Home Physical Sciences Effects of Blue and Red Light On Growth And Nitrate Metabolism In Pakchoi
Article Open Access

Effects of Blue and Red Light On Growth And Nitrate Metabolism In Pakchoi

  • Xiao-Xue Fan , Feng Xue , Bo Song , Long-Zheng Chen , Gang Xu EMAIL logo and Hai Xu EMAIL logo
Published/Copyright: July 12, 2019

Abstract

This study investigated the effects of blue and red light on metabolites of nitrate, key enzymes, and the gene expression of key enzymes in pakchoi plants (Brassica campestris L. var. Suzhouqing). Plants were grown under three light quality treatments, namely, white light (W), red light (R) and blue light (B), at the same photosynthetic photon flux density (PPFD) of approximately 150 μmol m-2 s-1 for 48 hours of continuous illumination, and W was set as the control. The dynamics of net photosynthetic rate in pakchoi subjected to different light treatments were the same as the total chlorophyll contents: blue light > white light > red light. The nitrate reductase (NR) activity, nitrite reductase (NiR) activity, glutamine synthetase (GS) activity and glutamate synthase (GOGAT) activity were highest under blue light. Further, the expression levels of NR, NiR and GS genes were significantly higher under blue light. Under continuous illumination, the auxin content (IAA) in pakchoi leaves was highest under blue light, whereas the abscisic acid (ABA) content was highest under red light. In contrast, there was no significant effect for gibberellin (GA) under any type of light treatment.

1 Introduction

Nitrate is a main source of nitrogen, and its content reflects the nutrient status of plants. Nitrate positively influences the yield and quality of vegetables, and the accumulated level of nitrate is an important parameter that indicates the safety of vegetables. Many studies have demonstrated that light conditions are one of the main factors affecting plant nitrate levels. Among light conditions, light quality is a key factor in the regulation of nitrate concentration in plants [1].

Nitrate reductase (NR) is generally considered a key and rate-limiting enzyme for nitrate assimilation. Light markedly affects NR activity in plants by regulating the transcription, translation and post-translational activity of NR genes. Bian [1] proposed a model of NR regulation by light. The model suggested that light could regulate NR activity through two pathways, namely, the regulation of NR gene expression by photosynthetic products and the regulation of NR state by nicotinamide adenine dinucleotide phosphate (NADP).

Previous studies indicated that light quality has a significant effect on nitrate metabolism in plants. A five-minute red-blue light pulse can stimulate nitrate assimilation in red algae, however, this kind of effect can be neutralized by subsequent far-red light [2]. This pattern suggests that light-sensitive pigments participate in this process. A similar phenomenon is also found in green algae, in which low-intensity blue light facilitated nitrate absorption [3]. Another study in etiolated barley showed that the NR activity in red light-treated plants was two times higher than that in plants treated with white light, suggesting that light-sensitive pigment improved NR mRNA protein and enzyme activity [4]. The result is probably due to blue light stimulating NR absorption through photosynthesis [5], alternatively, the direct stimulation of NR because the chromophore of the blue-light receptor cryptochrome contains flavin adenine dinucleotide (FAD), and FAD is also present in the prosthetic group of NR [6].

At present, studies concerning the effects of light on nitrite reductase activity are relatively few. The NII gene is an important gene that encodes NIR [7]. It has been shown that red and blue light radiation can induce NII expression, which is probably pertinent to light-sensitive pigments and blue-light receptors [8,9]. GOGAT and GS are key enzymes for ammonia assimilation in plants. It was found that the light-sensitive pigments in red pine [10], lettuce [11], mustard [12] and Arabidopsis thaliana [13] significantly participated in the regulation of GS activity. The ferredoxin glutamate synthase (Fd-GOGAT) in plants is widely present in the photosynthetic tissue of plants, and its expression is affected by light. Both red and blue light can increase the Fd-GOGAT activity in etiolated duckweed seedlings, and two phytochromes and blue-light receptors were involved. Red light can stimulate Fd-GOGAT expression, while far-red light can reverse this effect, suggesting the involvement of phytochrome. Similarly, ultraviolet-A radiation promoted the expression of Fd-GOGAT by a special blue-light receptor, which implicated the blue-light receptor [10].

Pakchoi (Brassica campestris L.) is an important agricultural crop in China that can be produced in a plant factory and for which year-round production is feasible. The objectives of the present study were to investigate how blue light and red light affect nitrate metabolism and to provide a quick and effective way to reduce the nitrate content of pakchoi.

2 Experimental Section

2.1 Plant materials

The variety of pakchoi was Suzhouqing, which was supplied by the Jiangsu Academy of Agricultural Sciences of Vegetables. Seeds of Chinese cabbage were soaked for a period of 8 h in water and then were kept in a wet sponge seedling block. Environmental conditions were as follows: under natural light, the relative humidity (RH) was maintained at 80-90%, and the growth temperature was 20-22℃. After the two cotyledons of seedlings fully expanded, we placed the seedlings into a hydroponic box filled with Hoagland nutrient solution. When the Chinese cabbage had produced six true leaves, 60 seedlings were selected and were then cultured under three light-quality treatments for 48 h [14,15]. There were two fanners in the controlled environment, which maintained the CO2 level to be the same as that of the atmosphere. The relative humidity (RH) was maintained at 70±10%, and the growth temperature was 18-20℃. Three replications were performed for each phytochemical measurement. All data are expressed on a fresh weight (FW) basis.

2.2 Light treatments

Nanjing Vegetation Spectrum Photoelectric Technology Co., Ltd designed all the lamps. The light treatments were designated with red LEDs (R), blue LEDs (B), and white LEDs (W). The white light treatment (W), with a 12 h photoperiod, was used as a control, and plants were grown under incandescent reflector lamps. The spectral distributions of the white (peak at 400-760 nm), red (peak at 658 nm) and blue (peak at 460 nm) lights were measured by using a spectroradiometer (OPT-2000, ABDPE Co., Beijing, China). All the treatments were irradiated with the same photosynthetic photon flux density (PPFD) of 150 μmol m-2 s-1. PPFD was measured using a quantum sensor (LI-250, LI-COR, USA) and was separately controlled by adjusting both the electric currents. The parameters of the light in each treatment are shown in Table 1.

Table 1

Major technique parameters of different light spectral energy distribution.

Light treatmentPeak wavelengthHalfwave widthPPFDPower
λp(nm)Δλ(nm)(μmol m-2 s-1)(W)
W(CK)580150400
R658±1215054
B460±1115054
  1. W, white light; R, red light; B, blue light.

2.3 Methods

2.3.1 Determination of photosynthesis and chlorophyll

The chlorophyll content was determined according to Arnon’s method with improvements [16]. A total of 0.1 g of leaf material was soaked in 10.0 mL (V) of 80% acetone for 2-6 h until the material turned white. Optical density was measured with a UV-1200 spectrophotometer (Jin Peng Inc., China) at 663 nm for chlorophyll a (Chl a) and at 645 nm for chlorophyll b (Chl b).

Net photosynthetic rate (Pn) was measured using a photosynthesis instrument (LI-6400, LI-COR, USA). PPFD was set to 800 μmol m-2 s-1, and the experimental conditions of leaf temperature, CO2 concentration and relative humidity (RH) were 23±1℃, 380±5 µL L-1 and 60%- 70%, respectively. The Pn measurement was repeated 3 times with 3 plants in each treatment [17].

