Identification of Powdery Mildew Blumeria graminis f. sp. tritici Resistance Genes in Selected Wheat Varieties and Development of Multiplex PCR

Agnieszka Tomkowiak; Roksana Skowrońska; Dorota Weigt; Michał Kwiatek; Jerzy Nawracała; Przemysław Łukasz Kowalczewski; Mateusz Pluta

doi:10.1515/chem-2019-0024

Article Open Access

Identification of Powdery Mildew Blumeria graminis f. sp. tritici Resistance Genes in Selected Wheat Varieties and Development of Multiplex PCR

Agnieszka Tomkowiak , Roksana Skowrońska , Dorota Weigt , Michał Kwiatek , Jerzy Nawracała , Przemysław Łukasz Kowalczewski and Mateusz Pluta

Published/Copyright: March 22, 2019

Published by

Become an author with De Gruyter Brill

Submit Manuscript Author Information Explore this Subject

From the journal Open Chemistry Volume 17 Issue 1

Abstract

The aim of the study was to identify the Pm2, Pm3a, Pm4b and Pm6 genes and to develop multiplex PCR reaction conditions to reduce time and limit analysis costs. The following molecular markers were used for gene identification: Xcfd81, Whs350 and Xgwm205 (for Pm2), Pm3a (for Pm3a), STS_241 and Xgwm382 (for Pm4b), NAU/BCDSTS 135-2 (for Pm6). Plant material consisted of 7 popular European wheat varieties from the wheat collection at the Department of Genetics and Plant Breeding of the Poznań University of Life Sciences. The field experiment was established in 2017 and 2018 on 10 m² plots in a randomized complete block design in three replicates in the Dłoń Agricultural Experimental Farm of the Poznań University of Life Sciences (51°41’23.835”N 017°4’1.414”E). The analyses demonstrated that the accumulation of all identified Pm genes was found in the Assosan variety. The accumulation of the Pm2, Pm4b and Pm6 genes was found in Atomic, Bussard, Lear, Sparta, Tonacja and Ulka varieties. The work also involved developing multiplex PCR conditions for Xcfd81 and STS_241 and Xcfd81 and Xgwm382 primer pairs, allowing the simultaneous identification of the Pm2 and Pm4b genes.

Keywords: wheat; powdery mildew; SSR molecular markers; multiplex PCR

1 Introduction

In the last century, a growing proportion of the population living in cities with a simultaneous shrinking of crop area per person has been observed. For this reason, increasing the fertility of varieties is the main purpose of current plant breeding. Obtaining plants with beneficial economic features, including high yielding potential, is closely related to their resistance to biotic and abiotic stresses [1].

Wheat (Triticum aestivum L.) is cultivated on all continents and is the most important cereal in the Northern Hemisphere, but also in Australia and New Zealand [2]. The yield of winter wheat may be limited by many factors, including weed infestation, occurrence of pests, nutrient deficiencies, and pathogen infections [3, 4, 5]. In addition, stress factors, both abiotic and biotic, can also lead to lower yields and quality [6].

Powdery mildew of cereals and grasses caused by Blumeria graminis f. sp. tritici belongs to one of the most dangerous fungal diseases in cereal crops in the world, where it is the cause of large yield losses every year [7, 8, 9]. Currently, over 70 powdery mildew resistance alleles, located in 41 loci, and approx. 20 temporarily designated genes have been identified [10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20]. Research aimed at identifying new genes for powdery mildew resistance is ongoing. The powdery mildew (Pm) resistance genes have been introduced into strains by hybridization, homologous recombination or backcrossing [21] from ancestor or wild wheat species, e.g., Triticum monococcum, Triticum durum, Triticum uratu, Aegilops speltioides, Aegilops tauschii, Haynaldia villosa [22, 23]. Only 24 genes are derived from the Trtiticum aestivum gene pool [21].

Breeding resistant varieties provides the possibility of effective, cheap and safe eradication of harmful

organisms, at the same time reducing the amount of used plant protection products and preserving the quality and quantity of the yield. Selection using molecular MAS markers (marker assisted selection) allows the detection of specific genes or QTLs in plants at the early stages of their development in a relatively short time. Resistance to powdery mildew, which is conditioned by only one gene, is characterized by low efficiency and persistence, therefore, the pyramidization of Pm genes is sought [24, 25, 26]. The development of multiplex PCR will allow the simultaneous identification of two or three genes, which will reduce the time and cost of analysis.

The aim of the study was to identify the Pm2, Pm3a, Pm4b and Pm6 powdery mildew resistance genes in wheat varieties with different origins from the collection of the Department of Genetics and Plant Breeding of the Poznań University of Life Sciences and to develop multiplex PCR reaction conditions.

