Startseite Naturwissenschaften Anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis
Artikel Open Access

Anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis

  • Xiaolei Lan , Qian Liu , Hua Gao , Zhenye Li und Yazhuo Zhang EMAIL logo
Veröffentlicht/Copyright: 31. Dezember 2019
Artikel downloaden (PDF)
Open Chemistry
Aus der Zeitschrift Open Chemistry Band 17 Heft 1

Abstract

Resistance to Dopamine agonists therapy is still a key factor that hinders the clinical treatment of prolactinoma. Consequently, a large number of investigations have been carried out to identify novel therapeutic targets. Our previous studies have suggested that the epidermal growth factor-like domain 7 (EGFL7) plays a crucial role in tumorigenesis of pituitary adenomas via EGFR/AKT/MAPK signaling pathway. In the present research, we found a positive staining of c-myc intimately associated with high-level EGFL7 in invasive prolactinoma compared to non-invasive prolactinoma and the normal pituitary gland. Meanwhile, PI3K/Akt and MAPK signaling cascades closely related to the activation of c-myc. Therefore, this research was conducted to explore the cooperation effect of c-myc and EGFL7 in prolactinoma. The inhibition of c-myc with anti-c-myc antibodies significantly reduced the proliferation, PRL secretion and invasion of rat prolactinoma MMQ cells. Notably, down regulation c-Myc by in vitro administration of anti-c-Myc antibodies could significantly depress EGFL7 induced MMQ cell proliferation, PRL secretion and invasion. An anti-c-Myc antibody could block EGFL7 induced Akt activation, but the expression of p-ERK was not altered by an anti-c-Myc antibody. Thus, our results suggest that anti-c-myc efficacy could block EGFL7 induced prolactinoma tumorigenesis via inhibited Akt activation in MMQ cells.

Keywords: EGFL7; c-myc; Cooperatation; Prolactinoma; Tumorigenesis

1 Introduction

Prolactinoma are the most common tumors of pituitary adenoma with hyperprolactinemia [1]. Treatment with a dopamine agonist is effective in the inhibition of prolactin (PRL) secretion and tumor growth [2]. However, dopamine agonist-resistant to prolactinoma is still a key factor hindering prolactinoma treatment [3]. Therefore, novel and efficacious therapies are desired for these patients.

As a proto-oncogene, c‑myc enables cells grow infinitely and has been reported to initiate or accelerate tumorigenesis in a variety of tissues [4]. Prior studies have revealed that c-myc over-expression has an effect to turn tumor cells into malignant phenotypes by activating a cancer gene or deactivating its suppressors [5, 6]. This upregulation proceeds through multiple mechanisms, ranging from gene amplification, cellular senescence, to mutation of upstream signal pathways [7]. This research aims to examine the c‑myc over-expression levels in prolactinoma associated with the high level of EGFL7. However, the role of c-myc in prolactinoma remains to be completely elucidated.

Previously, we found EGFL7 played the tumorigenesis role in pituitary adenomas [8, 9]. Over-expression of EGFL7 is observed in growth hormone-producing pituitary adenomas [9] and prolactinoma [10]. Attenuation of EGFL7 expression Inhibits the tumor growth and invasion in vivo and in vitro experiments [9]. Furthermore, EGFL7 can act as a potential novel viable target for prolactinoma. In vitro administration of anti-EGFL7 antibodies induced prolactinoma cells apoptosis and plays an essential role in regulating biological behavior [10].

Our previous results showed that the MAPK and PI3K/AKT signaling pathway is a dominant driver in EGFL7 induced tumor growth and invasiveness [8,11]. Meanwhile, the PI3K/Akt and MAPK signaling cascades closely related to activation of c-myc [12]. Therefore, the current

study reveals the c-myc and EGFL7 cooperation effect in prolactinoma. It was found that the EGFL7 expression level was positively correlated with expression of c-myc in prolactinomas by using Tissue microarray (TMA). Using MTT, ELISA and Transwell assay, c-Myc-blocking antibody could block EGFL7 induced prolactinoma tumorigenesis. Down-stream signaling pathways studied investigated the biological process that is related to the phosphorylation of AKT.

2 Materials and Methods

2.1 Patients and specimens

Tissue samples from 126 patients with prolactinomas were provided by the biobank of Beijing Neurosurgical Institute [8]. All these patients had an endoscopic trans-sphenoidal operation between December 2012 and January 2014 at Tiantan Hospital, Beijing, China. There were 51 invasive specimens and 75 non-invasive specimens. The following invasive PAs diagnostic criteria were adopted: 1) Knosp classification grade III-IV tumors and Hardy classification III-IV; 2) Tumor cells confirmed via pathology as invading sellar bone or adjacent dura mater; 3) Tumor cells invading the sphenoid sinus cavity or peripheralvascular and nerve. We also collected anterior pituitaries glands from six organ donors whose deaths were irrelevant to neurological or endocrine diseases. For the sake of rooting out the possibility of incidental pathologies, all the normal anterior pituitaries were pathologically examined by immunohistochemistry. The study obtained approval from the Ethics Committee of Beijing Tiantan Hospital.

2.2 Immunohistochemistry

The immunohistochemical (IHC) SABC method was performed as depicted previously [9]. Prolactinoma and pituitary gland specimens were paraffin-embedded and put in 10% formaldehyde, and tissue sections of 4 μm were obtained through a standard hematoxylin-eosin (H&E) stain for histopathological evaluation. IHC analysis with rabbit recombinant monoclonal c‑myc (1:100, cat. ab32072; Abcam) and mouse monoclonal anti-EGFL7 antibody (1:100, cat. sc-101349; Santa) were conducted on the sections by random, automated, slide staining system Leica BOND-III (Leica Biosystems, Wetzlar, Germany). A Bond Polymer Refine Detection system (Leica Biosystems) was adopted to visualize the primary antibodies while an Aperio AT2 digital scanner (Leica Biosystems) was utilized to examine the expression of immunostained slides. The negative control sections received identical treatment other than omitting the primary antibody. Moreover, endothelial cells as a positive control obtained desirable results .

2.3 Cell culture

A rat prolactinoma cell MMQ was provided by American Type Culture Collection. MMQ cells were cultured in F12K medium added with 15% horse serum and 2.5% fetal bovine serum as well as 100 units/mL penicillin and streptomycin in a humidified air containing 5% CO2 at 4°C.

2.4 Cell proliferation assay

The proliferation of MMQ cells was assessed by an MTS assay following the manufacturers’ protocols. Briefly, MMQ cells were seeded into 96-well microplates and cultured in the medium mentioned above with 50 ng/mL recombinant human EGFL7 (rhEGFL7) or 10 μg/mL anti-c-myc antibodies for 72 h. Subsequently, a 20 μL MTS solution (Promega, Madison, WI, USA) was supplemented to each well with a 100 μL culture medium for four hours. The absorbance was assessed at 490 nm with a multi-detection microplate reader (Tecan Infinite® M200 pro). All experiments were performed in triplicate.

2.5 ELISA assay

A PRL RapidBio ELISA kit (West Hills, CA, USA) was used to evaluate the PRL secretions from MMQ cells as described previously [13]. According to the standard curve, standard density and OD, a linear regression equation was used to calculate the concentration of PRL. The color intensity of the reaction product was proportional to the concentration of PRL and was detected by the same multi-detector microplate reader mentioned in the cell proliferation test.

2.6 Western blot analyses

A DC Protein Assay (Bio-Rad) was applied to measure the concentrations of cell lysate protein [14]. Laemmli method was employed to resolve the same amounts of protein (40 μg) from each cell lysate. The proteins were transferred onto a 0.45-mm nitrocellulose membranes (Bio-Rad) which was sealed at 4°C and incubated overnight with the primary antibody. All the antibodies appeared as follows: anti-EGFL7 antibody (19291-1-AP, Proteintech), anti-p-ERK(ser42/44) antibody (#4696, CST), anti-AKT antibody (#4685, CST), anti-ERK antibody (#4685, CST) and GAPDH (Sigma) antibody, horseradish peroxidase-labeled secondary antibodies (Santa Cruz Bio.) Enhanced chemiluminescence was employed to visualize the membranes, and density measurements were performed by Amersham Imager 6000 (GE, American).

2.7 Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

The purified total RNA (1μg) was reverse-transcribed into complementary deoxyribonucleic acid (cDNA) using a Revert Aid First-Strand cDNA Synthesis Kit (Thermo Shandon) based on the manufacturer’s protocol. The primer details of genes were described in Table 1. GAPDH was used as an endogenous control for normalizing the level of the target genes. qRT-PCR was performed on an ABI 7500 Fast Real-Time PCR System using the Platinum® SYBR® Green qPCR SuperMix-UDG (Invitrogen). A comparative CT method was used to calculate fold-change in the differential expression of each gene (2-△△CT method). PCR conditions: 50℃ 20 min, 95℃ 10 min, then 95℃ 10 secs to 60℃ 1 min, 40 cycles.

