leaves using different extraction methods with UPLC-Q/TOF-MS/MS technology
  86. Nanoarchitectonics and performance evaluation of a Fe3O4-stabilized Pickering emulsion-type differential pressure plugging agent
  87. Investigating pyrolysis characteristics of Shengdong coal through Py-GC/MS
  88. Extraction, phytochemical characterization, and antifungal activity of Salvia rosmarinus extract
  89. Introducing a novel and natural antibiotic for the treatment of oral pathogens: Abelmoschus esculentus green-formulated silver nanoparticles
  90. Optimization of gallic acid-enriched ultrasonic-assisted extraction from mango peels
  91. Effect of gamma rays irradiation in the structure, optical, and electrical properties of samarium doped bismuth titanate ceramics
  92. Combinatory in silico investigation for potential inhibitors from Curcuma sahuynhensis Škorničk. & N.S. Lý volatile phytoconstituents against influenza A hemagglutinin, SARS-CoV-2 main protease, and Omicron-variant spike protein
  93. Physical, mechanical, and gamma ray shielding properties of the Bi2O3–BaO–B2O3–ZnO–As2O3–MgO–Na2O glass system
  94. Twofold interpenetrated 3D Cd(ii) complex: Crystal structure and luminescent property
  95. Study on the microstructure and soil quality variation of composite soil with soft rock and sand
  96. Ancient spring waters still emerging and accessible in the Roman Forum area: Chemical–physical and microbiological characterization
  97. Extraction and characterization of type I collagen from scales of Mexican Biajaiba fish
  98. Finding small molecular compounds to decrease trimethylamine oxide levels in atherosclerosis by virtual screening
  99. Prefatory in silico studies and in vitro insecticidal effect of Nigella sativa (L.) essential oil and its active compound (carvacrol) against the Callosobruchus maculatus adults (Fab), a major pest of chickpea
  100. Polymerized methyl imidazole silver bromide (CH3C6H5AgBr)6: Synthesis, crystal structures, and catalytic activity
  101. Using calcined waste fish bones as a green solid catalyst for biodiesel production from date seed oil
  102. Influence of the addition of WO3 on TeO2–Na2O glass systems in view of the feature of mechanical, optical, and photon attenuation
  103. Naringin ameliorates 5-fluorouracil elicited neurotoxicity by curtailing oxidative stress and iNOS/NF-ĸB/caspase-3 pathway
  104. GC-MS profile of extracts of an endophytic fungus Alternaria and evaluation of its anticancer and antibacterial potentialities
  105. Green synthesis, chemical characterization, and antioxidant and anti-colorectal cancer effects of vanadium nanoparticles
  106. Determination of caffeine content in coffee drinks prepared in some coffee shops in the local market in Jeddah City, Saudi Arabia
  107. A new 3D supramolecular Cu(ii) framework: Crystal structure and photocatalytic characteristics
  108. Bordeaux mixture accelerates ripening, delays senescence, and promotes metabolite accumulation in jujube fruit
  109. Important application value of injectable hydrogels loaded with omeprazole Schiff base complex in the treatment of pancreatitis
  110. Color tunable benzothiadiazole-based small molecules for lightening applications
  111. Investigation of structural, dielectric, impedance, and mechanical properties of hydroxyapatite-modified barium titanate composites for biomedical applications
  112. Metal gel particles loaded with epidermal cell growth factor promote skin wound repair mechanism by regulating miRNA
  113. In vitro exploration of Hypsizygus ulmarius (Bull.) mushroom fruiting bodies: Potential antidiabetic and anti-inflammatory agent
  114. Alteration in the molecular structure of the adenine base exposed to gamma irradiation: An ESR study
  115. Comprehensive study of optical, thermal, and gamma-ray shielding properties of Bi2O3–ZnO–PbO–B2O3 glasses
  116. Lewis acids as co-catalysts in Pd-based catalyzed systems of the octene-1 hydroethoxycarbonylation reaction
  117. Synthesis, Hirshfeld surface analysis, thermal, and selective α-glucosidase inhibitory studies of Schiff base transition metal complexes
  118. Protective properties of AgNPs green-synthesized by Abelmoschus esculentus on retinal damage on the virtue of its anti-inflammatory and antioxidant effects in diabetic rat
  119. Effects of green decorated AgNPs on lignin-modified magnetic nanoparticles mediated by Cydonia on cecal ligation and puncture-induced sepsis
  120. Treatment of gastric cancer by green mediated silver nanoparticles using Pistacia atlantica bark aqueous extract