2.3.2 Determination of physiological metabolites

Soluble proteins were extracted from leaves with the improved method of Li et al. [18]. The proteins were precipitated with NH4HSO4 (45% saturation), collected by centrifugation and dissolved in 50 mmol L-1 sodium phosphate buffer (1 mmol L-1 Na2EDTA, 1 mmol L-1 sodium molybdate, 5 mmol L-1 leupeptin, 10 mmol L-1 FAD, 5 mmol L-1 cysteine, 0.05 mmol L-1 NaH2PO4 2H2O and 0.05 mmol L-1 Na2HPO4 2H2O at a pH of 7.5). One milliliter of extract and 5.0 mL of Coomassie Brilliant Blue G-250 were mixed thoroughly. The absorbance was measured at 595 nm. Protein standard solution was prepared with bovine serum albumin. Then, 100 mg of bovine serum albumin was dissolved in 100 mL of deionized water to obtain a total volume of 1000 μg mL-1, which was used as the standard fluid.

The soluble sugar contents were measured by the modified anthrone method of Li et al. [18]. Leaves (0.1 g dry weight) were placed in a test tube, to which 10 mL of distilled water was added. After 30 min in a water bath at 85℃, the supernatant was collected for determination. Soluble sugar content was measured at 620 nm.

Nitrate content was determined according to Li [19]. Leaf tissue (0.2 g) was added to 10 mL of deionized water and placed in a boiling water bath for 30 min. The supernatant was adjusted to 25 mL, then, 0.4 mL of salicylic acid-sulfuric acid mixture (5%) was pipetted into 0.1 mL of the supernatant. The mixture was shaken, allowed to rest for 20 minutes, and finally mixed with 9.5 mL of NaOH. The absorption spectrum was at 410 nm.

Nitrite content was measured according to Qin [20]. A leaf sample (1.0 g) was homogenized in 2 mL of buffer solution. The homogenate was transferred to a 50 mL volumetric flask. One mL of ferrocyanide and 1 mL of ZnSO4 were then added to the volumetric flask, and the volume was adjusted to 50 mL. The mixture was shaken and allowed to rest for 10 minutes before filtering. The reaction mixture containing 5 mL of filtrate, 5 mL of sulfanilamide and 5 mL of 1-naphthylamine was incubated in a 30℃ water bath for 30 min. The absorbance was read at 530 nm.

Concentrations of glutamic acid and glutamine were determined using a kit made by the Nanjing Institute of Biological Engineering and following the principles of Lund [21]. The test steps are shown in the supplementary materials section.

The glutamic acid assay kit is based on glutamic acid catalyzed by glutamate dehydrogenase to produce 2-oxoglutarate, NH3 and NADH. With the ultraviolet spectrum, NADH was measured at 340 nm to calculate the glutamic acid content.

The glutamine assay kit is based on hydrolysis of glutamine to glutamate and colorimetric determination of the product. The intensity of the product color measured at 630 nm is proportional to the glutamine concentration in the sample.

2.3.3 Nitrate reductase and nitrite reductase activities assay

NR was measured according to Bian et al. [15]. Leaf tissue (0.1 g) was homogenized with 4 mL of phosphate buffer (the same as in 2.3.2) and then centrifuged at 17,000 r for 15 min at 4 ℃. The supernatant contained crude enzyme extract. The assay mixture contained 100 μL of the extraction, 200 μmol KNO3 and 0.2 μmol nicotinamide adenine dinucleotide. After reacting at 30 ℃ for 20 min, 50 μL of 1 M zinc acetate was added to stop the reaction. The mixture was centrifuged at 7600 r for 5 min, and the absorbance was read at 530 nm. The amount of formed NO2- was calculated using a standard curve prepared with NaNO2. The activity of nitrate reductase is expressed by the produced nitrite nitrogen content per gram of fresh sample per hour (μg g-1 h-1).

NiR was measured by the modified method of Mendez and Vega [22]. Leaf tissue (1 g) was kept at 0℃ for 2 h and then homogenized in 4 mL of buffer solution. The homogenate was centrifuged at 12 000 r at 4℃ for 15 min. The supernatant contained crude enzyme extract. Three test tubes were numbered, and 2 mL of PBS was added to each tube. Then, 1 mL of distilled water was added to tube No. 1, 1 mL of KNO2 (1 mmol) and 2 mL of color-developing reagent were added to tube No. 2, and 1 mL of KNO2 (1 mmol) was added to tube No. 3. All three tubes were incubated at 30℃ for 10 min. Subsequently, 0.1 mL of toluene and 2 mL of crude enzyme extract were added to these tubes and incubated at 30℃ for 2 h. In tubes No. 1 and No. 3, 2 mL of color-developing reagent was added, and after sufficient color developed, 3 mL of trichloroacetic acid (TCA) was added. The mixture was centrifuged at 12 000 r for 10 min. The absorbance was read at 530 nm. The NO2- content of the solution was calculated from a standard curve. The amount of NO2- reduction was calculated as follows: content in tube No. 1 + content in tube No. 2 - content in tube No. 3. The consumption of nitrite (tube No. 1 + tube No. 2 - tube No. 3) was used to calculate enzyme activity. The NiR activity was expressed by the reduction in NO2- content per gram of fresh sample per hour (μg g-1 h-1).

2.3.4 Glutamate synthase and glutamine synthetase activities assay

The leaf tissues (0.5 g) were homogenized in an ice bath with 50 mM buffer solution containing 1% (w/v) insoluble polyvinylpyrrolidone, 1.5% (w/v) soluble casein, 2 mM EDTA and 2 mM dithiothreitol. The homogenate was centrifuged at 4℃ and 12 000 r for 15 min. The supernatant contained crude enzyme extract, which was used for the glutamine synthetase and glutamate synthase enzyme activity assay.

GS activity was determined by the method of Cánovas et al. [23]. One mL of crude enzyme extract was added to 3 mL of reaction solution containing 50 mmol·L-1 L-sodium glutamate, 4 mmol·L-1 ATP-2Na, 40 mmol·L-1 hydroxylamine, 20 mmol·L-1 MgSO4, 10 mmol·L-1 L-cysteine and 40 mmol·L-1 PBS. The resulting mixture was allowed to react at 30℃ for 15 min; then, 1 mL of reaction solution containing 30% trichloroacetic acid (g/v), 8% FeCl3 (g/v) and 5.5 mol L-1 HCl was added, and these three solutions were mixed at 1:1:1 (v:v:v). After 10 min of rest, the absorbance was read at 540 nm. The activity of GS was expressed as µmol γ-glutamyl hydroxamate formed per gram of fresh sample per minute (μmol g-1 min-1).

GOGAT activity was measured by the method of Migge et al. [24]. The reaction mixture was incubated at 30 ℃ for 30 min. In total, 40 µL of N-methylmaleimide (pH of 8.0) was added to the mixture, incubated in a 95 ℃ water bath for 10 min, and then centrifuged at 12 000 r for 8 min. Then, 70 µL of supernatant was added to 100 μL of solution to be tested, and the absorbance was read at 540 nm. The reaction mixture contained 20 μL of crude enzyme extract, 5 μL of methyl viologen (100 mmol·L-1), 40 µL of HEPES (150 mmol·L-1), 10 µL of L-glutamine (100 mmol·L-1), 5 µL of α-ketoglutaric acid (60 mmol·L-1), 10 μL of aminooxyacetic acid (100 mmol·L-1), 20 g·L-1 of NaS2O and 20 g·L-1 of NaHCO3. The methyl viologen-dependent activity of GOGAT was calculated from the increase in glutamate per gram fresh sample per minute (μmol g-1 min-1).