Table 1

The primers in RT-PCR experiment

GeneForwardRerverse
N-cadherinagaacagggtggacgtcattaccactgtgactagcccatc
MMP-2tgcaaccacaaccaactacgtagagctcctggatcccctt
MMP-9tgggcaagcagtactctaccgtcttcatgcagaggggagt
Vimentinactaatgagtccctggagcgaggtggcgatctcaatgtca
GAPDHagtctactggcgtcttcaccccacgatgccaaagttgtca

2.8 Statistical analysis

All data were expressed as the mean ± standard deviation (SD) of at least three independently performed experiments. Statistical analysis was conducted by SPSS 18.0 for Windows (SPSS Inc., Chicago, IL, USA). A one-way analysis of variance (ANOVA) was adopted to analyze the statistical significance of the differences among three groups, followed by a least significant difference post-hoc test to get individual P values. P value <0.05 was deemed as statistically significant.

3 Results

3.1 The positive staining of c-myc was intimately associated with high-level EGFL7 in invasive prolactinoma

Firstly, the expression level of c-myc and EGFL-7 was measured by using tissue microarray in invasive prolactinomas in comparison with normal pituitary and non-invasive prolactinomas. As illustrated in Figure 1, the positive staining of c-myc in invasive prolactinoma was significantly higher than that in non-invasive prolactinoma. The result showed that the average expression level of c-myc protein in invasive prolactinoma vs. non-invasive prolactinoma was about 2.05-fold increased (Figure 2A). In addition, total expression level of EGFL7 has been determined and presented in Figure 2B. As the result shown in Figure 2B, noticeably higher expression of EGFL7 was observed in invasive prolactinoma than non-invasive prolactinoma and normal pituitary. In addition, the correlation of overexpression of c-myc and EGFL7 was also analyzed. As illustrated in Figure 2C, the positive staining of c-myc was intimately associated with high-level EGFL7 in invasive prolactinoma (r=0.411; P<0.05. n=126).

Figure 1 Overexpression of c-myc and EGFL7 in invasive prolactinoma. Representative staining of a TMA was showed. c-myc and EGFL7 positive staining was significantly higher in invasive prolactinoma than that in non-invasive prolactinoma and normal pituitary. scale bar=60 μm.
Figure 1

Overexpression of c-myc and EGFL7 in invasive prolactinoma. Representative staining of a TMA was showed. c-myc and EGFL7 positive staining was significantly higher in invasive prolactinoma than that in non-invasive prolactinoma and normal pituitary. scale bar=60 μm.

Figure 2 Positively correlated of c-myc and EGFL7. H-scores of staining of TMA expressed as Mean ± SD. Both c-myc (A) and EGFL7 (B) overexpression in invasive prolactinoma. *P<0.05, **P<0.01 vs. non-invasive prolactinoma. In addition, (C) c-myc expression levels were significantly positively correlated with EGFL7 expression levels (r=0.411; P<0.05).
Figure 2

Positively correlated of c-myc and EGFL7. H-scores of staining of TMA expressed as Mean ± SD. Both c-myc (A) and EGFL7 (B) overexpression in invasive prolactinoma. *P<0.05, **P<0.01 vs. non-invasive prolactinoma. In addition, (C) c-myc expression levels were significantly positively correlated with EGFL7 expression levels (r=0.411; P<0.05).

3.2 Down regulation c-Myc depress EGFL7 induced cell proliferation and PRL secretion in MMQ cells

This research studied the role c-myc played in EGFL7-induced MMQ cell proliferation and PRL secretion in an effort to better understand the biological function of c-myc in the EGFL7 signaling pathway. Our previous investigation indicated that knockdown EGFL7 effectively inhibited pituitary adenoma cell growth [8, 9]. In this study, MMQ cells were incubated with 50 ng/mL rhEGFL7 protein or PBS for 72 h. As shown in Figure 3, 50 ng/mL rhEGFL7 significantly promote cell proliferation (Figure 3A, 1.88±0.37 fold) and PRL secretion (Figure 3B, 1.51± 0.32 fold). To further clarify whether c-myc is involved in EGFL7 induced cell growth, MMQ cells transfected with or without rhEGFL7 were performed with 10 μg/mL anti-c-myc antibodies. As shown in Figure 3A and 3B, down regulation c-Myc by anti-c-myc antibodies could depress EGFL7 induced cell proliferation and PRL secretion in MMQ cells.

Figure 3 anti-c-Myc antibody depress EGFL7 induced cell proliferation and PRL secretion in MMQ cells. Cell proliferation (A) and ELISA experiments (B) were performed to detect the cell proliferation and PRL secretion in MMQ cells incubated with or without rhEGFL7 and with anti-c-myc antibodies. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).
Figure 3

anti-c-Myc antibody depress EGFL7 induced cell proliferation and PRL secretion in MMQ cells. Cell proliferation (A) and ELISA experiments (B) were performed to detect the cell proliferation and PRL secretion in MMQ cells incubated with or without rhEGFL7 and with anti-c-myc antibodies. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).

3.3 Down regulation c-Myc could depress EGFL7 induced cell invasion

As our above results indicated, knockdown EGFL7 effectively inhibited the invasion and migration of pituitary adenoma. Thus, we measured the effect of down regulation c-Myc in EGFL7 induced cell invasion gene expression of MMQ cells. After incubation with or without rhEGFL7 and with anti-c-myc antibodies in MMQ cells, the mRNA level of invasion related genes N-cadherin, MMP2, MMP-9 and vimentin were measured by RT-PCR experiments. As shown in Figure 4, 50 ng/mL rhEGFL7 significantly enhance the level of MMQ cell invasion related genes N-cadherin (4.6 ± 1.2 fold), MMP-2 (3.8 ± 0.9 fold), MMP-9 (1.8 ± 0.3 fold) and vimentinin (2.9 ± 0.7 fold), and 10 μg/mL anti-c-myc antibodies could significantly inhibit cell invasion gene expression. Meanwhile, down regulation c-Myc by anti-c-myc antibodies could depress EGFL7 induced the level of cell invasion related genes in MMQ cells.

Figure 4 anti-c-Myc antibody depress EGFL7 induced cell invasion in MMQ cells. After incubated with or without rhEGFL7 and with anti-c-myc antibodies in MMQ cells, the relative mRNA level of invasion related genes N-cadherin, MMP2, MMP-9 and vimentinin were measured by RT-PCR experiments. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), #P<0.05 vs. rhEGFL7(+) anti-c-myc antibodies (-). ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).
Figure 4

anti-c-Myc antibody depress EGFL7 induced cell invasion in MMQ cells. After incubated with or without rhEGFL7 and with anti-c-myc antibodies in MMQ cells, the relative mRNA level of invasion related genes N-cadherin, MMP2, MMP-9 and vimentinin were measured by RT-PCR experiments. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), #P<0.05 vs. rhEGFL7(+) anti-c-myc antibodies (-). ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).

3.4 anti-c-Myc antibody could block EGFL7 induced Akt activation

The MAPK and PI3K/AKT signaling pathway are dominantly involved in EGFL7-induced tumor invasiveness. There are some studies reporting that EGFL7 is capable of interacting with AKT and ERK, by modulating EGFR signaling[15, 16]. Meanwhile, PI3K/Akt and MAPK signaling cascades are closely related to the activation of c-myc[12]. Thus, the present study explored whether the downregulation of c-Myc affects EGFL7-induced AKT and ERK activation. Protein extracts from MMQ cell transfected with or without 50 ng/mL rhEGFL7 and with 10 μg/mL anti-c-myc antibodies were detected by western blot, while the phosphorylation status of Akt and Erk in MMQ cells were measured. As seen in Figure 5, after 3 days’ treatment with 50 ng/ml rhEGFL7, it was observed that Akt (Figure 5A and Figure 5B) and Erk (Figure 5A and Figure 5C) phosphorylation levels in MMQ cells were markedly induced by rhEGFL7 in comparison with PBS control. However, anti-c-Myc antibody could block EGFL7 induced Akt activation, but the expression of p-ERK did not alter by anti-c-Myc antibody. Thus, our results suggest that anti-c-myc efficacy could block EGFL7 induced prolactinoma tumorigenesis via inhibited Akt activation in MMQ cells.