  121. Preparation of newly developed porcelain ceramics containing WO3 nanoparticles for radiation shielding applications
  122. Utilization of computational methods for the identification of new natural inhibitors of human neutrophil elastase in inflammation therapy
  123. Some anticancer agents as effective glutathione S-transferase (GST) inhibitors
  124. Clay-based bricks’ rich illite mineral for gamma-ray shielding applications: An experimental evaluation of the effect of pressure rates on gamma-ray attenuation parameters
  125. Stability kinetics of orevactaene pigments produced by Epicoccum nigrum in solid-state fermentation
  126. Treatment of denture stomatitis using iron nanoparticles green-synthesized by Silybum marianum extract
  127. Characterization and antioxidant potential of white mustard (Brassica hirta) leaf extract and stabilization of sunflower oil
  128. Characteristics of Langmuir monomolecular monolayers formed by the novel oil blends
  129. Strategies for optimizing the single GdSrFeO4 phase synthesis
  130. Oleic acid and linoleic acid nanosomes boost immunity and provoke cell death via the upregulation of beta-defensin-4 at genetic and epigenetic levels
  131. Unraveling the therapeutic potential of Bombax ceiba roots: A comprehensive study of chemical composition, heavy metal content, antibacterial activity, and in silico analysis
  132. Green synthesis of AgNPs using plant extract and investigation of its anti-human colorectal cancer application
  133. The adsorption of naproxen on adsorbents obtained from pepper stalk extract by green synthesis
  134. Treatment of gastric cancer by silver nanoparticles encapsulated by chitosan polymers mediated by Pistacia atlantica extract under ultrasound condition
  135. In vitro protective and anti-inflammatory effects of Capparis spinosa and its flavonoids profile
  136. Wear and corrosion behavior of TiC and WC coatings deposited on high-speed steels by electro-spark deposition
  137. Therapeutic effects of green-formulated gold nanoparticles by Origanum majorana on spinal cord injury in rats
  138. Melanin antibacterial activity of two new strains, SN1 and SN2, of Exophiala phaeomuriformis against five human pathogens
  139. Evaluation of the analgesic and anesthetic properties of silver nanoparticles supported over biodegradable acacia gum-modified magnetic nanoparticles
  140. Review Articles
  141. Role and mechanism of fruit waste polyphenols in diabetes management
  142. A comprehensive review of non-alkaloidal metabolites from the subfamily Amaryllidoideae (Amaryllidaceae)
  143. Discovery of the chemical constituents, structural characteristics, and pharmacological functions of Chinese caterpillar fungus
  144. Eco-friendly green approach of nickel oxide nanoparticles for biomedical applications
  145. Advances in the pharmaceutical research of curcumin for oral administration
  146. Rapid Communication
  147. Determination of the contents of bioactive compounds in St. John’s wort (Hypericum perforatum): Comparison of commercial and wild samples
  148. Retraction
  149. Retraction of “Two mixed-ligand coordination polymers based on 2,5-thiophenedicarboxylic acid and flexible N-donor ligands: The protective effect on periodontitis via reducing the release of IL-1β and TNF-α”
  150. Topical Issue on Phytochemicals, biological and toxicological analysis of aromatic medicinal plants
  151. Anti-plasmodial potential of selected medicinal plants and a compound Atropine isolated from Eucalyptus obliqua
  152. Anthocyanin extract from black rice attenuates chronic inflammation in DSS-induced colitis mouse model by modulating the gut microbiota
  153. Evaluation of antibiofilm and cytotoxicity effect of Rumex vesicarius methanol extract
  154. Chemical compositions of Litsea umbellata and inhibition activities
  155. Green synthesis, characterization of silver nanoparticles using Rhynchosia capitata leaf extract and their biological activities
  156. GC-MS analysis and antibacterial activities of some plants belonging to the genus Euphorbia on selected bacterial isolates
  157. The abrogative effect of propolis on acrylamide-induced toxicity in male albino rats: Histological study
  158. A phytoconstituent 6-aminoflavone ameliorates lipopolysaccharide-induced oxidative stress mediated synapse and memory dysfunction via p-Akt/NF-kB pathway in albino mice
  159. Anti-diabetic potentials of Sorbaria tomentosa Lindl. Rehder: Phytochemistry (GC-MS analysis), α-amylase, α-glucosidase inhibitory, in vivo hypoglycemic, and biochemical analysis