2 Materials And Methods

Plant material consisted of 7 Triticum aestivum ssp. vulgare L. varieties from the wheat collection at the Department of Genetics and Plant Breeding of the Poznań University of Life Sciences (Table 1). The varieties show good resistance to powdery mildew of cereals and grasses, according to information from the National Small Grain Collection at the Agriculture Research Station in Aberdeen, USA. The field experiment was established at the Experimental Station KGiHR housed in the Dłoń Agricultural Experimental Farm of the Poznań University of Life Sciences (51º 41’23.835”N 17º4’1.414”E) in 2017 and 2018. Genotypes were sown on 10 m² plots, in a randomized block system, in triplicate. The assessment of the degree of plant infestation by Blumeria graminis f. sp. tritici was carried out at the milk maturity stage (BBCH 71-77) on 40 flag and underflag leaves of randomly selected plants from each plot. The field assessment was carried out in accordance with the recommendations of the European and Mediterranean Plant Protection Organization (EPPO) according to a 9 degree scale (1° – 0.1% of infected area, 9° – 60% of infected area).

Table 1

The degree of resistance to Puccinia recondita f. sp. tritici infection under field conditions (Dłoń Agricultural Experimental Farm) and the identification of the Pm2, Pm3a, Pm4b and Pm6 genes by means of molecular markers.

Genotype	Field conditions		Molecular analysis
	2017	2018	Pm2 Xcfd81	Pm2 Whs350	Pm2 Xgwm205	Pm3a Pm3a	Pm4b STS_241	Pm4b Xgwm382	Pm6 NAU/STSBCD 135-2
Asosan	4	2	+	-	+	+	+	+	+
Atomic	4	3	+	-	+	-	+	+	+
Bussard	5	4	+	-	+	-	+	+	+
Lear	6	4	+	+	+	-	+	+	+
Sparta	5	3	+	+	+	-	+	+	+
Tonacja	5	4	+	-	+	-	+	+	+
Ulka	5	2	+	-	+	-	+	+	+

9° scale: 1°-0.1% of infected area, 9°-60% of infected area
“+” indicates the presence of a given DNA fragment characteristic of the marker locus
“–” indicates the absence of a given DNA fragment characteristic of the marker locus

The material for the tests was collected from 10-day-old seedlings, which were obtained from seeds germinated in laboratory conditions. DNA isolation was performed using the Genomic Mini AX PLANT plants DNA isolation kit (A&A Biotechnology, Poland) according to the included procedure. DNA concentration was determined using a DeNovix spectrophotometer. The samples were diluted with Tris buffer to obtain a uniform concentration of 50 ng/μL. PCR was carried out in a TProfesional Basic gradient thermocycler (Polygen, Poland).

The identification of powdery mildew resistance genes (Blumeria graminis f. sp. tritici) was carried out using the following molecular markers: Xcfd81 [27], Whs350 [28] and Xgwm205 [29] for Pm2, Pm3a [30] for Pm3a, STS_241 [31] and Xgwm382 [31] for Pm4b and NAU/STS BCD 135-2 for Pm6 [32]. The primer sequences are derived from the Grain Genes database [33] and are presented in Table 2 with their annealing temperature and the size of the amplified products. The 12.75 μL reaction volume consisted of: water – 5 μL, DreamTaq™ Green PCR Master Mix – 6.25 μL, primers – 2 × 0.25 μL (final concentration was 20 μM), DNA template – 1 μL. PCR after optimizing was carried out under the same conditions regardless of the marker being identified. The profile differed only in the primer annealing temperature, determined based on their melting point: initial denaturation for 5 minutes at 94°C, 40 cycles (denaturation – 45 sec at 94°C, primer annealing – 1 min at 51°C, 52°C, 56°C, 57°C, elongation – 1 min at 72°C), final extension – 5 min at 72°C, storage – 4°C max. for 24 hours.

Table 2

Primer sequences and their annealing temperature in the identification of the Lr11, Lr13, Lr16, Lr26 genes.

Gene – Marker	Primer sequence	Annealing temperature	Product amplified
Pm2 – Xcfd81	F: 5’TATCCCCAATCCCCTCTT3’ R: 5’GTCAATTGTGGCTTGTCCCT3’	57°C	283 bp
Pm2 – Whs350	F: 5’AGCTGTTTGGGTACAAGGTG3’ R: 5’TCCCCTGTGCTACTACTTCTC3’	56°C	598 bp
Pm2 – Xgwm205	F: 5’CGACCCGGTTCACTTCAG3’ R: 5’AGTCGCCGTTGTATAGTGCC3’	56°C	143 bp
Pm3a – Pm3a	F:5’GGAGTCTCTTCGCATAGA3’	51°C	642 bp
	R: 5’CAGCTTCTAAGATCAAGGAT3’
Pm4b – STS_241	F:5’CTCATTCTTGTTTTACTTCCTTCAGT3’	56°C	241 bp
	R:5’GTCTCGTCTTCAGCATCCTATACA3’
Pm4b – Xgwm382	F:5’ GTCAGATAACGCCGTCCAAT3’	52°C	125 bp
	R:5’ CTACGTGCACCACCATTTTG3’
Pm6 – NAU/	F:5’GCTCCGAAGCAAGAGAAGAA3’	57°C	230 bp
STSBCD 135-2	R:5’TCTGCTGGTCCTCTGATGTG3’