Figure 5 anti-c-Myc antibody block EGFL7 induced Akt activation. (A) The phosphorylation status of Akt and Erk in MMQ cells incubation with or without rhEGFL7 and with anti-c-myc antibodies were measured by western blot. Protein level of p-Akt/Akt (B) and p-Erk/Erk (C) expressed as Mean ± SD. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).
Figure 5

anti-c-Myc antibody block EGFL7 induced Akt activation. (A) The phosphorylation status of Akt and Erk in MMQ cells incubation with or without rhEGFL7 and with anti-c-myc antibodies were measured by western blot. Protein level of p-Akt/Akt (B) and p-Erk/Erk (C) expressed as Mean ± SD. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).

4 Discussions

The proteins c‑myc and EGFL7 have been previously reported to be potent markers of tumor development in a wide range of solid tumors [17, 18, 19, 20]. It was observed that the expression of c‑myc had a sharp upregulation at a relatively late stage of prostate cancer, suggesting that correlated with tumor invasion and metastasis [21]. Many pieces of evidence revealed that anti-EGFL7 inhibited tumor growth and enhanced the antiangiogenesis [22, 23]. Our previous results indicated a significantly higher expression of EGFL7 in hormone-secreting pituitary adenomas, which was associated with poor prognosis and invasiveness of tumor cells [8, 9]. So far, very few studies have investigated the correlation of c‑myc and EGFL7 with tumorigenesis and invasion clinicopathological parameters in prolactinoma.

Therefore, the current study is probably a pioneering study with the aim to explore the association between them. The study has investigated the correlation of c‑myc and EGFL7 proteins with invasion in prolactinoma by IHC on tissue microarrays. The data demonstrated that both c‑myc and EGFL7 were over-expressed in invasive prolactinoma in comparison with the non‑invasive prolactinoma and the normal pituitary tissues. Meanwhile, the positive staining of c-myc was strongly linked with high-level EGFL7 in invasive prolactinoma. Thus, c‑myc and EGFL7 was further demonstrated to be potential and potent biological markers for the detection of invasive prolactinoma.

The EGFL7 protein sequence is composed of an amino-terminal signal peptide domain, an EMI, and two centrally located EGF-like domains [24]. Predecessor research results have indicated EGFL7 binds to EGFR with EGF-like domains. Our previous study showed that EGFL7 knockdown has an effect on EGFR signaling cascades [8]. EGFR led to auto-phosphorylation of tyrosine residues with the result that a multitude of downstream signaling pathways were activated, containing protein kinase B (AKT/PKB) and mitogen-activated protein kinase (MAPK) pathways [25]. Meanwhile, PI3K/Akt and MAPK signaling cascades closely related to activation of c-myc [26]. To further investigate the cooperation effect of c-myc and EGFL7 in prolactinoma, MMQ cells were incubated with a 50 ng/mL recombinant human EGFL7rhEGFL7and anti-cmy antibodies were added for down-regulation c-myc level. we compared the cell ability, PRL releasing and invasion gene expression of MMQ cells. The results after the two treatments with rhEGFL7 suggested that cell growth and invasion were inhibited. Moreover, down regulation of c-Myc by anti-c-myc antibodies could depress EGFL7 induced cell proliferation and invasion in MMQ cells (Figure 1-4). To further clarify the effect of c-myc knockdown on EGFL7 induce signaling cascades, we detected the AKT and ERK activation from MMQ cells transfected with or without rhEGFL7 were performed with 10 μg/mL anti-c-myc antibodies. Interestingly, the EGFL7 induced activation of AKT was significantly suppressed by c-myc antibody, but activation of ERK was not changed (Figure 5). These results with both treatments showed the positive interreaction of c-myc and EGFL7 in biological function of MMQ cells and may correlate with Akt activation.

In the present study, we report for the positive interaction between c-myc and EGFL7 in prolactinoma. We also demonstrated that down regulation c-Myc with antibody could depress EGFL7 induced cell proliferation, PRL secretion and invasion of MMQ cells. In brief, our finding suggests that anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis. Thus, c-myc and EGFL7 may serve as a potential novel viable target for treatment of prolactinomas.

Acknowledgements

This work was financially supported by the Beijing Natural Science Foundation of China (No. 81601205) and National Natural Science Foundation of China (81502154, 81601205).

  1. Conflict of interest: The authors declare that they have no competing interests.

References

[1] Glezer A., Bronstein M.D., Prolactinoma, Arq. Bras. Endocrinol. Metabol., 2014, 58(2), 118-123.10.1590/0004-2730000002961Suche in Google Scholar PubMed

[2] Levin G., Rottenstreich A., Prolactin, prolactin disorders, and dopamine agonists during pregnancy, Hormones (Athens). 2019, 18(2),137-139.10.1007/s42000-018-0071-zSuche in Google Scholar PubMed

[3] Oh M.C., Aghi M.K., Dopamine agonist-resistant prolactinomas, J. Neurosurg., 2011, 114(5), 1369-1379.10.3171/2010.11.JNS101369Suche in Google Scholar PubMed

[4] Conacci-Sorrell M., McFerrin L., Eisenman R.N., An overview of MYC and its interactome, Cold. Spring. Harb. Perspect. Med., 2014, 4(1), a014357.10.1101/cshperspect.a014357Suche in Google Scholar PubMed PubMed Central

[5] Sadeghi S., Hojati Z., Tabatabaeian H., Cooverexpression of EpCAM and c-myc genes in malignant breast tumours, J. Genet. 2017, 96(1), 109-118.10.1007/s12041-017-0748-0Suche in Google Scholar PubMed

[6] Trudel M., c-Myc Signalling in the Genetic Mechanism of Polycystic Kidney Disease, In. Polycystic. Kidney. Disease., Li, X., Ed. Brisbane (AU), 2015.10.15586/codon.pkd.2015.ch10Suche in Google Scholar PubMed

[7] Wright J.B., Brown S.J., Cole M.D., Upregulation of c-MYC in cis through a large chromatin loop linked to a cancer risk-associated single-nucleotide polymorphism in colorectal cancer cells, Mol. Cell. Biol. 2010, 30(6), 1411-1420.10.1128/MCB.01384-09Suche in Google Scholar PubMed PubMed Central

[8] Liu Q., Zhang J., Gao H., Yuan T., Kang J., Jin L.,et al., Role of EGFL7/EGFR-signaling pathway in migration and invasion of growth hormone-producing pituitary adenomas, Sci. China. Life. Sci., 2018, 61(8), 893–901.10.1007/s11427-018-9320-4Suche in Google Scholar PubMed

[9] Liu Q., Wang J., Yang H., Gao H., Li C., Lan X., et al., Attenuation of EGFL7 Expression Inhibits Growth Hormone-Producing Pituitary Adenomas Growth and Invasion, Hum. Gene. Ther. 2018, (in press), DOI: 10.1089/hum.2017.200.10.1089/hum.2017.200Suche in Google Scholar PubMed

[10] Liu Q., Yuan T.Y., Gao H., Gui S.B., Zhang Y.Z., Li C.Z., Anti-EGFL7 antibodies inhibit rat prolactinoma MMQ cells proliferation and PRL secretion, Open. Chemistry, 2018, 16, 621-626.10.1515/chem-2018-0064Suche in Google Scholar

[11] Huang C., Yuan X., Wan Y., Liu F., Chen X., Zhan X., et al., VE-statin/Egfl7 expression in malignant glioma and its relevant molecular network, Int. J. Clin. Exp. Pathol., 2014, 7(3), 1022-1031.Suche in Google Scholar

[12] Zhu J., Blenis J., Yuan J., Activation of PI3K/Akt and MAPK pathways regulates Myc-mediated transcription by phosphorylating and promoting the degradation of Mad1, Proc. Natl. Acad. Sci. U.S.A., 2008, 105(18), 6584-6589.10.1073/pnas.0802785105Suche in Google Scholar PubMed PubMed Central

[13] Cao L., Gao H., Li P., Gui S., Zhang Y., The Wnt/beta-catenin signaling pathway is involved in the antitumor effect of fulvestrant on rat prolactinoma MMQ cells, Tumour. biology, 2014, 35(6), 5121-5127.10.1007/s13277-013-1571-8Suche in Google Scholar PubMed

[14] Li Z., Liu Q., Li C., Zong X., Bai J., Wu Y., et al., The role of TGF-beta/Smad signaling in dopamine agonist-resistant prolactinomas, Mol. Cell. Endocrinol., 2015, 402, 64-71.10.1016/j.mce.2014.12.024Suche in Google Scholar PubMed

[15] Massimiani M., Vecchione L., Piccirilli D., Spitalieri P., Amati F., Salvi S., et al., Epidermal growth factor-like domain 7 promotes migration and invasion of human trophoblast cells through activation of MAPK, PI3K and NOTCH signaling pathways, Mol. Hum. Reprod., 2015, 21(5), 435-451.10.1093/molehr/gav006Suche in Google Scholar PubMed PubMed Central