  160. Assessment of cytotoxic and apoptotic activities of the Cassia angustifolia aqueous extract against SW480 colon cancer
  161. Biochemical analysis, antioxidant, and antibacterial efficacy of the bee propolis extract (Hymenoptera: Apis mellifera) against Staphylococcus aureus-induced infection in BALB/c mice: In vitro and in vivo study
  162. Assessment of essential elements and heavy metals in Saudi Arabian rice samples underwent various processing methods
  163. Two new compounds from leaves of Capparis dongvanensis (Sy, B. H. Quang & D. V. Hai) and inhibition activities
  164. Hydroxyquinoline sulfanilamide ameliorates STZ-induced hyperglycemia-mediated amyleoid beta burden and memory impairment in adult mice
  165. An automated reading of semi-quantitative hemagglutination results in microplates: Micro-assay for plant lectins
  166. Inductively coupled plasma mass spectrometry assessment of essential and toxic trace elements in traditional spices consumed by the population of the Middle Eastern region in their recipes
  167. Phytochemical analysis and anticancer activity of the Pithecellobium dulce seed extract in colorectal cancer cells
  168. Impact of climatic disturbances on the chemical compositions and metabolites of Salvia officinalis
  169. Physicochemical characterization, antioxidant and antifungal activities of essential oils of Urginea maritima and Allium sativum
  170. Phytochemical analysis and antifungal efficiency of Origanum majorana extracts against some phytopathogenic fungi causing tomato damping-off diseases
  171. Special Issue on 4th IC3PE
  172. Graphene quantum dots: A comprehensive overview
  173. Studies on the intercalation of calcium–aluminium layered double hydroxide-MCPA and its controlled release mechanism as a potential green herbicide
  174. Synergetic effect of adsorption and photocatalysis by zinc ferrite-anchored graphitic carbon nitride nanosheet for the removal of ciprofloxacin under visible light irradiation
  175. Exploring anticancer activity of the Indonesian guava leaf (Psidium guajava L.) fraction on various human cancer cell lines in an in vitro cell-based approach
  176. The comparison of gold extraction methods from the rock using thiourea and thiosulfate
  177. Special Issue on Marine environmental sciences and significance of the multidisciplinary approaches
  178. Sorption of alkylphenols and estrogens on microplastics in marine conditions
  179. Cytotoxic ketosteroids from the Red Sea soft coral Dendronephthya sp.
  180. Antibacterial and biofilm prevention metabolites from Acanthophora spicifera
  181. Characteristics, source, and health risk assessment of aerosol polyaromatic hydrocarbons in the rural and urban regions of western Saudi Arabia
  182. Special Issue on Advanced Nanomaterials for Energy, Environmental and Biological Applications - Part II
  183. Green synthesis, characterization, and evaluation of antibacterial activities of cobalt nanoparticles produced by marine fungal species Periconia prolifica
  184. Combustion-mediated sol–gel preparation of cobalt-doped ZnO nanohybrids for the degradation of acid red and antibacterial performance
  185. Perinatal supplementation with selenium nanoparticles modified with ascorbic acid improves hepatotoxicity in rat gestational diabetes
  186. Evaluation and chemical characterization of bioactive secondary metabolites from endophytic fungi associated with the ethnomedicinal plant Bergenia ciliata
  187. Enhancing photovoltaic efficiency with SQI-Br and SQI-I sensitizers: A comparative analysis
  188. Nanostructured p-PbS/p-CuO sulfide/oxide bilayer heterojunction as a promising photoelectrode for hydrogen gas generation
https://doi.org/10.1515/chem-2022-0288
Keywords for this article
black rice anthocyanin; inflammation; inflammatory bowel disease; microbiota
Creative Commons
BY 4.0

Articles in the same Issue

  1. Characteristics, source, and health risk assessment of aerosol polyaromatic hydrocarbons in the rural and urban regions of western Saudi Arabia
  2. Regular Articles
  3. A network-based correlation research between element electronegativity and node importance
  4. Pomegranate attenuates kidney injury in cyclosporine-induced nephrotoxicity in rats by suppressing oxidative stress
  5. Ab initio study of fundamental properties of XInO3 (X = K, Rb, Cs) perovskites
  6. Responses of feldspathic sandstone and sand-reconstituted soil C and N to freeze–thaw cycles
  7. Robust fractional control based on high gain observers design (RNFC) for a Spirulina maxima culture interfaced with an advanced oxidation process