2.3.5 RNA extraction and RT-PCR for gene expression analysis

Leaf samples were fixed and stored in liquid nitrogen. Total RNA content was extracted with Trizol according to the manufacturer’s instructions. A fluorescence quantitative reverse PCR kit was used for reverse transcription (Zhongding, PC04-5OT). To guarantee reverse transcription efficiency, oligo (dT) and random primers were used. Specific gene primers of 3 nitrogen metabolism genes, as shown in Table 2, were used for RT-PCR.

Table 2

The primers for RT-qPCR were as follows.

Name of primerPrimer sequenceFragment length
F3675BcNR-FGCCTCAAGAATCCGACAG233
F3675BcNR-RCTCCTCCAGAGTAAGCATAGC
4239-BcNiR-FCATCGCAGGAAGCATCAA 185185
4239-BcNiR-RTCAGGCACATCAGGCAAC
4239-BCGS2-FGTCTTCTTCAAGTTCCAGG 119119
4239-BCGS2-RCACAACCGAGTTCCATAA
ACTIN-FGAATCCACGAAACAACTTACAACTC131
ACTIN-RCTCTTTGCTCATACGGTCAGC
  1. The relative amount of gene expression was calculated by .

PCRs included 10 µL of SYBR Green qPCR Mix, 2 µL of diluted cDNA and 0.4 µL of each primer. ddH2O was added to a final volume of 20 µL. The conditions for RT-qPCR were 30 s at 94℃, 10 s at 94 ℃ for denaturing, and 30 s at 72℃ for annealing. The RT-qPCR included 45 cycles. The fluorescence data were collected at 72℃. Relevant gene expression was calculated according to Livak and Schmittgen [25].

2.4 Statistical analyses

Statistical analyses were conducted using Statistical Product and Service Solutions for Windows version 16.0 (SPSS Inc., Japan), and the differences between the means were tested using Duncan’s multiple range test (P = 0.05).

Ethical approval: The conducted research is not related to either human or animal use.

3 Results

3.1 Effects of 48 h of continuous light on the contents of nitrate in pakchoi

As shown in Figure1, the nitrate content in pakchoi decreased rapidly in the initial 24 h in the W, R and B treatments. The content was lowest at 24 h and increased thereafter. However, the effect of B was the most significant. At 24 h, the nitrate content under the B treatment was approximately 23.9% lower than that of W-grown plants.

Figure 1 Effects of continuous light on the contents of nitrate in pakchoi.
Figure 1

Effects of continuous light on the contents of nitrate in pakchoi.

3.2 Effects of 24 h of continuous light on nitrogen metabolites in pakchoi

After 24 h of continuous light, the glutamate content was not significantly different among the three light treatments. The glutamic acid and soluble protein contents were significantly higher in the B treatment than in the W and R treatments. In particular, the glutamic acid content under the B treatment was 80.5% and 49.1% higher than that in the W and R treatments, respectively. The soluble sugar content under the R treatment was 13% and 24% higher than that under the B and W treatments (Table 3).

Table 3

Effects of 24 h continuous light on content of nitrogen metabolites in pakchoi.

Light treatmentSoluble sugarSoluble proteinGlutamic acidGlutamine
(mg g-1)(g L-1)(μmol gprot-1)(μmol gprot-1)
W(CK)30.62a7.13b6.64b0.10a
R38.08a7.10b8.04ab0.08a
B33.59a7.25a11.99a0.07a
  1. W, white light; R, red light; B, blue light. Mean separation within a row by Duncan’s multiple range test, values followed by different letters are significantly different at 5% level.

3.3 Effects of 24 h of continuous light on chlorophyll content and net photosynthetic rate in pakchoi

As shown in Figure 2, after treatment with different sources of light, the total chlorophyll pigment under the W, R and B treatments was 33.9, 31.7 and 41.7 mg·g–1, respectively. The dynamics of net photosynthetic rate in pakchoi were the same trend as those of the total chlorophyll content, i.e., blue light > white light > red light. The B treatment increased the Pn by 29.4% and 88.4% compared to the W and R treatments.

Figure 2 Effects of 24 h continuous light on net photosynthetic rate and chlorophyll content.
Figure 2

Effects of 24 h continuous light on net photosynthetic rate and chlorophyll content.

3.4 Effects of 24 h of continuous light on activity of nitrogen metabolism enzymes in pakchoi

As shown in Table 4, the NR activity in pakchoi was 19.3% higher under the B treatment than that under the W treatment, while the difference between the W and R treatments was not significant. The NIR activity was not significantly different among the three light treatments. The B treatment increased the GS activity by 29.4% compared to the W treatment, however, there was no significant difference between the R and W treatments. The GOGAT activity was significantly increased by 86.8% and 45% after exposure to B and R compared with that of W-grown plants.

Table 4

Effects of 24 h continuous light on nitrogen metabolism enzyme activity in pakchoi.

Light treatmentNRNIRGSGOGAT
(μg g-1 h-1)(μg g-1 h-1)(μmol g-1 min-1)(μmol g-1 min-1)
W(CK)62.92b57.17a40.80b11.40c
R71.44ab65.33a42.41b16.53b
B75.05a69.42a52.86a21.30a
  1. W, white light; R, red light; B, blue light. Mean separation within a row by Duncan’s multiple range test, values followed by different letters are significantly different at 5% level.

3.5 Effects of 24 h of continuous light on nitrogen metabolism gene expression in pakchoi

RT-PCR was used to analyze the relative transcript levels of 3 genes involved in nitrogen metabolism in plants after irradiation with different light treatments. As shown in Figure 3, the transcriptional levels of 3 genes were not significantly different after exposure to the three light treatments. The expression levels of NR, NIR and GS genes were greatest under the B treatment, followed by the R and W treatments (Figure 3).

Figure 3 Effects of 24 h continuous light on key nitrogen metabolism gene gene expression in pakchoi.
Figure 3

Effects of 24 h continuous light on key nitrogen metabolism gene gene expression in pakchoi.

3.6 Effects of 24 h of continuous light on phytohormone content in pakchoi leaves

For the different light treatments, the IAA content under the W and R treatments was markedly lower than that under the B treatment. At 24 h, the IAA content under the B treatment was significantly increased to 59.65 ng·g–1 compared with that under the W (53.65 ng·g–1) and R (54.58 ng·g–1) treatments. However, the difference between the R and W treatments was not significant. The GA content was not significantly different among the three treatments. With continuous light treatment, the differences in ABA content between the R and other treatments became increasingly greater. After 24 h, the ABA content under the R treatment was significantly increased by 8.5% and 23.4% compared with that under the W and B treatments, respectively.

4 Discussion

Light plays very important roles in nitrate metabolism in plants. It is also one of the main factors determining nitrate content. Among light conditions, light quality is a key factor in regulating the nitrate concentration in plants. Our results show that pakchoi grown under B and R treatments had a lower nitrate content than that grown under a W treatment (Figure 1). The change in nitrate in plants is closely linked to internal physiological activities, including the concentration of soluble protein, carbon and photosynthetic capacity [1].