[16] Lim W., Park S., Bazer F.W., Song G., Apigenin Reduces Survival of Choriocarcinoma Cells by Inducing Apoptosis via the PI3K/ AKT and ERK1/2 MAPK Pathways, J. Cell. Physiol, 2016, 231(12), 2690-2699.10.1002/jcp.25372Suche in Google Scholar PubMed

[17] Shimizu T., Ishikawa T., Sugihara E., Kuninaka S., Miyamoto T., Mabuchi Y., et al., c-MYC overexpression with loss of Ink4a/Arf transforms bone marrow stromal cells into osteosarcoma accompanied by loss of adipogenesis, Oncogene., 2010, 29(42), 5687-5699.10.1038/onc.2010.312Suche in Google Scholar PubMed

[18] Su Y., Pelz C., Huang T., Torkenczy K., Wang X., Cherry A., et al., Post-translational modification localizes MYC to the nuclear pore basket to regulate a subset of target genes involved in cellular responses to environmental signals, Genes. Dev., 2018, 32(21-22), 1398-1419.10.1101/gad.314377.118Suche in Google Scholar PubMed PubMed Central

[19] Dudvarski Stankovic N., Bicker F., Keller S., Jones D.T., Harter P.N., Kienzle, A., et al., EGFL7 enhances surface expression of integrin alpha5beta1 to promote angiogenesis in malignant brain tumors, EMBO. Mol. Med. 2018, 10(9), pii: e8420.Suche in Google Scholar

[20] Rattanapan Y., Korkiatsakul V., Kongruang A., Chareonsirisuthigul T., Rerkamnuaychoke B., Wongkularb A., et al., EGFL7 and RASSF1 promoter hypermethylation in epithelial ovarian cancer, Cancer. Genet., 2018, 224-225, 37-40.10.1016/j.cancergen.2018.04.117Suche in Google Scholar PubMed

[21] Inamura N., Kimura T., Wang L., Yanagi H., Tsuda M., Tanino M., et al., Notch1 regulates invasion and metastasis of head and neck squamous cell carcinoma by inducing EMT through c-Myc, Auris. Nasus. Larynx., 2017, 44(4), 447-457.10.1016/j.anl.2016.08.003Suche in Google Scholar PubMed

[22] Johnson L., Huseni M., Smyczek T., Lima A., Yeung S., Cheng J.H., et al., Anti-EGFL7 antibodies enhance stress-induced endothelial cell death and anti-VEGF efficacy, J, Clin. Invest., 2013, 123(9), 3997-4009.10.1172/JCI67892Suche in Google Scholar PubMed PubMed Central

[23] Oh J., Park S.H., Lee T.S., Oh H.K., Choi J.H., Choi Y.S., High expression of epidermal growth factor-like domain 7 is correlated with poor differentiation and poor prognosis in patients with epithelial ovarian cancer, J. Gynecol. Oncol., 2014, 25(4), 334-341.10.3802/jgo.2014.25.4.334Suche in Google Scholar PubMed PubMed Central

[24] Parker L.H., Schmidt M., Jin S.W., Gray A.M., Beis D., Pham T., et al., The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation, Nature., 2004, 428(6984), 754-758.10.1038/nature02416Suche in Google Scholar PubMed

[25] Jabbarzadeh Kaboli P., Leong M.P., Ismail P., Ling K.H., Antitumor effects of berberine against EGFR, ERK1/2, P38 and AKT in MDA-MB231 and MCF-7 breast cancer cells using molecular modelling and in vitro study, Pharmacol. Rep., 2018, 71(1), 13-23.10.1016/j.pharep.2018.07.005Suche in Google Scholar PubMed

[26] Lee Y. J., Jung O., Lee J., Son J., Cho J.Y., Ryou C., et al., Maclurin exerts anti-cancer effects on PC3 human prostate cancer cells via activation of p38 and inhibitions of JNK, FAK, AKT, and c-Myc signaling pathways, Nutr. Res., 2018, 58, 62-71.10.1016/j.nutres.2018.07.003Suche in Google Scholar PubMed

Received: 2018-10-31
Accepted: 2019-05-15
Published Online: 2019-12-31

© 2019 Xiaolei Lan et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 Public License.