  8. Study on arsenic speciation and redistribution mechanism in Lonicera japonica plants via synchrotron techniques
  9. Optimization of machining Nilo 36 superalloy parameters in turning operation
  10. Vacuum impregnation pre-treatment: A novel method for incorporating mono- and divalent cations into potato strips to reduce the acrylamide formation in French fries
  11. Characterization of effective constituents in Acanthopanax senticosus fruit for blood deficiency syndrome based on the chinmedomics strategy
  12. Comparative analysis of the metabolites in Pinellia ternata from two producing regions using ultra-high-performance liquid chromatography–electrospray ionization–tandem mass spectrometry
  13. The assessment of environmental parameter along the desalination plants in the Kingdom of Saudi Arabia
  14. Effects of harpin and carbendazim on antioxidant accumulation in young jujube leaves
  15. The effects of in ovo injected with sodium borate on hatching performance and small intestine morphology in broiler chicks
  16. Optimization of cutting forces and surface roughness via ANOVA and grey relational analysis in machining of In718
  17. Essential oils of Origanum compactum Benth: Chemical characterization, in vitro, in silico, antioxidant, and antibacterial activities
  18. Translocation of tungsten(vi) oxide/gadolinium(iii) fluoride in tellurite glasses towards improvement of gamma-ray attenuation features in high-density glass shields
  19. Mechanical properties, elastic moduli, and gamma ray attenuation competencies of some TeO2–WO3–GdF3 glasses: Tailoring WO3–GdF3 substitution toward optimum behavioral state range
  20. Comparison between the CIDR or sponge with hormone injection to induce estrus synchronization for twining and sex preselection in Naimi sheep
  21. Exergetic performance analyses of three different cogeneration plants
  22. Psoralea corylifolia (babchi) seeds enhance proliferation of normal human cultured melanocytes: GC–MS profiling and biological investigation
  23. A novel electrochemical micro-titration method for quantitative evaluation of the DPPH free radical scavenging capacity of caffeic acid
  24. Comparative study between supported bimetallic catalysts for nitrate remediation in water
  25. Persicaline, an alkaloid from Salvadora persica, inhibits proliferation and induces apoptosis and cell-cycle arrest in MCF-7 cells
  26. Determination of nicotine content in locally produced smokeless tobacco (Shammah) samples from Jazan region of Saudi Arabia using a convenient HPLC-MS/MS method
  27. Changes in oxidative stress markers in pediatric burn injury over a 1-week period
  28. Integrated geophysical techniques applied for petroleum basins structural characterization in the central part of the Western Desert, Egypt
  29. The impact of chemical modifications on gamma-ray attenuation properties of some WO3-reinforced tellurite glasses
  30. Microwave and Cs+-assisted chemo selective reaction protocol for synthesizing 2-styryl quinoline biorelevant molecules
  31. Structural, physical, and radiation absorption properties of a significant nuclear power plant component: A comparison between REX-734 and 316L SS austenitic stainless steels
  32. Effect of Moringa oleifera on serum YKL-40 level: In vivo rat periodontitis model
  33. Investigating the impact of CO2 emissions on the COVID-19 pandemic by generalized linear mixed model approach with inverse Gaussian and gamma distributions
  34. Influence of WO3 content on gamma rays attenuation characteristics of phosphate glasses at low energy range
  35. Study on CO2 absorption performance of ternary DES formed based on DEA as promoting factor
  36. Performance analyses of detonation engine cogeneration cycles
  37. Sterols from Centaurea pumilio L. with cell proliferative activity: In vitro and in silico studies
  38. Untargeted metabolomics revealing changes in aroma substances in flue-cured tobacco
  39. Effect of pumpkin enriched with calcium lactate on iron status in an animal model of postmenopausal osteoporosis
  40. Energy consumption, mechanical and metallographic properties of cryogenically treated tool steels
  41. Optimization of ultra-high pressure-assisted extraction of total phenols from Eucommia ulmoides leaves by response surface methodology
  42. Harpin enhances antioxidant nutrient accumulation and decreases enzymatic browning in stored soybean sprouts
  43. Physicochemical and biological properties of carvacrol
  44. Radix puerariae in the treatment of diabetic nephropathy: A network pharmacology analysis and experimental validation