Simultaneous identification of the Pm2 and Pm4b genes was carried out using Xcfd81 (Pm2) and STS_241 (Pm4b) and Xcfd81 (Pm2) i Xgwm382 (Pm4b) marker pairs. Primer sequences are shown in Table 2. The multiplex PCR reaction for Xcfd81 and STS_241 marker identification was carried out in a volume of 25 μL and the mixture composition was as follows: water – 10 μL, PCR Mix Plus (A&A Biotechnology, Poland) – 12.5 μL, Xcfd81 primer – 2 × 0.25 μL, STS_241 primer – 2 × 0.25 μL, DNA template – 1.5 μL. The reaction was based on the thermal profile specific for the identification of the Pm2 gene – primer annealing temperature was 57°C. In order to simultaneously identify the Xcfd81 and Xgwm382 markers, the multiplex PCR reaction was carried out in a volume of 25 μL. Mixture composition: water – 10 μL, PCR Mix Plus (A&A Biotechnology, Poland) – 12.5 μL, Xcfd81 primer – 2 × 0.25 μL, Xgwm382 primer – 2 × 0.25 μL, DNA template – 1.5 μL. Primer annealing temperature was 52°C.

To visualize the results, PCR products were separated in a 2.5% agarose gel containing 0.01% μL ethidium bromide in TBE 1x buffer. The voltage was 100 V and the current was 200 mA. The duration of electrophoresis was 1 h. A Molecular Imager Gel Doc™ XR UV transilluminator was used with the Biorad Bio Image™ Software to visualize the PCR products.

3 Results

3.1 Field assessment

Assosan and Ulka were the most resistant varieties in field conditions in 2018. The degree of infection of these varieties by Blumeria graminis f. dp. tritici was only 2°. However, these varieties showed less resistance in 2017, which might be caused by very intensive precipitation during the growing season, which promoted pathogen development. The least resistant in field conditions were the varieties: Lear (5° – 2017 and 6° – 2018), Bussard (4° – 2017 and 5° – 2018) and Tonacja (4° – 2017 and 5° – 2018). The Atomic (4° – 2017 and 3° – 2018) and Sparta (5° – 2017 and 3° – 2018) varieties were characterized by moderate resistance in both 2017 and 2018 (Table 1).

3.2 Pm2 gene identification

The analyses with the Xcfd81 marker linked to the Pm2 gene resulted in the identification of a 283-bp specific product in all tested varieties. The occurrence of non-specific products was also observed. The result was reproducible (Table 1., Figure 1). The Whs350 marker was the second one tested for the Pm2 gene. A specific product with a length of 598 bp was identified only in two tested varieties: Lear and Sparta. The marker was not present in the Assosan, Atomic, Bussard, Tonacja and Ulka varieties (Table 1). Xgwm205 was the following marker linked to Pm2. A specific product of 143 bp was identified in all tested varieties. Moreover, the occurrence of non-specific products was also observed. The result was reproducible (Table 1)

Figure 1

Electropherogram showing the presence of the Xcfd81 marker of the Pm2 gene in wheat varieties.

3.3 Pm3a gene identification

The analyses using the Pm3a marker demonstrated a specific amplification product of 642 bp only in the Assosan variety. The marker did not appear in the Atomic, Bussard, Lear, Sparta, Tonacja and Ulka varieties. The result was reproducible (Table 1).

3.4 Pm4b gene identification

The experiments concerning the identification of the Pm4b gene using the STS_241 marker, which gave a specific product of 241 bp, identified the marker in three varieties: Assosan, Atomic and Sparta. No distinct product was obtained in the Bussard, Lear, Tonacja and Ulka varieties (Table 1., Figure 2). Xgwm382 was another marker tested for the Pm4b gene. A specific product of 125 bp was identified in all tested varieties. The result was reproducible (Table 1., Figure 3).

Figure 2

Electropherogram showing the presence of the STS_241 marker of the Pm4b gene in wheat varieties.

Figure 3

Electrophorogram showing the presence of the Xgwm382 marker of the Pm4b gene in wheat varieties.

3.5 Pm6 gene identification

NAU/STSBCD 135-2 coupled to the Pm6 gene was the last tested marker. The presence of a specific product of 230 bp was identified in all tested varieties. The result was reproducible (Table 1).

3.6 Multiplex PCR DNA amplification for the Pm2 and Pm4b genes

After PCR with Xcfd81 and STS_241 primer pairs, 283-bp and 241-bp products were obtained, indicating the presence of the Pm2 and Pm4b genes, respectively. Two strong products were obtained in Atomic, Bussard, Lear and Sparta varieties. In the case of the Assosan, Tonacja and Ulka varieties, only a product of 241 bp was observed, indicating the presence of the Pm4b gene (Figure 4).