Artikel in diesem Heft

  1. Regular Articles
  2. Research on correlation of compositions with oestrogenic activity of Cistanche based on LC/Q-TOF-MS/MS technology
  3. Efficacy of Pyrus elaeagnifolia subsp. elaeagnifolia in acetic acid–induced colitis model
  4. Anti-inflammatory and antinociceptive features of Bryonia alba L.: As a possible alternative in treating rheumatism
  5. High efficiency liposome fusion induced by reducing undesired membrane peptides interaction
  6. Prediction of the Blood-Brain Barrier Permeability Using RP-18 Thin Layer Chromatography
  7. Phytic Acid Extracted from Rice Bran as a Growth Promoter for Euglena gracilis
  8. Development of a validated spectrofluorimetric method for assay of sotalol hydrochloride in tablets and human plasma: application for stability-indicating studies
  9. Topological Indices of Hyaluronic Acid-Paclitaxel Conjugates’ Molecular Structure in Cancer Treatment
  10. Thermodynamic properties of the bubble growth process in a pool boiling of water-ethanol mixture two-component system
  11. Critical Roles of the PI3K-Akt-mTOR Signaling Pathway in Apoptosis and Autophagy of Astrocytes Induced by Methamphetamine
  12. Characteristics of Stable Hydrogen and Oxygen Isotopes of Soil Moisture under Different Land Use in Dry Hot Valley of Yuanmou
  13. Specific, highly sensitive and simple spectrofluorimetric method for quantification of daclatasvir in HCV human plasma patients and in tablets dosage form
  14. Chromium-modified cobalt molybdenum nitrides as catalysts for ammonia synthesis
  15. Langerhans cell-like dendritic cells treated with ginsenoside Rh2 regulate the differentiation of Th1 and Th2 cells in vivo
  16. Identification of Powdery Mildew Blumeria graminis f. sp. tritici Resistance Genes in Selected Wheat Varieties and Development of Multiplex PCR
  17. Computational Analysis of new Degree-based descriptors of oxide networks
  18. The Use Of Chemical Composition And Additives To Classify Petrol And Diesel Using Gas Chromatography–Mass Spectrometry And Chemometric Analysis: A Uk Study
  19. Minimal Energy Tree with 4 Branched Vertices
  20. Jatropha seed oil derived poly(esteramide-urethane)/ fumed silica nanocomposite coatings for corrosion protection
  21. Calculating topological indices of certain OTIS interconnection networks
  22. Energy storage analysis of R125 in UIO-66 and MOF-5 nanoparticles: A molecular simulation study
  23. Velvet Antler compounds targeting major cell signaling pathways in osteosarcoma - a new insight into mediating the process of invasion and metastasis in OS
  24. Effects of Azadirachta Indica Leaf Extract, Capping Agents, on the Synthesis of Pure And Cu Doped ZnO-Nanoparticles: A Green Approach and Microbial Activity
  25. Aqueous Micro-hydration of Na+(H2O)n=1-7 Clusters: DFT Study
  26. A proposed image-based detection of methamidophos pesticide using peroxyoxalate chemiluminescence system
  27. Phytochemical screening and estrogenic activity of total glycosides of Cistanche deserticola
  28. Biological evaluation of a series of benzothiazole derivatives as mosquitocidal agents
  29. Chemical pretreatments of Trapa bispinosa's peel (TBP) biosorbent to enhance adsorption capacity for Pb(ll)
  30. Dynamic Changes in MMP1 and TIMP1 in the Antifibrotic Process of Dahuang Zhechong Pill in Rats with Liver Fibrosis
  31. The Optimization and Production of Ginkgolide B Lipid Microemulsion
  32. Photodynamic Therapy Enhanced the Antitumor Effects of Berberine on HeLa Cells
  33. Chiral and Achiral Enantiomeric Separation of (±)-Alprenolol
  34. Correlation of Water Fluoride with Body Fluids, Dental Fluorosis and FT4, FT3 –TSH Disruption among Children in an Endemic Fluorosis area in Pakistan
  35. A one-step incubation ELISA kit for rapid determination of dibutyl phthalate in water, beverage and liquor
  36. Free Radical Scavenging Activity of Essential Oil of Eugenia caryophylata from Amboina Island and Derivatives of Eugenol
  37. Effects of Blue and Red Light On Growth And Nitrate Metabolism In Pakchoi
  38. miRNA-199a-5p functions as a tumor suppressor in prolactinomas
  39. Solar photodegradation of carbamazepine from aqueous solutions using a compound parabolic concentrator equipped with a sun tracking system
  40. Influence of sub-inhibitory concentration of selected plant essential oils on the physical and biochemical properties of Pseudomonas orientalis
  41. Preparation and spectroscopic studies of Fe(II), Ru(II), Pd(II) and Zn(II) complexes of Schiff base containing terephthalaldehyde and their transfer hydrogenation and Suzuki-Miyaura coupling reaction
  42. Complex formation in a liquid-liquid extraction-chromogenic system for vanadium(IV)
  43. Synthesis, characterization (IR, 1H, 13C & 31P NMR), fungicidal, herbicidal and molecular docking evaluation of steroid phosphorus compounds
  44. Analysis and Biological Evaluation of Arisaema Amuremse Maxim Essential Oil
  45. A preliminary assessment of potential ecological risk and soil contamination by heavy metals around a cement factory, western Saudi Arabia
  46. Anti- inflammatory effect of Prunus tomentosa Thunb total flavones in LPS-induced RAW264.7 cells
  47. Collaborative Influence of Elevated CO2 Concentration and High Temperature on Potato Biomass Accumulation and Characteristics
  48. Methods of extraction, physicochemical properties of alginates and their applications in biomedical field – a review
  49. Characteristics of liposomes derived from egg yolk
  50. Preparation of ternary ZnO/Ag/cellulose and its enhanced photocatalytic degradation property on phenol and benzene in VOCs
  51. Influence of Human Serum Albumin Glycation on the Binding Affinities for Natural Flavonoids
  52. Synthesis and antioxidant activity of 2-methylthio-pyrido[3,2-e][1,2,4] triazolo[1,5-a]pyrimidines
  53. Comparative study on the antioxidant activities of ten common flower teas from China
  54. Molecular Properties of Symmetrical Networks Using Topological Polynomials
  55. Synthesis of Co3O4 Nano Aggregates by Co-precipitation Method and its Catalytic and Fuel Additive Applications
  56. Phytochemical analysis, Antioxidant and Antiprotoscolices potential of ethanol extracts of selected plants species against Echinococcus granulosus: In-vitro study
  57. Silver nanoparticles enhanced fluorescence for sensitive determination of fluoroquinolones in water solutions
  58. Simultaneous Quantification of the New Psychoactive Substances 3-FMC, 3-FPM, 4-CEC, and 4-BMC in Human Blood using GC-MS
  59. Biodiesel Production by Lipids From Indonesian strain of Microalgae Chlorella vulgaris
  60. Miscibility studies of polystyrene/polyvinyl chloride blend in presence of organoclay
  61. Antibacterial Activities of Transition Metal complexes of Mesocyclic Amidine 1,4-diazacycloheptane (DACH)
  62. Novel 1,8-Naphthyridine Derivatives: Design, Synthesis and in vitro screening of their cytotoxic activity against MCF7 cell line
  63. Investigation of Stress Corrosion Cracking Behaviour of Mg-Al-Zn Alloys in Different pH Environments by SSRT Method
  64. Various Combinations of Flame Retardants for Poly (vinyl chloride)
  65. Phenolic compounds and biological activities of rye (Secale cereale L.) grains
  66. Oxidative degradation of gentamicin present in water by an electro-Fenton process and biodegradability improvement
  67. Optimizing Suitable Conditions for the Removal of Ammonium Nitrogen by a Microbe Isolated from Chicken Manure
  68. Anti-inflammatory, antipyretic, analgesic, and antioxidant activities of Haloxylon salicornicum aqueous fraction
  69. The anti-corrosion behaviour of Satureja montana L. extract on iron in NaCl solution
  70. Interleukin-4, hemopexin, and lipoprotein-associated phospholipase A2 are significantly increased in patients with unstable carotid plaque
  71. A comparative study of the crystal structures of 2-(4-(2-(4-(3-chlorophenyl)pipera -zinyl)ethyl) benzyl)isoindoline-1,3-dione by synchrotron radiation X-ray powder diffraction and single-crystal X-ray diffraction
  72. Conceptual DFT as a Novel Chemoinformatics Tool for Studying the Chemical Reactivity Properties of the Amatoxin Family of Fungal Peptides
  73. Occurrence of Aflatoxin M1 in Milk-based Mithae samples from Pakistan
  74. Kinetics of Iron Removal From Ti-Extraction Blast Furnace Slag by Chlorination Calcination
  75. Increasing the activity of DNAzyme based on the telomeric sequence: 2’-OMe-RNA and LNA modifications
  76. Exploring the optoelectronic properties of a chromene-appended pyrimidone derivative for photovoltaic applications
  77. Effect of He Qi San on DNA Methylation in Type 2 Diabetes Mellitus Patients with Phlegm-blood Stasis Syndrome
  78. Cyclodextrin potentiometric sensors based on selective recognition sites for procainamide: Comparative and theoretical study
  79. Greener synthesis of dimethyl carbonate from carbon dioxide and methanol using a tunable ionic liquid catalyst
  80. Nonisothermal Cold Crystallization Kinetics of Poly(lactic acid)/Bacterial Poly(hydroxyoctanoate) (PHO)/Talc
  81. Enhanced adsorption of sulfonamide antibiotics in water by modified biochar derived from bagasse
  82. Study on the Mechanism of Shugan Xiaozhi Fang on Cells with Non-alcoholic Fatty Liver Disease
  83. Comparative Effects of Salt and Alkali Stress on Antioxidant System in Cotton (Gossypium Hirsutum L.) Leaves