  45. Anti-Alzheimer, antioxidants, glucose-6-phosphate dehydrogenase effects of Taverniera glabra mediated ZnO and Fe2O3 nanoparticles in alloxan-induced diabetic rats
  46. Experimental study on photocatalytic CO2 reduction performance of ZnS/CdS-TiO2 nanotube array thin films
  47. Epoxy-reinforced heavy metal oxides for gamma ray shielding purposes
  48. Black mulberry (Morus nigra L.) fruits: As a medicinal plant rich in human health-promoting compounds
  49. Promising antioxidant and antimicrobial effects of essential oils extracted from fruits of Juniperus thurifera: In vitro and in silico investigations
  50. Chloramine-T-induced oxidation of Rizatriptan Benzoate: An integral chemical and spectroscopic study of products, mechanisms and kinetics
  51. Study on antioxidant and antimicrobial potential of chemically profiled essential oils extracted from Juniperus phoenicea (L.) by use of in vitro and in silico approaches
  52. Screening and characterization of fungal taxol-producing endophytic fungi for evaluation of antimicrobial and anticancer activities
  53. Mineral composition, principal polyphenolic components, and evaluation of the anti-inflammatory, analgesic, and antioxidant properties of Cytisus villosus Pourr leaf extracts
  54. In vitro antiproliferative efficacy of Annona muricata seed and fruit extracts on several cancer cell lines
  55. An experimental study for chemical characterization of artificial anterior cruciate ligament with coated chitosan as biomaterial
  56. Prevalence of residual risks of the transfusion-transmitted infections in Riyadh hospitals: A two-year retrospective study
  57. Computational and experimental investigation of antibacterial and antifungal properties of Nicotiana tabacum extracts
  58. Reinforcement of cementitious mortars with hemp fibers and shives
  59. X-ray shielding properties of bismuth-borate glass doped with rare earth ions
  60. Green supported silver nanoparticles over modified reduced graphene oxide: Investigation of its antioxidant and anti-ovarian cancer effects
  61. Orthogonal synthesis of a versatile building block for dual functionalization of targeting vectors
  62. Thymbra spicata leaf extract driven biogenic synthesis of Au/Fe3O4 nanocomposite and its bio-application in the treatment of different types of leukemia
  63. The role of Ag2O incorporation in nuclear radiation shielding behaviors of the Li2O–Pb3O4–SiO2 glass system: A multi-step characterization study
  64. A stimuli-responsive in situ spray hydrogel co-loaded with naringenin and gentamicin for chronic wounds
  65. Assessment of the impact of γ-irradiation on the piperine content and microbial quality of black pepper
  66. Antioxidant, sensory, and functional properties of low-alcoholic IPA beer with Pinus sylvestris L. shoots addition fermented using unconventional yeast
  67. Screening and optimization of extracellular pectinase produced by Bacillus thuringiensis SH7
  68. Determination of polyphenols in Chinese jujube using ultra-performance liquid chromatography–mass spectrometry
  69. Synergistic effects of harpin and NaCl in determining soybean sprout quality under non-sterile conditions
  70. Field evaluation of different eco-friendly alternative control methods against Panonychus citri [Acari: Tetranychidae] spider mite and its predators in citrus orchards
  71. Exploring the antimicrobial potential of biologically synthesized zero valent iron nanoparticles
  72. NaCl regulates goldfish growth and survival at three food supply levels under hypoxia
  73. An exploration of the physical, optical, mechanical, and radiation shielding properties of PbO–MgO–ZnO–B2O3 glasses
  74. A novel statistical modeling of air pollution and the COVID-19 pandemic mortality data by Poisson, geometric, and negative binomial regression models with fixed and random effects
  75. Treatment activity of the injectable hydrogels loaded with dexamethasone In(iii) complex on glioma by inhibiting the VEGF signaling pathway
  76. An alternative approach for the excess lifetime cancer risk and prediction of radiological parameters
  77. Panax ginseng leaf aqueous extract mediated green synthesis of AgNPs under ultrasound condition and investigation of its anti-lung adenocarcinoma effects
  78. Study of hydrolysis and production of instant ginger (Zingiber officinale) tea
  79. Novel green synthesis of zinc oxide nanoparticles using Salvia rosmarinus extract for treatment of human lung cancer
  80. Evaluation of second trimester plasma lipoxin A4, VEGFR-1, IL-6, and TNF-α levels in pregnant women with gestational diabetes mellitus