Figure 4

Electrophorogram showing the presence of the following markers: Xcfd81 of the Pm2 gene and STS_241 of the Pm4b gene in wheat varieties.

After PCR reactions with Xcfd81 and Xgwm382 primer pairs, 283-bp and 125-bp products were obtained, indicating the presence of the Pm2 and Pm4b genes, respectively. Two strong products were obtained in the Assosan, Bussard, Lear and Sparta varieties. As regards the Assosan, Tonacja and Ulka varieties, only a product of 283 bp was observed, indicating the presence of the Pm2 gene. No specific products were observed in the Ulka variety. The occurrence of non-specific products was also observed (Figure 5).

Figure 5

Electrophorogram showing the presence of the following markers: Xcfd81 of the Pm2 gene and STS_241 of the Pm4b gene in wheat varieties.

4 Discussion

The Xcfd81, Whs350 and Xgwm205 markers were analyzed for their usefulness in the identification of the Pm2 gene conferring resistance to powdery mildew – Blumeria graminis f. sp. tritici. The analyses demonstrated that the most effective markers were: Xcfd81, which gave a 283-bp product and Xgwm205 with a 143-bp amplification product, which confirmed the presence of the Pm2 gene in all 7 analyzed Triticum aestivum ssp. vulgare varieties. The Whs350 marker turned out to be the least suitable. Its 598-bp amplification product occurred only in 2 out of 7 analyzed varieties. All three tested markers were identified in the Lear and Sparta varieties.

Ma et al. [34, 35, 36] also demonstrated the efficacy of the Xcfd81 and Xgwm205 markers in the identification of the Pm2 gene. Moreover, Gao et al. [37] showed that these markers were also linked to the Pm46 gene, which was previously considered to be an allelic form of the Pm2 gene. They showed that the Tabasco variety had the Pm46 gene, and not Pm2 as previously thought.

Tomkowiak et al. [38] also evaluated the usefulness of the Xgwm205, Xcfd81 and Whs350 molecular markers to identify the Pm2 resistance gene against powdery mildew of cereals and grasses in 27 wheat varieties. As a result of SSR analyses, the Xgwm205 marker was considered the most effective in Pm2 gene identification; its product appeared in 25 out of 27 analyzed varieties. The Xcfd81

marker was found in 21 varieties and Whs350 marker product in only 9 varieties. All three tested markers linked to the gene were successfully identified in the Atomic, Bussard, Sparta, Lear Tonacja and Ulka varieties.

Huang and Roder [11] conducted research on 32 genotypes of wheat for the presence of different Pm genes and confirmed the presence of the Pm2 gene in the genotype of the Ulka variety.

The Pm3a gene marker was analyzed as the next one. The analyses showed the presence of a 642-bp product only in the Assosan variety. Huang and Roder [11] and Tommasini et al. [30] also identified the Pm3a gene in the Assosan variety. The latter variety may be a good source of powdery mildew resistance, because, the analyses showed that it contained all the analyzed genes, i.e., Pm2, Pm3, Pm4b and Pm6. According to literature data, Kredo might be an equally useful variety, in which Huang and Roder [11] identified the Pm3a gene, and Tomkowiak et al. [39] showed the presence of the Pm2, Pm4b and Pm6 genes.

Subsequently, the usefulness of the STS_241 and Xgwm382 markers for the identification of the Pm4b gene was tested. The Xgwm382 marker turned out to be significantly more effective, as its product of 125 bp was identified in all the analyzed varieties. The STS_241 marker was characterized by a lower suitability. A 241-bp marker product appeared only in 3 out of 7 tested varieties: Assosan, Atomic and Sparta. Tomkowiak et al. [39] also analyzed, among others, Assosan and Atomic varieties for the presence of the Pm4b gene using the STS_241 marker and did not show the presence of the gene in these varieties. Yi et al. [31], Hao et al. [20] and Tomkowiak et al. [39] considered the non-analyzed VPM line as a reliable source of the Pm4b gene.

The STS NAU/STS BCD 135-2 marker, specific for the Pm6 gene, was tested as the last one. The analyses showed the presence of a 230-bp product in all varieties. Literature data provide different lengths of the product, which indicate the presence of the NAU/STS BCD 135-2 marker. Ji et al. [32] studied four markers specific for the Pm6 gene: NAU/STS BCD 135-1, NAU/STS BCD 135-2, STS003 and STS004. The authors showed that both NAU/STS BCD 135-1 and NAU/STS BCD 135-2 markers were strongly linked to the Pm6 gene, however, the NAU/STS BCD 135-2 marker turned out to be more effective. According to the methodology included in these authors’ study, a product of 230 bp would indicate the presence of the marker. Kowalczyk et al. [24] confirmed the obtained results by using the marker to detect the Pm6 gene in triticale varieties. Kęska et al. [40] identified the Pm6 gene in new wheat breeding lines using the NAU/STS BCD 135-2 marker and applying primers designed by Ji et al. [32]. The authors identified the Pm6 gene in 8 genotypes obtained from breeding lines as a result of conducted analyses. However, the results are doubtful, because the authors indicated that the presence of the Pm6 gene was indicated by a product of 135 bp, which is contrary to the source methodology. Similar studies were also conducted by Tomkowiak et al. [39], who identified a product of 230 bp in all analyzed varieties and lines.