  84. Optimization of chromatographic systems for analysis of selected psychotropic drugs and their metabolites in serum and saliva by HPLC in order to monitor therapeutic drugs
  85. Electrocatalytic Properties of Ni-Doped BaFe12O19 for Oxygen Evolution in Alkaline Solution
  86. Study on the removal of high contents of ammonium from piggery wastewater by clinoptilolite and the corresponding mechanisms
  87. Phytochemistry and toxicological assessment of Bryonia dioica roots used in north-African alternative medicine
  88. The essential oil composition of selected Hemerocallis cultivars and their biological activity
  89. Mechanical Properties of Carbon Fiber Reinforced Nanocrystalline Nickel Composite Electroforming Deposit
  90. Anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis
  91. Topical Issue on Applications of Mathematics in Chemistry
  92. Zagreb Connection Number Index of Nanotubes and Regular Hexagonal Lattice
  93. The Sanskruti index of trees and unicyclic graphs
  94. Valency-based molecular descriptors of Bakelite network BNmn
  95. Computing Topological Indices for Para-Line Graphs of Anthracene
  96. Zagreb Polynomials and redefined Zagreb indices of Dendrimers and Polyomino Chains
  97. Topological Descriptor of 2-Dimensional Silicon Carbons and Their Applications
  98. Topological invariants for the line graphs of some classes of graphs
  99. Words for maximal Subgroups of Fi24‘
  100. Generators of Maximal Subgroups of Harada-Norton and some Linear Groups
  101. Special Issue on POKOCHA 2018
  102. Influence of Production Parameters on the Content of Polyphenolic Compounds in Extruded Porridge Enriched with Chokeberry Fruit (Aronia melanocarpa (Michx.) Elliott)
  103. Effects of Supercritical Carbon Dioxide Extraction (SC-CO2) on the content of tiliroside in the extracts from Tilia L. flowers
  104. Impact of xanthan gum addition on phenolic acids composition and selected properties of new gluten-free maize-field bean pasta
  105. Impact of storage temperature and time on Moldavian dragonhead oil – spectroscopic and chemometric analysis
  106. The effect of selected substances on the stability of standard solutions in voltammetric analysis of ascorbic acid in fruit juices
  107. Determination of the content of Pb, Cd, Cu, Zn in dairy products from various regions of Poland
  108. Special Issue on IC3PE 2018 Conference
  109. The Photocatalytic Activity of Zns-TiO2 on a Carbon Fiber Prepared by Chemical Bath Deposition
  110. N-octyl chitosan derivatives as amphiphilic carrier agents for herbicide formulations
  111. Kinetics and Mechanistic Study of Hydrolysis of Adenosine Monophosphate Disodium Salt (AMPNa2) in Acidic and Alkaline Media
  112. Antimalarial Activity of Andrographis Paniculata Ness‘s N-hexane Extract and Its Major Compounds
  113. Special Issue on ABB2018 Conference
  114. Special Issue on ICCESEN 2017
  115. Theoretical Diagnostics of Second and Third-order Hyperpolarizabilities of Several Acid Derivatives
  116. Determination of Gamma Rays Efficiency Against Rhizoctonia solani in Potatoes
  117. Studies On Compatibilization Of Recycled Polyethylene/Thermoplastic Starch Blends By Using Different Compatibilizer
  118. Liquid−Liquid Extraction of Linalool from Methyl Eugenol with 1-Ethyl-3-methylimidazolium Hydrogen Sulfate [EMIM][HSO4] Ionic Liquid
  119. Synthesis of Graphene Oxide Through Ultrasonic Assisted Electrochemical Exfoliation
  120. Special Issue on ISCMP 2018
  121. Synthesis and antiproliferative evaluation of some 1,4-naphthoquinone derivatives against human cervical cancer cells
  122. The influence of the grafted aryl groups on the solvation properties of the graphyne and graphdiyne - a MD study
  123. Electrochemical modification of platinum and glassy carbon surfaces with pyridine layers and their use as complexing agents for copper (II) ions
  124. Effect of Electrospinning Process on Total Antioxidant Activity of Electrospun Nanofibers Containing Grape Seed Extract
  125. Effect Of Thermal Treatment Of Trepel At Temperature Range 800-1200˚C
  126. Topical Issue on Agriculture
  127. The effect of Cladophora glomerata exudates on the amino acid composition of Cladophora fracta and Rhizoclonium sp.
  128. Influence of the Static Magnetic Field and Algal Extract on the Germination of Soybean Seeds
  129. The use of UV-induced fluorescence for the assessment of homogeneity of granular mixtures
  130. The use of microorganisms as bio-fertilizers in the cultivation of white lupine
  131. Lyophilized apples on flax oil and ethyl esters of flax oil - stability and antioxidant evaluation
  132. Production of phosphorus biofertilizer based on the renewable materials in large laboratory scale
  133. Human health risk assessment of potential toxic elements in paddy soil and rice (Oryza sativa) from Ugbawka fields, Enugu, Nigeria
  134. Recovery of phosphates(V) from wastewaters of different chemical composition
  135. Special Issue on the 4th Green Chemistry 2018
  136. Dead zone for hydrogenation of propylene reaction carried out on commercial catalyst pellets
  137. Improved thermally stable oligoetherols from 6-aminouracil, ethylene carbonate and boric acid
  138. The role of a chemical loop in removal of hazardous contaminants from coke oven wastewater during its treatment
  139. Combating paraben pollution in surface waters with a variety of photocatalyzed systems: Looking for the most efficient technology
  140. Special Issue on Chemistry Today for Tomorrow 2019
  141. Applying Discriminant and Cluster Analyses to Separate Allergenic from Non-allergenic Proteins
  142. Chemometric Expertise Of Clinical Monitoring Data Of Prolactinoma Patients
  143. Chemomertic Risk Assessment of Soil Pollution
  144. New composite sorbent for speciation analysis of soluble chromium in textiles
  145. Photocatalytic activity of NiFe2O4 and Zn0.5Ni0.5Fe2O4 modified by Eu(III) and Tb(III) for decomposition of Malachite Green
  146. Photophysical and antibacterial activity of light-activated quaternary eosin Y
  147. Spectral properties and biological activity of La(III) and Nd(III) Monensinates
  148. Special Issue on Monitoring, Risk Assessment and Sustainable Management for the Exposure to Environmental Toxins
  149. Soil organic carbon mineralization in relation to microbial dynamics in subtropical red soils dominated by differently sized aggregates
  150. A potential reusable fluorescent aptasensor based on magnetic nanoparticles for ochratoxin A analysis
  151. Special Issue on 13th JCC 2018
  152. Fluorescence study of 5-nitroisatin Schiff base immobilized on SBA-15 for sensing Fe3+
  153. Thermal and Morphology Properties of Cellulose Nanofiber from TEMPO-oxidized Lower part of Empty Fruit Bunches (LEFB)
  154. Encapsulation of Vitamin C in Sesame Liposomes: Computational and Experimental Studies
  155. A comparative study of the utilization of synthetic foaming agent and aluminum powder as pore-forming agents in lightweight geopolymer synthesis
  156. Synthesis of high surface area mesoporous silica SBA-15 by adjusting hydrothermal treatment time and the amount of polyvinyl alcohol
  157. Review of large-pore mesostructured cellular foam (MCF) silica and its applications
  158. Ion Exchange of Benzoate in Ni-Al-Benzoate Layered Double Hydroxide by Amoxicillin
  159. Synthesis And Characterization Of CoMo/Mordenite Catalyst For Hydrotreatment Of Lignin Compound Models
  160. Production of Biodiesel from Nyamplung (Calophyllum inophyllum L.) using Microwave with CaO Catalyst from Eggshell Waste: Optimization of Transesterification Process Parameters
  161. The Study of the Optical Properties of C60 Fullerene in Different Organic Solvents
  162. Composite Material Consisting of HKUST-1 and Indonesian Activated Natural Zeolite and its Application in CO2 Capture
  163. Topical Issue on Environmental Chemistry
  164. Ionic liquids modified cobalt/ZSM-5 as a highly efficient catalyst for enhancing the selectivity towards KA oil in the aerobic oxidation of cyclohexane
  165. Application of Thermal Resistant Gemini Surfactants in Highly Thixotropic Water-in-oil Drilling Fluid System
  166. Screening Study on Rheological Behavior and Phase Transition Point of Polymer-containing Fluids produced under the Oil Freezing Point Temperature
  167. The Chemical Softening Effect and Mechanism of Low Rank Coal Soaked in Alkaline Solution
  168. The Influence Of NO/O2 On The NOx Storage Properties Over A Pt-Ba-Ce/γ-Al2O3 Catalyst
  169. Special Issue on the International conference CosCI 2018
  170. Design of SiO2/TiO2 that Synergistically Increases The Hydrophobicity of Methyltrimethoxysilane Coated Glass
  171. Antidiabetes and Antioxidant agents from Clausena excavata root as medicinal plant of Myanmar
  172. Development of a Gold Immunochromatographic Assay Method Using Candida Biofilm Antigen as a Bioreceptor for Candidiasis in Rats
  173. Special Issue on Applied Biochemistry and Biotechnology 2019
  174. Adsorption of copper ions on Magnolia officinalis residues after solid-phase fermentation with Phanerochaete chrysosporium
  175. Erratum
  176. Erratum to: Sand Dune Characterization For Preparing Metallurgical Grade Silicon
https://doi.org/10.1515/chem-2019-0151
Schlagwörter für diesen Artikel
EGFL7; c-myc; Cooperatation; Prolactinoma; Tumorigenesis
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Regular Articles