In the present study, nitrate content decreased sharply under the three light treatments between 0 and 24 h, and the effect of the B treatment was the most significant. The reason for this result may be that the B treatment promoted the synthesis of soluble protein and caused an increase in the supply of enzymes and NADPH, which are used for the reduction of nitrate in leaves. The result is similar to the previous discovery of Lillo and Appenroth [26]. Another reason light regulates nitrate metabolism is that the expression of NR is controlled by light. NR is the most important and most limiting step in nitrogen metabolism [27]. The results revealed that the B and R treatments had positive effects on NR activity in pakchoi, and the effect of the B treatment was more pronounced. Under the B treatment, the nitrate content was significantly decreased, which might be partly attributable to the higher activity of NR. This result was similar to that reported by Qi et al. [27].

Previous studies found that NR activity is subject to changes in NR gene expression. The qRT-PCR analysis in our study showed that the expression of NR, NiR and GS genes was upregulated in response to the B treatment, suggesting the induction of nitrogen metabolism enzymes possibly (Figure 3). Our result of the effect of B treatment was similar to the results in spinach, tobacco and rice [27,29,30]. This result could also be caused by action through a signal transduction chain involving phosphorylation since the blue-light effect may be sensitive to protein kinase inhibitors and regulation of the absorption of nitrate [31,32]. The significant nitrate reduction in pakchoi under continuous light at 24 h may also lie in the fact that the higher NR activity stimulated by the increase in NR expression leads to enhanced nitrate reduction [33].

After the reduction of nitrate to nitrite in the cytosol, nitrite is translocated into the chloroplasts with the help of NiR. In our study, the NiR activity under the B and R treatments was higher than that under the W treatment (Table 4). However, there was no significant difference among the three treatments. It was found that NII is a gene encoding NiR and red and blue irradiation induced NII expression, consistent with the involvement of phytochrome and possibly a blue-light receptor [8,9]. Blue light especially stimulated the accumulation of one of the NiR proteins (NiR2). In research on lettuce, Bian et al. [35] reported that supplementation with green light had a positive effect on NR and NiR gene expression levels under short-term continuous light. Therefore, further studies using supplementation with green light may be able to promote nutritional value.

The GS-GOGAT cycle is the main pathway for ammonia assimilation in plants. Light directly participates in the expression of the GS2 gene and in its activity [34]. In the present study, we found that light quality had similar effects on GS, GOGAT and NR, i.e., B > R > W (Table 4). The result is similar to the previous discovery of Bian et al. [35], who reported significant positive correlations between activities of GS and GOGAT and the activity of NR. As was reported by Teller et al. [36], Fd-GOGAT was induced by red and blue light in etiolated turions of Spirodela, and both phytochrome and a blue-light receptor were involved. However, we still do not know the synaptic mechanisms, hence, more research on this phenomenon is needed.

It is well known that photosynthesis plays an important role in nitrate metabolism, and products of photosynthesis are known to stimulate NR activation. In our present study, we found that the B treatment increased soluble protein content in pakchoi by 1.68% compared to the W treatment, which can provide more protein for both photosynthesis and nitrate metabolism. However, there is a strong relationship between photosynthesis and chlorophyll content. Our study found that the B treatment dramatically increased the net photosynthetic rate, which also contributed to a high chlorophyll content. In a study on rapeseed, Li et al. [20] also found that blue light at a higher percentage can increase chlorophyll content. The result is consistent with an early observation that higher NR was positively correlated with photosynthesis.

Light up regulates genes that are involved in the assimilation of ammonium into glutamine and glutamate. There were negative correlations between nitrogen assimilation and nitrate content. The products of nitrogen assimilation, especially glutamine, are known to exert negative feedback on NIA expression, which is a gene coding for NADH:NR in Arabidopsis [37,38]. In our present study, a decrease in glutamine content under the B treatment was observed, which may have reduced the inhibition of enzyme activity.

In plants, light is an important environmental signal that induces photomorphogenesis and the regulation of hormone activity [39]. We found that different light qualities can affect the phytohormone levels in pakchoi (Table 5). The changes in IAA contents under different light treatments were similar to those reported by Su [40], who showed that red light can reduce the activity of IAA synthesis enzymes, while blue light can increase the activity of IAA oxidase. In this study, we also found that blue light increased IAA content and NR activity in pakchoi, which was similar to the results observed in Arabidopsis [41]. There is little research on the regulatory mechanism of nitrate metabolism and hormones, and the question of how light participates in this process remains. These mechanisms still need further study.

Table 5

Effects of 24 h continuous light on phytohormone content in pakchoi.

Light treatmentIAAGAABA
(ng g-1 FW-1)(ng g-1 FW-1)(ng g-1 FW-1)
W(CK)53.65b6.34a64.34b
R54.58b6.38a69.83a
B59.65a6.17a58.02b
  1. W, white light; R, red light; B, blue light. Mean separation within a row by Duncan’s multiple range test, values followed by different letters are significantly different at 5% level.

5 Conclusion

The results of this study showed that the metabolites of pakchoi could be changed by exposure to continuous blue light. First, continuous blue light reduced nitrate content significantly, which is beneficial for promoting the safety and quality of pakchoi. The reduction in nitrate content under B treatment is mostly attributed to the higher activity of NR, GS and GOGAT enzymes. Second, the photosynthetic ability of pakchoi was also influenced by different light sources. However, there is still a need for further detailed study of changes in plant metabolites under different light treatments.

Acknowledgements

This research was partially supported by the National Natural Science Foundation of China (31501804). Thanks are due to the Jiangsu Key Laboratory for Horticultural Crop Genetic Improvement for their help with this research.

  1. Conflict of interest: Authors declare no conflict of interest.

  2. Supplemental Material: The online version of this article offers supplementary material (https://doi.org/10.1515/chem-2019-0038)

References

[1] Bian Z.H., Yang Q.C., Liu W.K., Effects of light quality on the accumulation of phytochemicals in vegetables produced in controlled environments: a review, J. J Sci Food Agr., 2015, 95, 869-877.10.1002/jsfa.6789Search in Google Scholar

[2] Figuroa F.L., Photoregulation of nitrogen metabolism and protein accumulation in the red alga Corallina elongata Ellis et, J. Zeitschrift Fur Naturforschung C., 1993, 48, 788-794.10.1515/znc-1993-9-1017Search in Google Scholar

[3] Ullrich W.R., Lazarova J., Ullrich C.L, Witt F.G., Aparicio P.J., Nitrate uptake and extracellular alkalinization by the green alga Hydrodictyon reticulum in blue and red light. J. J Exp Bot., 1998, 49, 1157-1162.10.1093/jxb/49.324.1157Search in Google Scholar

[4] Lillo C., Henriksen A., Comparative studies of diurnal variations of nitrate reductase activity in wheat, oat and barley, J. Physiol Plant., 1984, 62, 89-94.10.1111/j.1399-3054.1984.tb05928.xSearch in Google Scholar

[5] Maetschke M., Riedel J., Tischner R., Evidence for signal transduction in the stimulation of nitrate uptake by blue light in Chlorella saccharophila, J. Photochem Photobiol., 1997, 66, 128-132.10.1111/j.1751-1097.1997.tb03149.xSearch in Google Scholar