  81. Antidiabetic, antioxidant and cytotoxicity activities of ortho- and para-substituted Schiff bases derived from metformin hydrochloride: Validation by molecular docking and in silico ADME studies
  82. Antioxidant, antidiabetic, antiglaucoma, and anticholinergic effects of Tayfi grape (Vitis vinifera): A phytochemical screening by LC-MS/MS analysis
  83. Identification of genetic polymorphisms in the stearoyl CoA desaturase gene and its association with milk quality traits in Najdi sheep
  84. Cold-acclimation effect on cadmium absorption and biosynthesis of polyphenolics, and free proline and photosynthetic pigments in Spirogyra aequinoctialis
  85. Analysis of secondary metabolites in Xinjiang Morus nigra leaves using different extraction methods with UPLC-Q/TOF-MS/MS technology
  86. Nanoarchitectonics and performance evaluation of a Fe3O4-stabilized Pickering emulsion-type differential pressure plugging agent
  87. Investigating pyrolysis characteristics of Shengdong coal through Py-GC/MS
  88. Extraction, phytochemical characterization, and antifungal activity of Salvia rosmarinus extract
  89. Introducing a novel and natural antibiotic for the treatment of oral pathogens: Abelmoschus esculentus green-formulated silver nanoparticles
  90. Optimization of gallic acid-enriched ultrasonic-assisted extraction from mango peels
  91. Effect of gamma rays irradiation in the structure, optical, and electrical properties of samarium doped bismuth titanate ceramics
  92. Combinatory in silico investigation for potential inhibitors from Curcuma sahuynhensis Škorničk. & N.S. Lý volatile phytoconstituents against influenza A hemagglutinin, SARS-CoV-2 main protease, and Omicron-variant spike protein
  93. Physical, mechanical, and gamma ray shielding properties of the Bi2O3–BaO–B2O3–ZnO–As2O3–MgO–Na2O glass system
  94. Twofold interpenetrated 3D Cd(ii) complex: Crystal structure and luminescent property
  95. Study on the microstructure and soil quality variation of composite soil with soft rock and sand
  96. Ancient spring waters still emerging and accessible in the Roman Forum area: Chemical–physical and microbiological characterization
  97. Extraction and characterization of type I collagen from scales of Mexican Biajaiba fish
  98. Finding small molecular compounds to decrease trimethylamine oxide levels in atherosclerosis by virtual screening
  99. Prefatory in silico studies and in vitro insecticidal effect of Nigella sativa (L.) essential oil and its active compound (carvacrol) against the Callosobruchus maculatus adults (Fab), a major pest of chickpea
  100. Polymerized methyl imidazole silver bromide (CH3C6H5AgBr)6: Synthesis, crystal structures, and catalytic activity
  101. Using calcined waste fish bones as a green solid catalyst for biodiesel production from date seed oil
  102. Influence of the addition of WO3 on TeO2–Na2O glass systems in view of the feature of mechanical, optical, and photon attenuation
  103. Naringin ameliorates 5-fluorouracil elicited neurotoxicity by curtailing oxidative stress and iNOS/NF-ĸB/caspase-3 pathway
  104. GC-MS profile of extracts of an endophytic fungus Alternaria and evaluation of its anticancer and antibacterial potentialities
  105. Green synthesis, chemical characterization, and antioxidant and anti-colorectal cancer effects of vanadium nanoparticles
  106. Determination of caffeine content in coffee drinks prepared in some coffee shops in the local market in Jeddah City, Saudi Arabia
  107. A new 3D supramolecular Cu(ii) framework: Crystal structure and photocatalytic characteristics
  108. Bordeaux mixture accelerates ripening, delays senescence, and promotes metabolite accumulation in jujube fruit
  109. Important application value of injectable hydrogels loaded with omeprazole Schiff base complex in the treatment of pancreatitis
  110. Color tunable benzothiadiazole-based small molecules for lightening applications
  111. Investigation of structural, dielectric, impedance, and mechanical properties of hydroxyapatite-modified barium titanate composites for biomedical applications
  112. Metal gel particles loaded with epidermal cell growth factor promote skin wound repair mechanism by regulating miRNA
  113. In vitro exploration of Hypsizygus ulmarius (Bull.) mushroom fruiting bodies: Potential antidiabetic and anti-inflammatory agent
  114. Alteration in the molecular structure of the adenine base exposed to gamma irradiation: An ESR study
  115. Comprehensive study of optical, thermal, and gamma-ray shielding properties of Bi2O3–ZnO–PbO–B2O3 glasses