  2. Research on correlation of compositions with oestrogenic activity of Cistanche based on LC/Q-TOF-MS/MS technology
  3. Efficacy of Pyrus elaeagnifolia subsp. elaeagnifolia in acetic acid–induced colitis model
  4. Anti-inflammatory and antinociceptive features of Bryonia alba L.: As a possible alternative in treating rheumatism
  5. High efficiency liposome fusion induced by reducing undesired membrane peptides interaction
  6. Prediction of the Blood-Brain Barrier Permeability Using RP-18 Thin Layer Chromatography
  7. Phytic Acid Extracted from Rice Bran as a Growth Promoter for Euglena gracilis
  8. Development of a validated spectrofluorimetric method for assay of sotalol hydrochloride in tablets and human plasma: application for stability-indicating studies
  9. Topological Indices of Hyaluronic Acid-Paclitaxel Conjugates’ Molecular Structure in Cancer Treatment
  10. Thermodynamic properties of the bubble growth process in a pool boiling of water-ethanol mixture two-component system
  11. Critical Roles of the PI3K-Akt-mTOR Signaling Pathway in Apoptosis and Autophagy of Astrocytes Induced by Methamphetamine
  12. Characteristics of Stable Hydrogen and Oxygen Isotopes of Soil Moisture under Different Land Use in Dry Hot Valley of Yuanmou
  13. Specific, highly sensitive and simple spectrofluorimetric method for quantification of daclatasvir in HCV human plasma patients and in tablets dosage form
  14. Chromium-modified cobalt molybdenum nitrides as catalysts for ammonia synthesis
  15. Langerhans cell-like dendritic cells treated with ginsenoside Rh2 regulate the differentiation of Th1 and Th2 cells in vivo
  16. Identification of Powdery Mildew Blumeria graminis f. sp. tritici Resistance Genes in Selected Wheat Varieties and Development of Multiplex PCR
  17. Computational Analysis of new Degree-based descriptors of oxide networks
  18. The Use Of Chemical Composition And Additives To Classify Petrol And Diesel Using Gas Chromatography–Mass Spectrometry And Chemometric Analysis: A Uk Study
  19. Minimal Energy Tree with 4 Branched Vertices
  20. Jatropha seed oil derived poly(esteramide-urethane)/ fumed silica nanocomposite coatings for corrosion protection
  21. Calculating topological indices of certain OTIS interconnection networks
  22. Energy storage analysis of R125 in UIO-66 and MOF-5 nanoparticles: A molecular simulation study
  23. Velvet Antler compounds targeting major cell signaling pathways in osteosarcoma - a new insight into mediating the process of invasion and metastasis in OS
  24. Effects of Azadirachta Indica Leaf Extract, Capping Agents, on the Synthesis of Pure And Cu Doped ZnO-Nanoparticles: A Green Approach and Microbial Activity
  25. Aqueous Micro-hydration of Na+(H2O)n=1-7 Clusters: DFT Study
  26. A proposed image-based detection of methamidophos pesticide using peroxyoxalate chemiluminescence system
  27. Phytochemical screening and estrogenic activity of total glycosides of Cistanche deserticola
  28. Biological evaluation of a series of benzothiazole derivatives as mosquitocidal agents
  29. Chemical pretreatments of Trapa bispinosa's peel (TBP) biosorbent to enhance adsorption capacity for Pb(ll)
  30. Dynamic Changes in MMP1 and TIMP1 in the Antifibrotic Process of Dahuang Zhechong Pill in Rats with Liver Fibrosis
  31. The Optimization and Production of Ginkgolide B Lipid Microemulsion
  32. Photodynamic Therapy Enhanced the Antitumor Effects of Berberine on HeLa Cells
  33. Chiral and Achiral Enantiomeric Separation of (±)-Alprenolol
  34. Correlation of Water Fluoride with Body Fluids, Dental Fluorosis and FT4, FT3 –TSH Disruption among Children in an Endemic Fluorosis area in Pakistan
  35. A one-step incubation ELISA kit for rapid determination of dibutyl phthalate in water, beverage and liquor
  36. Free Radical Scavenging Activity of Essential Oil of Eugenia caryophylata from Amboina Island and Derivatives of Eugenol
  37. Effects of Blue and Red Light On Growth And Nitrate Metabolism In Pakchoi
  38. miRNA-199a-5p functions as a tumor suppressor in prolactinomas
  39. Solar photodegradation of carbamazepine from aqueous solutions using a compound parabolic concentrator equipped with a sun tracking system
  40. Influence of sub-inhibitory concentration of selected plant essential oils on the physical and biochemical properties of Pseudomonas orientalis
  41. Preparation and spectroscopic studies of Fe(II), Ru(II), Pd(II) and Zn(II) complexes of Schiff base containing terephthalaldehyde and their transfer hydrogenation and Suzuki-Miyaura coupling reaction
  42. Complex formation in a liquid-liquid extraction-chromogenic system for vanadium(IV)
  43. Synthesis, characterization (IR, 1H, 13C & 31P NMR), fungicidal, herbicidal and molecular docking evaluation of steroid phosphorus compounds
  44. Analysis and Biological Evaluation of Arisaema Amuremse Maxim Essential Oil
  45. A preliminary assessment of potential ecological risk and soil contamination by heavy metals around a cement factory, western Saudi Arabia
  46. Anti- inflammatory effect of Prunus tomentosa Thunb total flavones in LPS-induced RAW264.7 cells
  47. Collaborative Influence of Elevated CO2 Concentration and High Temperature on Potato Biomass Accumulation and Characteristics
  48. Methods of extraction, physicochemical properties of alginates and their applications in biomedical field – a review
  49. Characteristics of liposomes derived from egg yolk
  50. Preparation of ternary ZnO/Ag/cellulose and its enhanced photocatalytic degradation property on phenol and benzene in VOCs
  51. Influence of Human Serum Albumin Glycation on the Binding Affinities for Natural Flavonoids
  52. Synthesis and antioxidant activity of 2-methylthio-pyrido[3,2-e][1,2,4] triazolo[1,5-a]pyrimidines
  53. Comparative study on the antioxidant activities of ten common flower teas from China
  54. Molecular Properties of Symmetrical Networks Using Topological Polynomials
  55. Synthesis of Co3O4 Nano Aggregates by Co-precipitation Method and its Catalytic and Fuel Additive Applications
  56. Phytochemical analysis, Antioxidant and Antiprotoscolices potential of ethanol extracts of selected plants species against Echinococcus granulosus: In-vitro study
  57. Silver nanoparticles enhanced fluorescence for sensitive determination of fluoroquinolones in water solutions
  58. Simultaneous Quantification of the New Psychoactive Substances 3-FMC, 3-FPM, 4-CEC, and 4-BMC in Human Blood using GC-MS
  59. Biodiesel Production by Lipids From Indonesian strain of Microalgae Chlorella vulgaris
  60. Miscibility studies of polystyrene/polyvinyl chloride blend in presence of organoclay
  61. Antibacterial Activities of Transition Metal complexes of Mesocyclic Amidine 1,4-diazacycloheptane (DACH)
  62. Novel 1,8-Naphthyridine Derivatives: Design, Synthesis and in vitro screening of their cytotoxic activity against MCF7 cell line
  63. Investigation of Stress Corrosion Cracking Behaviour of Mg-Al-Zn Alloys in Different pH Environments by SSRT Method
  64. Various Combinations of Flame Retardants for Poly (vinyl chloride)
  65. Phenolic compounds and biological activities of rye (Secale cereale L.) grains
  66. Oxidative degradation of gentamicin present in water by an electro-Fenton process and biodegradability improvement
  67. Optimizing Suitable Conditions for the Removal of Ammonium Nitrogen by a Microbe Isolated from Chicken Manure
  68. Anti-inflammatory, antipyretic, analgesic, and antioxidant activities of Haloxylon salicornicum aqueous fraction
  69. The anti-corrosion behaviour of Satureja montana L. extract on iron in NaCl solution
  70. Interleukin-4, hemopexin, and lipoprotein-associated phospholipase A2 are significantly increased in patients with unstable carotid plaque
  71. A comparative study of the crystal structures of 2-(4-(2-(4-(3-chlorophenyl)pipera -zinyl)ethyl) benzyl)isoindoline-1,3-dione by synchrotron radiation X-ray powder diffraction and single-crystal X-ray diffraction
  72. Conceptual DFT as a Novel Chemoinformatics Tool for Studying the Chemical Reactivity Properties of the Amatoxin Family of Fungal Peptides
  73. Occurrence of Aflatoxin M1 in Milk-based Mithae samples from Pakistan
  74. Kinetics of Iron Removal From Ti-Extraction Blast Furnace Slag by Chlorination Calcination
  75. Increasing the activity of DNAzyme based on the telomeric sequence: 2’-OMe-RNA and LNA modifications
  76. Exploring the optoelectronic properties of a chromene-appended pyrimidone derivative for photovoltaic applications
  77. Effect of He Qi San on DNA Methylation in Type 2 Diabetes Mellitus Patients with Phlegm-blood Stasis Syndrome
  78. Cyclodextrin potentiometric sensors based on selective recognition sites for procainamide: Comparative and theoretical study
  79. Greener synthesis of dimethyl carbonate from carbon dioxide and methanol using a tunable ionic liquid catalyst
  80. Nonisothermal Cold Crystallization Kinetics of Poly(lactic acid)/Bacterial Poly(hydroxyoctanoate) (PHO)/Talc
  81. Enhanced adsorption of sulfonamide antibiotics in water by modified biochar derived from bagasse
  82. Study on the Mechanism of Shugan Xiaozhi Fang on Cells with Non-alcoholic Fatty Liver Disease
  83. Comparative Effects of Salt and Alkali Stress on Antioxidant System in Cotton (Gossypium Hirsutum L.) Leaves