All Pm genes were found in the Assosan variety. The accumulation of the Pm2, Pm4b and Pm6 genes was demonstrated in the Atomic, Bussard, Lear, Sparta, Tonacja and Ulka varieties. These varieties can be an effective source of genes in breeding programs and may serve as reference materials.

The effectiveness of breeding programs can be increased by the accumulation of different combinations of genes conditioning resistance not only to powdery mildew, but also to other agricultural diseases that are dangerous from the agricultural point of view. Pyramidization of genes is a commonly used method in breeding varieties throughout the world and allows minimizing the use of plant protection products that are not neutral to the environment as well as human and animal health.

The use of the multiplex PCR technique may be one of the methods allowing for acceleration of breeding processes. It is a technique based on the use of molecular markers, consisting of the simultaneous use of several primer pairs in the reaction mixture. This allows the identification of several genes simultaneously. The markers used should be selected to allow their amplification at the same primer annealing temperature to the DNA template. The method allows the reduction of research financial expenditures, but also saves time and work effort [41,42].

The literature provides many examples of attempts at simultaneous identification of multiple resistance genes. Leśniowska et al. [43] made a successful attempt to develop multiplex PCR conditions for the Lr9 and Lr19 resistance genes against leaf rust. Gogół et al. [44] identified the resistance genes to leaf rust – Lr21 and powdery mildew – Pm4b in Polish wheat varieties and developed multiplex PCR conditions for simultaneous identification of these genes. The subject of their research was 30 Polish wheat varieties. Sumikova and Hanzalova [45] developed and optimized multiplex PCR conditions for the Lr29 and Lr37 resistance genes to leaf rust. De Froidmont [46] attempted simultaneous identification of the 1BL/1RS wheat-rye translocation carrying the Yr9 resistance gene to yellow rust, Sr31 resistance gene to stem rust, Lr26 resistance gene to leaf rust and Pm8 conferring resistance to powdery mildew. Fraaije et al. [47] used the multiplex PCR method to simultaneously identify resistance genes to four wheat pathogens: Septoria tritici, Stagonospora nodorum, Puccinia Striiformis and Puccinia recondita. It has been shown that this method can be used to identify the presence of genes for fungal diseases in wheat.

The work also attempted to develop multiplex PCR conditions. Many combinations were tried within the identified markers; however, positive results were obtained only for the Pm2 and Pm4b genes. Other combinations, e.g, Xcfd81 with Pm3a, or Whs350 with NAU/STS BCD 135-2 may have failed, among others, due to the large differences in amplicon lengths, which made it difficult to separate them on a single electrophoretic gel.

Two distinct products with sizes of 238 bp and 241 bp were obtained in 4 out of 7 tested variants as a result of simultaneous DNA amplification by the multiplex PCR method for the pair of Xcfd81 and STS_241 markers. In addition, only one product was identified in the Assosan, Tonacja and Ulka varieties, indicating the presence of the Pm4b gene

Xcfd81 and Xgwm382 were the second pair of identified markers. Both markers were characterized by high suitability for the identification of the Pm2 and Pm4b genes, respectively. The products of both markers were obtained in 4 out of 7 analyzed variants as a result of the multiplex PCR reaction. A 283-bp product, indicating the presence of the Pm2 gene was also identified in the Atomic and Tonacja varieties.

5 Conclusions

Assosan and Ulka were the most resistant varieties in the field assessment in 2018. All four analyzed genes for powdery mildew of cereals and grasses were identified in the Assosan variety, while the Pm2, Pm4b and Pm6 genes were identified in the Ulka variety. The Lear, Bussard and Tonacja varieties were characterized by the lowest resistance in the field assessment in 2017 and 2018. Molecular assessment, however, showed that they contained three pathogen resistance genes. The Atomic and Sparta varieties were characterized by medium resistance in the field evaluation, and molecular analyses revealed the presence of three resistance genes. The Assosan and Ulka varieties can be a good source of resistance to powdery mildew. In addition, the developed multiplex PCR conditions for simultaneous amplification of the Pm2 and Pm4b genes can be used in breeding programs to shorten the time of molecular analysis.

Ethical approval: The conducted research is not related to either human or animal use.
Funding: The authors received no financial support for the research, authorship, and/or publication of this article.
Conflicts of Interest: On behalf of all authors, the corresponding author states that there is no conflict of interest.