  116. Lewis acids as co-catalysts in Pd-based catalyzed systems of the octene-1 hydroethoxycarbonylation reaction
  117. Synthesis, Hirshfeld surface analysis, thermal, and selective α-glucosidase inhibitory studies of Schiff base transition metal complexes
  118. Protective properties of AgNPs green-synthesized by Abelmoschus esculentus on retinal damage on the virtue of its anti-inflammatory and antioxidant effects in diabetic rat
  119. Effects of green decorated AgNPs on lignin-modified magnetic nanoparticles mediated by Cydonia on cecal ligation and puncture-induced sepsis
  120. Treatment of gastric cancer by green mediated silver nanoparticles using Pistacia atlantica bark aqueous extract
  121. Preparation of newly developed porcelain ceramics containing WO3 nanoparticles for radiation shielding applications
  122. Utilization of computational methods for the identification of new natural inhibitors of human neutrophil elastase in inflammation therapy
  123. Some anticancer agents as effective glutathione S-transferase (GST) inhibitors
  124. Clay-based bricks’ rich illite mineral for gamma-ray shielding applications: An experimental evaluation of the effect of pressure rates on gamma-ray attenuation parameters
  125. Stability kinetics of orevactaene pigments produced by Epicoccum nigrum in solid-state fermentation
  126. Treatment of denture stomatitis using iron nanoparticles green-synthesized by Silybum marianum extract
  127. Characterization and antioxidant potential of white mustard (Brassica hirta) leaf extract and stabilization of sunflower oil
  128. Characteristics of Langmuir monomolecular monolayers formed by the novel oil blends
  129. Strategies for optimizing the single GdSrFeO4 phase synthesis
  130. Oleic acid and linoleic acid nanosomes boost immunity and provoke cell death via the upregulation of beta-defensin-4 at genetic and epigenetic levels
  131. Unraveling the therapeutic potential of Bombax ceiba roots: A comprehensive study of chemical composition, heavy metal content, antibacterial activity, and in silico analysis
  132. Green synthesis of AgNPs using plant extract and investigation of its anti-human colorectal cancer application
  133. The adsorption of naproxen on adsorbents obtained from pepper stalk extract by green synthesis
  134. Treatment of gastric cancer by silver nanoparticles encapsulated by chitosan polymers mediated by Pistacia atlantica extract under ultrasound condition
  135. In vitro protective and anti-inflammatory effects of Capparis spinosa and its flavonoids profile
  136. Wear and corrosion behavior of TiC and WC coatings deposited on high-speed steels by electro-spark deposition
  137. Therapeutic effects of green-formulated gold nanoparticles by Origanum majorana on spinal cord injury in rats
  138. Melanin antibacterial activity of two new strains, SN1 and SN2, of Exophiala phaeomuriformis against five human pathogens
  139. Evaluation of the analgesic and anesthetic properties of silver nanoparticles supported over biodegradable acacia gum-modified magnetic nanoparticles
  140. Review Articles
  141. Role and mechanism of fruit waste polyphenols in diabetes management
  142. A comprehensive review of non-alkaloidal metabolites from the subfamily Amaryllidoideae (Amaryllidaceae)
  143. Discovery of the chemical constituents, structural characteristics, and pharmacological functions of Chinese caterpillar fungus
  144. Eco-friendly green approach of nickel oxide nanoparticles for biomedical applications
  145. Advances in the pharmaceutical research of curcumin for oral administration
  146. Rapid Communication
  147. Determination of the contents of bioactive compounds in St. John’s wort (Hypericum perforatum): Comparison of commercial and wild samples
  148. Retraction
  149. Retraction of “Two mixed-ligand coordination polymers based on 2,5-thiophenedicarboxylic acid and flexible N-donor ligands: The protective effect on periodontitis via reducing the release of IL-1β and TNF-α”
  150. Topical Issue on Phytochemicals, biological and toxicological analysis of aromatic medicinal plants
  151. Anti-plasmodial potential of selected medicinal plants and a compound Atropine isolated from Eucalyptus obliqua
  152. Anthocyanin extract from black rice attenuates chronic inflammation in DSS-induced colitis mouse model by modulating the gut microbiota
  153. Evaluation of antibiofilm and cytotoxicity effect of Rumex vesicarius methanol extract
  154. Chemical compositions of Litsea umbellata and inhibition activities