  84. Optimization of chromatographic systems for analysis of selected psychotropic drugs and their metabolites in serum and saliva by HPLC in order to monitor therapeutic drugs
  85. Electrocatalytic Properties of Ni-Doped BaFe12O19 for Oxygen Evolution in Alkaline Solution
  86. Study on the removal of high contents of ammonium from piggery wastewater by clinoptilolite and the corresponding mechanisms
  87. Phytochemistry and toxicological assessment of Bryonia dioica roots used in north-African alternative medicine
  88. The essential oil composition of selected Hemerocallis cultivars and their biological activity
  89. Mechanical Properties of Carbon Fiber Reinforced Nanocrystalline Nickel Composite Electroforming Deposit
  90. Anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis
  91. Topical Issue on Applications of Mathematics in Chemistry
  92. Zagreb Connection Number Index of Nanotubes and Regular Hexagonal Lattice
  93. The Sanskruti index of trees and unicyclic graphs
  94. Valency-based molecular descriptors of Bakelite network BNmn
  95. Computing Topological Indices for Para-Line Graphs of Anthracene
  96. Zagreb Polynomials and redefined Zagreb indices of Dendrimers and Polyomino Chains
  97. Topological Descriptor of 2-Dimensional Silicon Carbons and Their Applications
  98. Topological invariants for the line graphs of some classes of graphs
  99. Words for maximal Subgroups of Fi24‘
  100. Generators of Maximal Subgroups of Harada-Norton and some Linear Groups
  101. Special Issue on POKOCHA 2018
  102. Influence of Production Parameters on the Content of Polyphenolic Compounds in Extruded Porridge Enriched with Chokeberry Fruit (Aronia melanocarpa (Michx.) Elliott)
  103. Effects of Supercritical Carbon Dioxide Extraction (SC-CO2) on the content of tiliroside in the extracts from Tilia L. flowers
  104. Impact of xanthan gum addition on phenolic acids composition and selected properties of new gluten-free maize-field bean pasta
  105. Impact of storage temperature and time on Moldavian dragonhead oil – spectroscopic and chemometric analysis
  106. The effect of selected substances on the stability of standard solutions in voltammetric analysis of ascorbic acid in fruit juices
  107. Determination of the content of Pb, Cd, Cu, Zn in dairy products from various regions of Poland
  108. Special Issue on IC3PE 2018 Conference
  109. The Photocatalytic Activity of Zns-TiO2 on a Carbon Fiber Prepared by Chemical Bath Deposition
  110. N-octyl chitosan derivatives as amphiphilic carrier agents for herbicide formulations
  111. Kinetics and Mechanistic Study of Hydrolysis of Adenosine Monophosphate Disodium Salt (AMPNa2) in Acidic and Alkaline Media
  112. Antimalarial Activity of Andrographis Paniculata Ness‘s N-hexane Extract and Its Major Compounds
  113. Special Issue on ABB2018 Conference
  114. Special Issue on ICCESEN 2017
  115. Theoretical Diagnostics of Second and Third-order Hyperpolarizabilities of Several Acid Derivatives
  116. Determination of Gamma Rays Efficiency Against Rhizoctonia solani in Potatoes
  117. Studies On Compatibilization Of Recycled Polyethylene/Thermoplastic Starch Blends By Using Different Compatibilizer
  118. Liquid−Liquid Extraction of Linalool from Methyl Eugenol with 1-Ethyl-3-methylimidazolium Hydrogen Sulfate [EMIM][HSO4] Ionic Liquid
  119. Synthesis of Graphene Oxide Through Ultrasonic Assisted Electrochemical Exfoliation
  120. Special Issue on ISCMP 2018
  121. Synthesis and antiproliferative evaluation of some 1,4-naphthoquinone derivatives against human cervical cancer cells
  122. The influence of the grafted aryl groups on the solvation properties of the graphyne and graphdiyne - a MD study
  123. Electrochemical modification of platinum and glassy carbon surfaces with pyridine layers and their use as complexing agents for copper (II) ions
  124. Effect of Electrospinning Process on Total Antioxidant Activity of Electrospun Nanofibers Containing Grape Seed Extract
  125. Effect Of Thermal Treatment Of Trepel At Temperature Range 800-1200˚C
  126. Topical Issue on Agriculture
  127. The effect of Cladophora glomerata exudates on the amino acid composition of Cladophora fracta and Rhizoclonium sp.
  128. Influence of the Static Magnetic Field and Algal Extract on the Germination of Soybean Seeds
  129. The use of UV-induced fluorescence for the assessment of homogeneity of granular mixtures
  130. The use of microorganisms as bio-fertilizers in the cultivation of white lupine
  131. Lyophilized apples on flax oil and ethyl esters of flax oil - stability and antioxidant evaluation
  132. Production of phosphorus biofertilizer based on the renewable materials in large laboratory scale
  133. Human health risk assessment of potential toxic elements in paddy soil and rice (Oryza sativa) from Ugbawka fields, Enugu, Nigeria
  134. Recovery of phosphates(V) from wastewaters of different chemical composition
  135. Special Issue on the 4th Green Chemistry 2018
  136. Dead zone for hydrogenation of propylene reaction carried out on commercial catalyst pellets
  137. Improved thermally stable oligoetherols from 6-aminouracil, ethylene carbonate and boric acid
  138. The role of a chemical loop in removal of hazardous contaminants from coke oven wastewater during its treatment
  139. Combating paraben pollution in surface waters with a variety of photocatalyzed systems: Looking for the most efficient technology
  140. Special Issue on Chemistry Today for Tomorrow 2019
  141. Applying Discriminant and Cluster Analyses to Separate Allergenic from Non-allergenic Proteins
  142. Chemometric Expertise Of Clinical Monitoring Data Of Prolactinoma Patients
  143. Chemomertic Risk Assessment of Soil Pollution
  144. New composite sorbent for speciation analysis of soluble chromium in textiles
  145. Photocatalytic activity of NiFe2O4 and Zn0.5Ni0.5Fe2O4 modified by Eu(III) and Tb(III) for decomposition of Malachite Green
  146. Photophysical and antibacterial activity of light-activated quaternary eosin Y
  147. Spectral properties and biological activity of La(III) and Nd(III) Monensinates
  148. Special Issue on Monitoring, Risk Assessment and Sustainable Management for the Exposure to Environmental Toxins
  149. Soil organic carbon mineralization in relation to microbial dynamics in subtropical red soils dominated by differently sized aggregates
  150. A potential reusable fluorescent aptasensor based on magnetic nanoparticles for ochratoxin A analysis
  151. Special Issue on 13th JCC 2018
  152. Fluorescence study of 5-nitroisatin Schiff base immobilized on SBA-15 for sensing Fe3+
  153. Thermal and Morphology Properties of Cellulose Nanofiber from TEMPO-oxidized Lower part of Empty Fruit Bunches (LEFB)
  154. Encapsulation of Vitamin C in Sesame Liposomes: Computational and Experimental Studies
  155. A comparative study of the utilization of synthetic foaming agent and aluminum powder as pore-forming agents in lightweight geopolymer synthesis
  156. Synthesis of high surface area mesoporous silica SBA-15 by adjusting hydrothermal treatment time and the amount of polyvinyl alcohol
  157. Review of large-pore mesostructured cellular foam (MCF) silica and its applications
  158. Ion Exchange of Benzoate in Ni-Al-Benzoate Layered Double Hydroxide by Amoxicillin
  159. Synthesis And Characterization Of CoMo/Mordenite Catalyst For Hydrotreatment Of Lignin Compound Models
  160. Production of Biodiesel from Nyamplung (Calophyllum inophyllum L.) using Microwave with CaO Catalyst from Eggshell Waste: Optimization of Transesterification Process Parameters
  161. The Study of the Optical Properties of C60 Fullerene in Different Organic Solvents
  162. Composite Material Consisting of HKUST-1 and Indonesian Activated Natural Zeolite and its Application in CO2 Capture
  163. Topical Issue on Environmental Chemistry
  164. Ionic liquids modified cobalt/ZSM-5 as a highly efficient catalyst for enhancing the selectivity towards KA oil in the aerobic oxidation of cyclohexane
  165. Application of Thermal Resistant Gemini Surfactants in Highly Thixotropic Water-in-oil Drilling Fluid System
  166. Screening Study on Rheological Behavior and Phase Transition Point of Polymer-containing Fluids produced under the Oil Freezing Point Temperature
  167. The Chemical Softening Effect and Mechanism of Low Rank Coal Soaked in Alkaline Solution
  168. The Influence Of NO/O2 On The NOx Storage Properties Over A Pt-Ba-Ce/γ-Al2O3 Catalyst
  169. Special Issue on the International conference CosCI 2018
  170. Design of SiO2/TiO2 that Synergistically Increases The Hydrophobicity of Methyltrimethoxysilane Coated Glass
  171. Antidiabetes and Antioxidant agents from Clausena excavata root as medicinal plant of Myanmar
  172. Development of a Gold Immunochromatographic Assay Method Using Candida Biofilm Antigen as a Bioreceptor for Candidiasis in Rats
  173. Special Issue on Applied Biochemistry and Biotechnology 2019
  174. Adsorption of copper ions on Magnolia officinalis residues after solid-phase fermentation with Phanerochaete chrysosporium
  175. Erratum
  176. Erratum to: Sand Dune Characterization For Preparing Metallurgical Grade Silicon
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2026 De Gruyter Brill
Heruntergeladen am 16.1.2026 von https://www.degruyterbrill.com/document/doi/10.1515/chem-2019-0151/html
Button zum nach oben scrollen