[6] Campbell W.H., Nitrate reductase biochemistry comes of age, J. Plant Physiol., 1996,11, 355-361.10.1104/pp.111.2.355Search in Google Scholar

[7] Becker T.W., Foyer C., Caboche M., Light-regulated expression of the nitrate-reductase and nitrite-reductase genes in tomato and in the phytochrome-deficient aurea mutant of tomato, J. Planta., 1992,188, 39-47.10.1007/BF00198937Search in Google Scholar

[8] Goud K.V., Sharma R., Retention of photoinduction of cytosolic enzymes in aurea mutant of tomato (Lycopersicones culentum), J. Plant Physiol., 1994, 105, 643-650.10.1104/pp.105.2.643Search in Google Scholar

[9] Migge A., Carrayol E., Hirel B., Lohmann, Meya G., Beekerl T.W., Influence of U-VA or U-VB light and of nitrogen source on the induction of ferredoxin-dependent glutamatesynthease in etiolated tomato cotyledons, J. Plant Physiol Boichem., 1998, 36, 789-797.10.1016/S0981-9428(99)80015-1Search in Google Scholar

[10] Elmlinger M.W., Mohr H., Coaction of blue/ultraviolet-A light and light absorbed by phytochrome in controlling the appearance of ferredoxin-dependent glutamate synthase in the Scots pine (Pinus sylvestris L.) seedling, J. Planta., 1991, 183, 374-380.10.1007/BF00197736Search in Google Scholar PubMed

[11] Sakamoto A., Takeba G., Shibata D., Tanaka K., Phytochrome-mediated activation of the gene for cytosolic glutamine synthetase GS-1 during imbibition of photosensitive lettuce seeds, J. Plant Mol Biol., 1990, 15, 317-324.10.1007/BF00036917Search in Google Scholar PubMed

[12] Weber M., Schmidt S., Schuster C., Mohr H., Factors involved in the coordinate appearanceof nitrite reductase and glutamine synthetase in the mustard Sinapsis alba L seedlings. J. Planta., 1990,180, 429-434.10.1007/BF01160400Search in Google Scholar

[13] Oliveira I.C., Coruzzi G.M., Carbon and amino acids reciprocally modulate the expression of glutamine synthetase in Arabidopsis, J. Plant Physiol., 1999, 121, 301-309.10.1104/pp.121.1.301Search in Google Scholar PubMed PubMed Central

[14] Zhou W .L., Liu W .K., Yang Q .C., Reducing nitrate content in lettuce by pre-harvest continuous light delivered by red and blue light-emitting diodes. J. J Plant Nutr., 2013, 36, 481-490.10.1080/01904167.2012.748069Search in Google Scholar

[15] Bian Z.H., Chen RF., Yang Q.C., Continuous light from red, blue, and green light-emitting diodes reduces nitrate content and enhances phytochemical concentrations and antioxidant capacity in lettuce. J. J Amer Soc Hort Sci., 2016, 141, 186-195.10.21273/JASHS.141.2.186Search in Google Scholar

[16] Arnon D.I., Copper enzymes in isolated chloroplasts polyphenoloxidase in beta vulgaris, J. Plant Physiol., 1949, 24, 1-15.10.1104/pp.24.1.1Search in Google Scholar PubMed PubMed Central

[17] Liu X.Y., Guo S.R., Xu Z.G., Jiao X., Takafumi T., Regulation of chloroplast ultrastructure, cross-section anatomy of leaves, and morphology of stomata of cherry tomato by different light irradiations of light-emitting diodes, J. Hortscience., 2011, 46, 1-5.10.21273/HORTSCI.46.2.217Search in Google Scholar

[18] Li H.M., Tang C., Xu Z.G., Effects of light emitting diodes on growth and morphogenesis of Rapeseed (Brassica napus L.) plantlets in vitro, J. Sci Hortic., 2013, 4, 117-124.10.1016/j.scienta.2012.10.009Search in Google Scholar

[19] Li H.S., Plant physiological and biochemical experiment principle and technology, 2rd ed., High Education Press, Beijing, 2000.Search in Google Scholar

[20] Qin S.C., Crop nutrition fertilizer and diagnosis experiment. Agriculture press, Beijing. 1992.Search in Google Scholar

[21] Lund P., L-Glutamine and L-Glutamate: UVMethod with Glutaminase and Glutamate Dehydrogenase. In :Bergmeyer, H.U. (Eds.), Methods of Enzymatic Analysis, 8rd ed., VCH, Verlagsgesellschaft, Weinheim, 1986.Search in Google Scholar

[22] Mendez, J.M., Vega, J.M., Purification and molecular properties of nitrite reductase from Anabaena sp. 7119, J. Physiol Plantarum., 1981, 52, 7-14.10.1111/j.1399-3054.1981.tb06026.xSearch in Google Scholar

[23] Cánovas F.M., Cantón, F.R., Gallardo F., García-Gutiérrez, A., De Vicente, A., Accumulation of glutamine synthetase during early development of maritime pine (Pinus pinaster) seedlings, J. Planta., 1991, 185, 372-378.10.1007/BF00201059Search in Google Scholar PubMed

[24] Migge A., Carrayol E., Kunz C., Hirel B., Fock H., Becker T., The expression of the tobacco genes encoding plastidic glutamine synthetase or Ferredoxin-dependent glutamate synthase does not depend on the rate of nitrate reduction,and is unaffected by suppression ofphotorespiration. J. J Exp Bot., 1997, 48, 1175-1181.10.1093/jxb/48.6.1175Search in Google Scholar

[25] Livak K.J., Schmittgen TD., Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method, J. Methods., 2001, 25, 402-408.10.1006/meth.2001.1262Search in Google Scholar PubMed

[26] Lillo C., Appenroth K.J., Light regulation of nitrate reductase in higher plants: which photoreceptors are involved? J. Plant Biol., 2001, 3, 455-465.10.1055/s-2001-17732Search in Google Scholar

[27] Qi L.D., Effects of light quality on the physiological characteristics and quality of spinach. master thesis, Shandong agricultural university, Shandong, China, 2007.Search in Google Scholar

[28] Campbell W.H., Nitrate reductase structure, function and regulation: bridging the gap between biochemistry and physiology, J. Annu Rev Plant Biol., 1999, 50, 277-303.10.1146/annurev.arplant.50.1.277Search in Google Scholar PubMed

[29] Cui Z.W., Different nitrogen source and light environment flue-cured tobacco nitrogen metabolism related enzyme activity, PhD thesis, The influence of Henan agricultural university, Henan, China, 2007.Search in Google Scholar

[30] Deng J.M., Cai Q.Y., Pan R.Z., Effect of light quality on protein and amino acid contents of rice seedlings, J. Chinese Bulletin of Botany., 2000, 17, 419-423.Search in Google Scholar

[31] Tischner R., Nitrate uptake and reduction in higher and lower plants. J. Plant, Cell & Environment., 2000, 23, 1005-1024.10.1046/j.1365-3040.2000.00595.xSearch in Google Scholar

[32] Maetschke M., Riedel J., Tischner R., Evidence for signal transduction in the stimulation of nitrate uptake by blue light in Chlorella saccharophila, J. Photochem Photobiol., 1997, 66, 128-132.10.1111/j.1751-1097.1997.tb03149.xSearch in Google Scholar