References

[1] Święcicki W.K., Surma M., Koziara W., Skrzypczak G., Szukała J., Bartkowiak-Broda I., et al., Modern technologies in crop production – friendly for man and environment, Pol J Agro., 2011, 7, 102-112.Search in Google Scholar

[2] Oerke E.C., Crop losses to pests, J Agr Sci., 2006, 144(1), 31-43. 10.1017/S0021859605005708Search in Google Scholar

[3] Jastrzębska M., Saeid A., Kostrzewska M.K., Baśladyńska S., New phosphorus biofertilizers from renewable raw materials in the aspect of cadmium and lead contents in soil and plants, Open Chem., 2018, 16(1), 35-49. 10.1515/chem-2018-0004Search in Google Scholar

[4] Jelínková Z., Moudrý jr. J., Bernas J., Kopecký M., Moudrý J., Konvalina P., Environmental and economic aspects of Triticum aestivum L. and Avena sativa growing, Open Life Sci., 2016, 11(1), 533-541. 10.1515/biol-2016-0069Search in Google Scholar

[5] Kuś J., Jończyk K., Kawalec A., Factors limiting the yields of winter wheat in different crop production systems, Acta Agrophys., 2007, 10(2), 407-417.Search in Google Scholar

[6] Witkowska-Banaszak E., Radzikowska D., Ratajczak K., Chemical profile and antioxidant activity of Trollius europaeus under the influence of feeding aphids, Open Life Sci., 2018, 13(1), 312-318. 10.1515/biol-2018-0038Search in Google Scholar PubMed PubMed Central

[7] Klocke B., Flath K., Miedaner T., Virulence phenotypes in powdery mildew (Blumeria graminis) populations and resistance genes in triticale (x Triticosecale), Eur J Plant Pathol., 2013, 137(3), 463-476. 10.1007/s10658-013-0257-9Search in Google Scholar

[8] Walker A.S., Bouguennec A., Confais J., Morgant G., Leroux P., Evidence of host‐range expansion from new powdery mildew (Blumeria graminis) infections of triticale (× Triticosecale) in France, Plant Pathol., 2011, 60(2), 207-220.10.1111/j.1365-3059.2010.02379.xSearch in Google Scholar

[9] Parks R., Carbone I., Murphy J.P., Marshall D., Cowger C., Virulence structure of the eastern US wheat powdery mildew population, Plant Dis., 2008, 92(7), 1074-1082.10.1094/PDIS-92-7-1074Search in Google Scholar PubMed

[10] Ma H., Kong Z., Fu B., Li N., Zhang L., Jia H., et al., Identification and mapping of a new powdery mildew resistance gene on chromosome 6D of common wheat, Theor Appl Genet., 2011, 123(7), 1099. 10.1007/s00122-011-1651-3Search in Google Scholar PubMed

[11] Huang X.Q., Röder M.S., Molecular mapping of powdery mildew resistance genes in wheat: a review, Euphytica, 2004, 137(2), 203-223. 10/cfnt59Search in Google Scholar

[12] Miranda L.M., Murphy J.P., Marshall D., Cowger C., Leath S., Chromosomal location of Pm35, a novel Aegilops tauschii derived powdery mildew resistance gene introgressed into common wheat (Triticum aestivum L.), Theor Appl Genet., 2007, 114(8), 1451-1456.10.1007/s00122-007-0530-4Search in Google Scholar PubMed

[13] Blanco A., Gadaleta A., Cenci A., Carluccio A.V., Abdelbacki A.M.M., Simeone R., Molecular mapping of the novel powdery mildew resistance gene Pm36 introgressed from Triticum turgidum var. dicoccoides in durum wheat, Theor Appl Genet., 2008, 117(1), 135. 10.1007/s00122-008-0760-0Search in Google Scholar PubMed

[14] Perugini L.D., Murphy J.P., Marshall D., Brown-Guedira G., Pm37, a new broadly effective powdery mildew resistance gene from Triticum timopheevii, Theor Appl Genet., 2008, 116(3), 417-425.10.1007/s00122-007-0679-xSearch in Google Scholar PubMed

[15] Luo P.G., Luo H.Y., Chang Z.J., Zhang H.Y., Zhang M., Ren Z.L., Characterization and chromosomal location of Pm40 in common wheat: a new gene for resistance to powdery mildew derived from Elytrigia intermedium, Theor Appl Genet., 2009, 118(6), 1059-1064. 10.1007/s00122-009-0962-0Search in Google Scholar PubMed

[16] Li G., Fang T., Zhang H., Xie C., Li H., Yang T., et al., Molecular identification of a new powdery mildew resistance gene Pm41 on chromosome 3BL derived from wild emmer (Triticum turgidum var. dicoccoides), Theor Appl Genet., 2009, 119(3), 531-539. 10.1007/s00122-009-1061-ySearch in Google Scholar PubMed

[17] Hua W., Liu Z., Zhu J., Xie C., Yang T., Zhou Y., et al., Identification and genetic mapping of Pm42, a new recessive wheat powdery mildew resistance gene derived from wild emmer (Triticum turgidum var. dicoccoides), Theor Appl Genet., 2009, 119, 223-230. 10.1007/s00122-009-1031-4Search in Google Scholar PubMed