  155. Green synthesis, characterization of silver nanoparticles using Rhynchosia capitata leaf extract and their biological activities
  156. GC-MS analysis and antibacterial activities of some plants belonging to the genus Euphorbia on selected bacterial isolates
  157. The abrogative effect of propolis on acrylamide-induced toxicity in male albino rats: Histological study
  158. A phytoconstituent 6-aminoflavone ameliorates lipopolysaccharide-induced oxidative stress mediated synapse and memory dysfunction via p-Akt/NF-kB pathway in albino mice
  159. Anti-diabetic potentials of Sorbaria tomentosa Lindl. Rehder: Phytochemistry (GC-MS analysis), α-amylase, α-glucosidase inhibitory, in vivo hypoglycemic, and biochemical analysis
  160. Assessment of cytotoxic and apoptotic activities of the Cassia angustifolia aqueous extract against SW480 colon cancer
  161. Biochemical analysis, antioxidant, and antibacterial efficacy of the bee propolis extract (Hymenoptera: Apis mellifera) against Staphylococcus aureus-induced infection in BALB/c mice: In vitro and in vivo study
  162. Assessment of essential elements and heavy metals in Saudi Arabian rice samples underwent various processing methods
  163. Two new compounds from leaves of Capparis dongvanensis (Sy, B. H. Quang & D. V. Hai) and inhibition activities
  164. Hydroxyquinoline sulfanilamide ameliorates STZ-induced hyperglycemia-mediated amyleoid beta burden and memory impairment in adult mice
  165. An automated reading of semi-quantitative hemagglutination results in microplates: Micro-assay for plant lectins
  166. Inductively coupled plasma mass spectrometry assessment of essential and toxic trace elements in traditional spices consumed by the population of the Middle Eastern region in their recipes
  167. Phytochemical analysis and anticancer activity of the Pithecellobium dulce seed extract in colorectal cancer cells
  168. Impact of climatic disturbances on the chemical compositions and metabolites of Salvia officinalis
  169. Physicochemical characterization, antioxidant and antifungal activities of essential oils of Urginea maritima and Allium sativum
  170. Phytochemical analysis and antifungal efficiency of Origanum majorana extracts against some phytopathogenic fungi causing tomato damping-off diseases
  171. Special Issue on 4th IC3PE
  172. Graphene quantum dots: A comprehensive overview
  173. Studies on the intercalation of calcium–aluminium layered double hydroxide-MCPA and its controlled release mechanism as a potential green herbicide
  174. Synergetic effect of adsorption and photocatalysis by zinc ferrite-anchored graphitic carbon nitride nanosheet for the removal of ciprofloxacin under visible light irradiation
  175. Exploring anticancer activity of the Indonesian guava leaf (Psidium guajava L.) fraction on various human cancer cell lines in an in vitro cell-based approach
  176. The comparison of gold extraction methods from the rock using thiourea and thiosulfate
  177. Special Issue on Marine environmental sciences and significance of the multidisciplinary approaches
  178. Sorption of alkylphenols and estrogens on microplastics in marine conditions
  179. Cytotoxic ketosteroids from the Red Sea soft coral Dendronephthya sp.
  180. Antibacterial and biofilm prevention metabolites from Acanthophora spicifera
  181. Characteristics, source, and health risk assessment of aerosol polyaromatic hydrocarbons in the rural and urban regions of western Saudi Arabia
  182. Special Issue on Advanced Nanomaterials for Energy, Environmental and Biological Applications - Part II
  183. Green synthesis, characterization, and evaluation of antibacterial activities of cobalt nanoparticles produced by marine fungal species Periconia prolifica
  184. Combustion-mediated sol–gel preparation of cobalt-doped ZnO nanohybrids for the degradation of acid red and antibacterial performance
  185. Perinatal supplementation with selenium nanoparticles modified with ascorbic acid improves hepatotoxicity in rat gestational diabetes
  186. Evaluation and chemical characterization of bioactive secondary metabolites from endophytic fungi associated with the ethnomedicinal plant Bergenia ciliata
  187. Enhancing photovoltaic efficiency with SQI-Br and SQI-I sensitizers: A comparative analysis
  188. Nanostructured p-PbS/p-CuO sulfide/oxide bilayer heterojunction as a promising photoelectrode for hydrogen gas generation
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 29.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/chem-2022-0288/html
Scroll to top button