[33] Nawaz M.A., Wang L.M, Jiao Y.Y., Chen Ch. Zhao L., Mei M.J., Yu Y.L., Bie Z.L., Pumpkin rootstock improves nitrogen use efficiency of watermelon scion by enhancing nutrient uptake, cytokinin content, and expression of nitrate reductase genes, J. Plant Growth Regul., 2017, 82, 233-246.10.1007/s10725-017-0254-7Search in Google Scholar

[34] Ireland R.J., Lea P.J., The enzymes of glutamine, glutamate, asparagines and aspartate metabolism, 2rd ed., Marcel Dekker Press, New York, 1999.Search in Google Scholar

[35] Bian Z.H., Cheng R.F., Wang Y., Yang Q.C., Lu C.G., Effect of green light on nitrate reduction and edible quality of hydroponically grown lettuce (Lactuca sativa L.) under short-term continuous light from red and blue light-emitting diodes, J. Environ Exp Bot., 2018, 153, 36-71.10.1016/j.envexpbot.2018.05.010Search in Google Scholar

[36] Teller S., Schmidt K.H., Appenroth K.J., Ferredoxin-dependent but not NADH-dependent glutamate synthase is regulated by phytochrome and blue/UV-A light receptor in turions of Spirodela polyrhiza, J. Plant Physiol Biochem., 1996, 34, 713-719.Search in Google Scholar

[37] Sivasankar S., Oaks A., Nitrate assimilation in higher plants: The effect of metabolites and light, J. Plant Physiol Biochem., 1996, 34, 609-620.Search in Google Scholar

[38] Coruzzi G., Last R., Biochemistry and molecular biology of plants. Wiley press, Maryland, USA, 2001.Search in Google Scholar

[39] Lau, O.S., Deng, X.W., Plant hormone signaling lightens up: integrators of light and hormones, J. Curr Opin Plant Biol., 2010, 13, 571-577.10.1016/j.pbi.2010.07.001Search in Google Scholar PubMed

[40] Su N., Wu Q., Cui J., Effects of monochromatic LED light quality on endogenous hormone content in leaves and hypocotyl of Cucumis sativus L, J. Application Environ Sci., 2014, 20, 45-49.Search in Google Scholar

[41] Pavel P.P., Alexander V.K., Ilya E.Z., Blue light alters miR167 expression and microRNA-targeted auxin response factor genes in Arabidopsis thaliana plants, J. Plant Physiol Bioch., 2016, 104,146-154.10.1016/j.plaphy.2016.03.018Search in Google Scholar PubMed

Received: 2018-04-04
Accepted: 2018-08-27
Published Online: 2019-07-12

© 2019 Xiao-Xue Fan et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 Public License.