[18] He R., Chang Z., Yang Z., Yuan Z., Zhan H., Zhang X., et al., Inheritance and mapping of powdery mildew resistance gene Pm43 introgressed from Thinopyrum intermedium into wheat, Theor Appl Genet., 2009, 118, 1173-1180. 10.1007/s00122-009-0971-zSearch in Google Scholar PubMed

[19] Mcintosh R.A., Yamazaki Y., Dubcovsky J., Rogers W.J., Morris C., Appels R., Catalogue of gene symbols for wheat, Proceedings of the 12th International Wheat Genetics Symposium, Yokohama, Japan, 2013.Search in Google Scholar

[20] Hao Y., Parks R., Cowger C., Chen Z., Wang Y., Bland D., et al., Molecular characterization of a new powdery mildew resistance gene Pm54 in soft red winter wheat, Theor Appl Genet., 2015, 128(3), 465-476. 10.1007/s00122-014-2445-1Search in Google Scholar PubMed

[21] Hsam S.L.K., Zeller F.J., Breeding for powdery mildew resistance in common wheat (Triticum aestivum L.). The powdery mildews, a comprehensive treatise, APS Press., 2002, 219-238.Search in Google Scholar

[22] Zhu Z., Zhou R., Kong X., Dong Y., Jia J., Microsatellite markers linked to 2 powdery mildew resistance genes introgressed from Triticum carthlicum accession PS5 into common wheat, Genome., 2005, 48(4), 585-590.10.1139/g05-016Search in Google Scholar PubMed

[23] Jiang J., Friebe B., Gill B.S., Chromosome painting of Amigo wheat, Theor Appl Genet., 1994, 89(7-8), 811-813.10.1007/BF00224501Search in Google Scholar PubMed

[24] Kowalczyk K., Gruszecka D., Nowak M., Leśniowska-Nowak J., Resistance of triticale hybrids with Pm4b and Pm6 genes to powdery mildew, Acta Biol Cracov Ser Bot., 2011, 53(1), 57-62. 10.2478/v10182-011-0008-1Search in Google Scholar

[25] Czembor H.J., Czembor J.H., Pietrusińska A., Domeradzka O., Resistance to powdery mildew (Blumeria graminis f.sp. hordei) in barley cultivars included to registration trials in Poland in 2012, Bulletin of Plant Breeding and Acclimatization Institute, 2013, 268, 35-45.Search in Google Scholar

[26] Pietrusińska A., Czembor J.H., Czembor J.H., Lr39+ Pm21: a new effective combination of resistance genes for leaf rust and powdery mildew in wheat, Czech J Genet Plant., 2013, 9(3), 109-115.10.17221/150/2012-CJGPBSearch in Google Scholar

[27] Qiu Y., Sun X., Zhou R., Kong X., Zhang S., Jia J., Identification of microsatellite markers linked to powdery mildew resistance gene Pm2 in wheat, Cereal Res Commun., 2006, 34(4), 1267-1273.10.1556/CRC.34.2006.4.268Search in Google Scholar

[28] Mohler V., Jahoor A., Allele-specific amplification of polymorphic sites for the detection of powdery mildew resistance loci in cereals, Theor Appl Genet., 1996, 93(7), 1078-1082.10.1007/BF00230128Search in Google Scholar PubMed

[29] Röder M.S., Korzun V., Wendehake K., Plaschke J., Tixier M.H., Leroy P., et al., A microsatellite map of wheat, Genetics, 1998, 149(4), 2007-2023.10.1093/genetics/149.4.2007Search in Google Scholar PubMed PubMed Central

[30] Tommasini L., Yahiaoui N., Srichumpa P., Keller B., Development of functional markers specific for seven Pm3 resistance alleles and their validation in the bread wheat gene pool, Theor Appl Genet., 2006, 114(1), 165-175.10.1007/s00122-006-0420-1Search in Google Scholar PubMed

[31] Yi Y.J., Liu H.Y., Huang X.Q., An L.Z., Wang F., Wang X.L., Development of molecular markers linked to the wheat powdery mildew resistance gene Pm4b and marker validation for molecular breeding, Plant Breed., 2008, 127(2), 116-120.10.1111/j.1439-0523.2007.01443.xSearch in Google Scholar

[32] Ji J., Qin B., Wang H., Cao A., Wang S., Chen P., et al., STS markers for powdery mildew resistance gene Pm6 in wheat, Euphytica, 2008, 163(2), 159-165. 10/c7q8s8Search in Google Scholar

[33] GrainGenes a database for Triticeae and Avena. https://wheat.pw.usda.gov [visited: 11/24/2018]Search in Google Scholar

[34] Ma P.T., Xu H.X., Xu Y.F., Li L.H., Qie Y.M., Luo Q.L., Molecular mapping of the new powdery mildew resistance gene Pm2b in Chinese breeding line KM2939, Theor Appl Genet., 2015, 128, 613-622. 10.1007/s00122-015-2457-5Search in Google Scholar PubMed