Articles in the same Issue

  1. Regular Articles
  2. Research on correlation of compositions with oestrogenic activity of Cistanche based on LC/Q-TOF-MS/MS technology
  3. Efficacy of Pyrus elaeagnifolia subsp. elaeagnifolia in acetic acid–induced colitis model
  4. Anti-inflammatory and antinociceptive features of Bryonia alba L.: As a possible alternative in treating rheumatism
  5. High efficiency liposome fusion induced by reducing undesired membrane peptides interaction
  6. Prediction of the Blood-Brain Barrier Permeability Using RP-18 Thin Layer Chromatography
  7. Phytic Acid Extracted from Rice Bran as a Growth Promoter for Euglena gracilis
  8. Development of a validated spectrofluorimetric method for assay of sotalol hydrochloride in tablets and human plasma: application for stability-indicating studies
  9. Topological Indices of Hyaluronic Acid-Paclitaxel Conjugates’ Molecular Structure in Cancer Treatment
  10. Thermodynamic properties of the bubble growth process in a pool boiling of water-ethanol mixture two-component system
  11. Critical Roles of the PI3K-Akt-mTOR Signaling Pathway in Apoptosis and Autophagy of Astrocytes Induced by Methamphetamine
  12. Characteristics of Stable Hydrogen and Oxygen Isotopes of Soil Moisture under Different Land Use in Dry Hot Valley of Yuanmou
  13. Specific, highly sensitive and simple spectrofluorimetric method for quantification of daclatasvir in HCV human plasma patients and in tablets dosage form
  14. Chromium-modified cobalt molybdenum nitrides as catalysts for ammonia synthesis
  15. Langerhans cell-like dendritic cells treated with ginsenoside Rh2 regulate the differentiation of Th1 and Th2 cells in vivo
  16. Identification of Powdery Mildew Blumeria graminis f. sp. tritici Resistance Genes in Selected Wheat Varieties and Development of Multiplex PCR
  17. Computational Analysis of new Degree-based descriptors of oxide networks
  18. The Use Of Chemical Composition And Additives To Classify Petrol And Diesel Using Gas Chromatography–Mass Spectrometry And Chemometric Analysis: A Uk Study
  19. Minimal Energy Tree with 4 Branched Vertices
  20. Jatropha seed oil derived poly(esteramide-urethane)/ fumed silica nanocomposite coatings for corrosion protection
  21. Calculating topological indices of certain OTIS interconnection networks
  22. Energy storage analysis of R125 in UIO-66 and MOF-5 nanoparticles: A molecular simulation study
  23. Velvet Antler compounds targeting major cell signaling pathways in osteosarcoma - a new insight into mediating the process of invasion and metastasis in OS
  24. Effects of Azadirachta Indica Leaf Extract, Capping Agents, on the Synthesis of Pure And Cu Doped ZnO-Nanoparticles: A Green Approach and Microbial Activity
  25. Aqueous Micro-hydration of Na+(H2O)n=1-7 Clusters: DFT Study
  26. A proposed image-based detection of methamidophos pesticide using peroxyoxalate chemiluminescence system
  27. Phytochemical screening and estrogenic activity of total glycosides of Cistanche deserticola
  28. Biological evaluation of a series of benzothiazole derivatives as mosquitocidal agents
  29. Chemical pretreatments of Trapa bispinosa's peel (TBP) biosorbent to enhance adsorption capacity for Pb(ll)
  30. Dynamic Changes in MMP1 and TIMP1 in the Antifibrotic Process of Dahuang Zhechong Pill in Rats with Liver Fibrosis
  31. The Optimization and Production of Ginkgolide B Lipid Microemulsion
  32. Photodynamic Therapy Enhanced the Antitumor Effects of Berberine on HeLa Cells
  33. Chiral and Achiral Enantiomeric Separation of (±)-Alprenolol
  34. Correlation of Water Fluoride with Body Fluids, Dental Fluorosis and FT4, FT3 –TSH Disruption among Children in an Endemic Fluorosis area in Pakistan
  35. A one-step incubation ELISA kit for rapid determination of dibutyl phthalate in water, beverage and liquor
  36. Free Radical Scavenging Activity of Essential Oil of Eugenia caryophylata from Amboina Island and Derivatives of Eugenol
  37. Effects of Blue and Red Light On Growth And Nitrate Metabolism In Pakchoi
  38. miRNA-199a-5p functions as a tumor suppressor in prolactinomas
  39. Solar photodegradation of carbamazepine from aqueous solutions using a compound parabolic concentrator equipped with a sun tracking system
  40. Influence of sub-inhibitory concentration of selected plant essential oils on the physical and biochemical properties of Pseudomonas orientalis
  41. Preparation and spectroscopic studies of Fe(II), Ru(II), Pd(II) and Zn(II) complexes of Schiff base containing terephthalaldehyde and their transfer hydrogenation and Suzuki-Miyaura coupling reaction
  42. Complex formation in a liquid-liquid extraction-chromogenic system for vanadium(IV)
  43. Synthesis, characterization (IR, 1H, 13C & 31P NMR), fungicidal, herbicidal and molecular docking evaluation of steroid phosphorus compounds
  44. Analysis and Biological Evaluation of Arisaema Amuremse Maxim Essential Oil
  45. A preliminary assessment of potential ecological risk and soil contamination by heavy metals around a cement factory, western Saudi Arabia
  46. Anti- inflammatory effect of Prunus tomentosa Thunb total flavones in LPS-induced RAW264.7 cells
  47. Collaborative Influence of Elevated CO2 Concentration and High Temperature on Potato Biomass Accumulation and Characteristics
  48. Methods of extraction, physicochemical properties of alginates and their applications in biomedical field – a review
  49. Characteristics of liposomes derived from egg yolk
  50. Preparation of ternary ZnO/Ag/cellulose and its enhanced photocatalytic degradation property on phenol and benzene in VOCs
  51. Influence of Human Serum Albumin Glycation on the Binding Affinities for Natural Flavonoids
  52. Synthesis and antioxidant activity of 2-methylthio-pyrido[3,2-e][1,2,4] triazolo[1,5-a]pyrimidines
  53. Comparative study on the antioxidant activities of ten common flower teas from China
  54. Molecular Properties of Symmetrical Networks Using Topological Polynomials
  55. Synthesis of Co3O4 Nano Aggregates by Co-precipitation Method and its Catalytic and Fuel Additive Applications
  56. Phytochemical analysis, Antioxidant and Antiprotoscolices potential of ethanol extracts of selected plants species against Echinococcus granulosus: In-vitro study
  57. Silver nanoparticles enhanced fluorescence for sensitive determination of fluoroquinolones in water solutions
  58. Simultaneous Quantification of the New Psychoactive Substances 3-FMC, 3-FPM, 4-CEC, and 4-BMC in Human Blood using GC-MS
  59. Biodiesel Production by Lipids From Indonesian strain of Microalgae Chlorella vulgaris
  60. Miscibility studies of polystyrene/polyvinyl chloride blend in presence of organoclay
  61. Antibacterial Activities of Transition Metal complexes of Mesocyclic Amidine 1,4-diazacycloheptane (DACH)
  62. Novel 1,8-Naphthyridine Derivatives: Design, Synthesis and in vitro screening of their cytotoxic activity against MCF7 cell line
  63. Investigation of Stress Corrosion Cracking Behaviour of Mg-Al-Zn Alloys in Different pH Environments by SSRT Method
  64. Various Combinations of Flame Retardants for Poly (vinyl chloride)
  65. Phenolic compounds and biological activities of rye (Secale cereale L.) grains
  66. Oxidative degradation of gentamicin present in water by an electro-Fenton process and biodegradability improvement
  67. Optimizing Suitable Conditions for the Removal of Ammonium Nitrogen by a Microbe Isolated from Chicken Manure
  68. Anti-inflammatory, antipyretic, analgesic, and antioxidant activities of Haloxylon salicornicum aqueous fraction
  69. The anti-corrosion behaviour of Satureja montana L. extract on iron in NaCl solution
  70. Interleukin-4, hemopexin, and lipoprotein-associated phospholipase A2 are significantly increased in patients with unstable carotid plaque
  71. A comparative study of the crystal structures of 2-(4-(2-(4-(3-chlorophenyl)pipera -zinyl)ethyl) benzyl)isoindoline-1,3-dione by synchrotron radiation X-ray powder diffraction and single-crystal X-ray diffraction
  72. Conceptual DFT as a Novel Chemoinformatics Tool for Studying the Chemical Reactivity Properties of the Amatoxin Family of Fungal Peptides
  73. Occurrence of Aflatoxin M1 in Milk-based Mithae samples from Pakistan
  74. Kinetics of Iron Removal From Ti-Extraction Blast Furnace Slag by Chlorination Calcination
  75. Increasing the activity of DNAzyme based on the telomeric sequence: 2’-OMe-RNA and LNA modifications
  76. Exploring the optoelectronic properties of a chromene-appended pyrimidone derivative for photovoltaic applications
  77. Effect of He Qi San on DNA Methylation in Type 2 Diabetes Mellitus Patients with Phlegm-blood Stasis Syndrome
  78. Cyclodextrin potentiometric sensors based on selective recognition sites for procainamide: Comparative and theoretical study
  79. Greener synthesis of dimethyl carbonate from carbon dioxide and methanol using a tunable ionic liquid catalyst
  80. Nonisothermal Cold Crystallization Kinetics of Poly(lactic acid)/Bacterial Poly(hydroxyoctanoate) (PHO)/Talc
  81. Enhanced adsorption of sulfonamide antibiotics in water by modified biochar derived from bagasse
  82. Study on the Mechanism of Shugan Xiaozhi Fang on Cells with Non-alcoholic Fatty Liver Disease
  83. Comparative Effects of Salt and Alkali Stress on Antioxidant System in Cotton (Gossypium Hirsutum L.) Leaves
  84. Optimization of chromatographic systems for analysis of selected psychotropic drugs and their metabolites in serum and saliva by HPLC in order to monitor therapeutic drugs
  85. Electrocatalytic Properties of Ni-Doped BaFe12O19 for Oxygen Evolution in Alkaline Solution
  86. Study on the removal of high contents of ammonium from piggery wastewater by clinoptilolite and the corresponding mechanisms
  87. Phytochemistry and toxicological assessment of Bryonia dioica roots used in north-African alternative medicine
  88. The essential oil composition of selected Hemerocallis cultivars and their biological activity
  89. Mechanical Properties of Carbon Fiber Reinforced Nanocrystalline Nickel Composite Electroforming Deposit
  90. Anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis
  91. Topical Issue on Applications of Mathematics in Chemistry
  92. Zagreb Connection Number Index of Nanotubes and Regular Hexagonal Lattice
  93. The Sanskruti index of trees and unicyclic graphs
  94. Valency-based molecular descriptors of Bakelite network BNmn
  95. Computing Topological Indices for Para-Line Graphs of Anthracene
  96. Zagreb Polynomials and redefined Zagreb indices of Dendrimers and Polyomino Chains
  97. Topological Descriptor of 2-Dimensional Silicon Carbons and Their Applications
  98. Topological invariants for the line graphs of some classes of graphs
  99. Words for maximal Subgroups of Fi24
  100. Generators of Maximal Subgroups of Harada-Norton and some Linear Groups
  101. Special Issue on POKOCHA 2018
  102. Influence of Production Parameters on the Content of Polyphenolic Compounds in Extruded Porridge Enriched with Chokeberry Fruit (Aronia melanocarpa (Michx.) Elliott)
  103. Effects of Supercritical Carbon Dioxide Extraction (SC-CO2) on the content of tiliroside in the extracts from Tilia L. flowers
  104. Impact of xanthan gum addition on phenolic acids composition and selected properties of new gluten-free maize-field bean pasta
  105. Impact of storage temperature and time on Moldavian dragonhead oil – spectroscopic and chemometric analysis
  106. The effect of selected substances on the stability of standard solutions in voltammetric analysis of ascorbic acid in fruit juices
  107. Determination of the content of Pb, Cd, Cu, Zn in dairy products from various regions of Poland
  108. Special Issue on IC3PE 2018 Conference
  109. The Photocatalytic Activity of Zns-TiO2 on a Carbon Fiber Prepared by Chemical Bath Deposition
  110. N-octyl chitosan derivatives as amphiphilic carrier agents for herbicide formulations
  111. Kinetics and Mechanistic Study of Hydrolysis of Adenosine Monophosphate Disodium Salt (AMPNa2) in Acidic and Alkaline Media
  112. Antimalarial Activity of Andrographis Paniculata Ness‘s N-hexane Extract and Its Major Compounds
  113. Special Issue on ABB2018 Conference
  114. Special Issue on ICCESEN 2017
  115. Theoretical Diagnostics of Second and Third-order Hyperpolarizabilities of Several Acid Derivatives
  116. Determination of Gamma Rays Efficiency Against Rhizoctonia solani in Potatoes
  117. Studies On Compatibilization Of Recycled Polyethylene/Thermoplastic Starch Blends By Using Different Compatibilizer
  118. Liquid−Liquid Extraction of Linalool from Methyl Eugenol with 1-Ethyl-3-methylimidazolium Hydrogen Sulfate [EMIM][HSO4] Ionic Liquid
  119. Synthesis of Graphene Oxide Through Ultrasonic Assisted Electrochemical Exfoliation
  120. Special Issue on ISCMP 2018
  121. Synthesis and antiproliferative evaluation of some 1,4-naphthoquinone derivatives against human cervical cancer cells
  122. The influence of the grafted aryl groups on the solvation properties of the graphyne and graphdiyne - a MD study
  123. Electrochemical modification of platinum and glassy carbon surfaces with pyridine layers and their use as complexing agents for copper (II) ions
  124. Effect of Electrospinning Process on Total Antioxidant Activity of Electrospun Nanofibers Containing Grape Seed Extract
  125. Effect Of Thermal Treatment Of Trepel At Temperature Range 800-1200˚C
  126. Topical Issue on Agriculture
  127. The effect of Cladophora glomerata exudates on the amino acid composition of Cladophora fracta and Rhizoclonium sp.
  128. Influence of the Static Magnetic Field and Algal Extract on the Germination of Soybean Seeds
  129. The use of UV-induced fluorescence for the assessment of homogeneity of granular mixtures
  130. The use of microorganisms as bio-fertilizers in the cultivation of white lupine
  131. Lyophilized apples on flax oil and ethyl esters of flax oil - stability and antioxidant evaluation
  132. Production of phosphorus biofertilizer based on the renewable materials in large laboratory scale
  133. Human health risk assessment of potential toxic elements in paddy soil and rice (Oryza sativa) from Ugbawka fields, Enugu, Nigeria
  134. Recovery of phosphates(V) from wastewaters of different chemical composition
  135. Special Issue on the 4th Green Chemistry 2018
  136. Dead zone for hydrogenation of propylene reaction carried out on commercial catalyst pellets
  137. Improved thermally stable oligoetherols from 6-aminouracil, ethylene carbonate and boric acid
  138. The role of a chemical loop in removal of hazardous contaminants from coke oven wastewater during its treatment
  139. Combating paraben pollution in surface waters with a variety of photocatalyzed systems: Looking for the most efficient technology
  140. Special Issue on Chemistry Today for Tomorrow 2019
  141. Applying Discriminant and Cluster Analyses to Separate Allergenic from Non-allergenic Proteins
  142. Chemometric Expertise Of Clinical Monitoring Data Of Prolactinoma Patients
  143. Chemomertic Risk Assessment of Soil Pollution
  144. New composite sorbent for speciation analysis of soluble chromium in textiles
  145. Photocatalytic activity of NiFe2O4 and Zn0.5Ni0.5Fe2O4 modified by Eu(III) and Tb(III) for decomposition of Malachite Green
  146. Photophysical and antibacterial activity of light-activated quaternary eosin Y
  147. Spectral properties and biological activity of La(III) and Nd(III) Monensinates
  148. Special Issue on Monitoring, Risk Assessment and Sustainable Management for the Exposure to Environmental Toxins
  149. Soil organic carbon mineralization in relation to microbial dynamics in subtropical red soils dominated by differently sized aggregates
  150. A potential reusable fluorescent aptasensor based on magnetic nanoparticles for ochratoxin A analysis
  151. Special Issue on 13th JCC 2018
  152. Fluorescence study of 5-nitroisatin Schiff base immobilized on SBA-15 for sensing Fe3+
  153. Thermal and Morphology Properties of Cellulose Nanofiber from TEMPO-oxidized Lower part of Empty Fruit Bunches (LEFB)
  154. Encapsulation of Vitamin C in Sesame Liposomes: Computational and Experimental Studies
  155. A comparative study of the utilization of synthetic foaming agent and aluminum powder as pore-forming agents in lightweight geopolymer synthesis
  156. Synthesis of high surface area mesoporous silica SBA-15 by adjusting hydrothermal treatment time and the amount of polyvinyl alcohol
  157. Review of large-pore mesostructured cellular foam (MCF) silica and its applications
  158. Ion Exchange of Benzoate in Ni-Al-Benzoate Layered Double Hydroxide by Amoxicillin
  159. Synthesis And Characterization Of CoMo/Mordenite Catalyst For Hydrotreatment Of Lignin Compound Models
  160. Production of Biodiesel from Nyamplung (Calophyllum inophyllum L.) using Microwave with CaO Catalyst from Eggshell Waste: Optimization of Transesterification Process Parameters
  161. The Study of the Optical Properties of C60 Fullerene in Different Organic Solvents
  162. Composite Material Consisting of HKUST-1 and Indonesian Activated Natural Zeolite and its Application in CO2 Capture
  163. Topical Issue on Environmental Chemistry
  164. Ionic liquids modified cobalt/ZSM-5 as a highly efficient catalyst for enhancing the selectivity towards KA oil in the aerobic oxidation of cyclohexane
  165. Application of Thermal Resistant Gemini Surfactants in Highly Thixotropic Water-in-oil Drilling Fluid System
  166. Screening Study on Rheological Behavior and Phase Transition Point of Polymer-containing Fluids produced under the Oil Freezing Point Temperature
  167. The Chemical Softening Effect and Mechanism of Low Rank Coal Soaked in Alkaline Solution
  168. The Influence Of NO/O2 On The NOx Storage Properties Over A Pt-Ba-Ce/γ-Al2O3 Catalyst
  169. Special Issue on the International conference CosCI 2018
  170. Design of SiO2/TiO2 that Synergistically Increases The Hydrophobicity of Methyltrimethoxysilane Coated Glass
  171. Antidiabetes and Antioxidant agents from Clausena excavata root as medicinal plant of Myanmar
  172. Development of a Gold Immunochromatographic Assay Method Using Candida Biofilm Antigen as a Bioreceptor for Candidiasis in Rats
  173. Special Issue on Applied Biochemistry and Biotechnology 2019
  174. Adsorption of copper ions on Magnolia officinalis residues after solid-phase fermentation with Phanerochaete chrysosporium
  175. Erratum
  176. Erratum to: Sand Dune Characterization For Preparing Metallurgical Grade Silicon
Downloaded on 21.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/chem-2019-0038/html
Scroll to top button