[35] Ma P.T., Xu H.X., Zhang H.X., Li L..H, Xu Y.F., Zhang X.T., The gene PmWFJ is a new member of complex Pm2 locus conferring unique powdery mildew resistance in wheat breeding line Wanfengjian 34, Mol Breed., 2015, 35, 210. 10.1007/s11032-015-0403-5Search in Google Scholar

[36] Ma P.T., Zhang H.X., Xu H.X., Xu Y.F., Cao Y.W., Zhang X.T., et al., The gene PmYB conferes broad-spectrum powdery mildew resistance in the multi-allelic Pm2 chromosome region of the Chinese wheat cultivar YingBo700, Mol Breed., 2015, 35, 124. 10.1007/s11032-015-0320-7Search in Google Scholar

[37] Gao H.L., Zhu F., Jiang Y., Wu J., Yan W., Zhang Q., et al., Genetic analysis and molecular mapping of a new powdery mildew resistant gene Pm46 in common wheat, Theor Appl Genet., 2012, 125(5), 967-973. 10.1007/s00122-012-1886-7Search in Google Scholar PubMed

[38] Tomkowiak A., Kurasiak-Popowska D., Grynia J., Nawracała J., Mikołajczyk S., Weigt D., et al., Evaluation of the usefulness of molecular markers Xgwm205, Xcfd81, Whs350 for the identification of resistance gene Pm2 to powdery mildew (Blumeria graminis f. sp. tritici) in wheat cultivars of different origins, Progress in Plant Protection, 2017, 57(2), 146-152. 10.14199/ppp-2017-023Search in Google Scholar

[39] Tomkowiak A., Grynia J., Kurasiak-Popowska D., Weigt D., Mikołajczyk S., Niemann J, et al., Identification of Pm2, Pm3a, Pm4b and Pm6 genes in selected wheat varieties and line, Zeszyty Problemowe Postępów Nauk Rolniczych, 2017, 591, 43-51. 10.22630/ZPPNR.2017.591.42Search in Google Scholar

[40] Kęska P., Okoń S., Stadnik J., Characterization of genetic diversity and identification of Pm6 genes in new breeding lines of common wheat with DNA markers, Ann UMCS Sect E., 2015, LXX(4), 35-43.10.24326/as.2015.4.4Search in Google Scholar

[41] Elnifro E.M., Ashshi A.M., Cooper R.J., Klapper P.E., Multiplex PCR: optimization and application in diagnostic virology, Clin Microbiol Rev., 2000, 13(4), 559-570.10.1128/CMR.13.4.559Search in Google Scholar PubMed PubMed Central

[42] Hayden M.J., Nguyen T.M., Waterman A., Chalmers K.J., Multiplex-ready PCR: a new method for multiplexed SSR and SNP genotyping, BMC Genomics, 2008, 9, 80. 10.1186/1471-2164-9-80Search in Google Scholar PubMed PubMed Central

[43] Leśniowska-Nowak J., Gradzielewska A., Majek M., Identification of the gene resistant to leaf rust in selected European wheat cultivars and Multiplex PCR development, Ann UMCS Sect E., 2013, 68(3), 20-28.10.24326/as.2013.3.3Search in Google Scholar

[44] Gogół A., Leśniowska-Nowak J., Nowak M., Okoń S., Kowalczyk K. Development of multiplex PCR for Lr21 and Pm4b resistance genes detection in common wheat (Triticum aestivum L.), Annales Umcs Sectio E, 2015, LXX(3), 21-30.10.24326/as.2015.3.3Search in Google Scholar

[45] Sumikova T., Hanzalova A., Multiplex PCR assay to detect rust resistance genes Lr26 and Lr37 in wheat, Czech J Genet Plant., 2010, 46(2), 85-89.10.17221/32/2010-CJGPBSearch in Google Scholar

[46] De Froidmont D., A co-dominant marker for the 1BL/1RS wheat-rye translocation via multiplex PCR, J Cereal Sci., 1998, 27(3), 229-232.10.1006/jcrs.1998.0194Search in Google Scholar

[47] Fraaije B.A., Lovell D.J., Coelho J.M., Baldwin S., Hollomon D.W., PCR-based assays to assess wheat varietal resistance to blotch (Septoria tritici and Stagonospora nodorum) and rust (Puccinia striiformis and Puccinia recondita) diseases, Eur J Plant Pathol., 2001, 107(9), 905-917.10.1023/A:1013119206261Search in Google Scholar

Received: 2018-11-26

Accepted: 2019-01-29

Published Online: 2019-03-22

This work is licensed under the Creative Commons Attribution 4.0 Public License.

Articles in the same Issue

https://doi.org/10.1515/chem-2019-0024

Keywords for this article

wheat; powdery mildew; SSR molecular markers; multiplex PCR

Creative Commons

BY 4.0