Startseite Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy
Artikel Open Access

Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy

  • Shao-kang Wang , Xiao-ting Zhang , Xuan-yao Jiang , Bi-jiang Geng , Tao-lin Qing , Lei Li , Yun Chen , Jin-feng Li , Xiao-fang Zhang , Shuo-gui Xu , Jiang-bo Zhu , Yu-ping Zhu EMAIL logo , Mei-tang Wang EMAIL logo und Ji-kuai Chen EMAIL logo
Veröffentlicht/Copyright: 4. März 2024
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 19 Heft 1

Abstract

Photothermal therapy (PTT) of nanomaterials is an emerging novel therapeutic strategy for breast cancer. However, there exists an urgent need for appropriate strategies to enhance the antitumor efficacy of PTT and minimize damage to surrounding normal tissues. Piezo1 might be a promising novel photothermal therapeutic target for breast cancer. This study aims to explore the potential role of Piezo1 activation in the hyperthermia therapy of breast cancer cells and investigate the underlying mechanisms. Results showed that the specific agonist of Piezo1 ion channel (Yoda1) aggravated the cell death of breast cancer cells triggered by heat stress in vitro. Reactive oxygen species (ROS) production was significantly increased following heat stress, and Yoda1 exacerbated the rise in ROS release. GSK2795039, an inhibitor of NADPH oxidase 2 (NOX2), reversed the Yoda1-mediated aggravation of cellular injury and ROS generation after heat stress. The in vivo experiments demonstrate the well photothermal conversion efficiency of TiCN under the 1,064 nm laser irradiation, and Yoda1 increases the sensitivity of breast tumors to PTT in the presence of TiCN. Our study reveals that Piezo1 activation might serve as a photothermal sensitizer for PTT, which may develop as a promising therapeutic strategy for breast cancer.

Keywords: photothermal therapy; heat stress; Piezo1; breast cancer

1 Introduction

Breast cancer has become the most threatening cancer. It now ranks first in incidence with an estimated 2.3 million new cases, representing 11.7% of all cancer cases [1]. According to cancer statistics, people who die from breast cancer may mount to 43,780 in the United States in 2022 [2]. Currently, locoregional treatment and systemic therapy remain the mainstay of treatment. However, due to the existence of heterogeneity, many patients are unable to achieve satisfactory outcomes. Current research emphasis is shifting to more biologically directed therapies and reducing the adverse effects of treatment.

Hyperthermia therapy is a new type of adjuvant means of cancer therapy. With the utilization of exogenous heat induction, hyperthermia therapy has considerable potential to augment cancer therapy with minimal toxicity, including inhibiting DNA repair processes, influencing the blood flow of tumors, and causing direct cytotoxicity to cells that are acid and nutrient-deprived [3,4,5]. Photothermal therapy (PTT) is an emerging controllable antitumor technique. It utilizes photothermal convertible agents to generate hyperthermia targeting the site of tumor and ultimately realize the tumor ablation [6,7]. In our previous study, complete breast tumor ablation without recurrence was achieved in mice with the utilization of the photothermal material NIR-II-CDs or their hybrid liposomal formulation [8]. However, due to the limited tissue penetration of light, it may be unrealistic to cure tumors located deeply in the body or tumor with a large volume. Besides, high-temperature induced ablation of tumor under strong laser carries an underlying risk for heating damage of normal cells nearby the tumor. Therefore, PTT is usually the first choice under mild conditions of tumor, in case the possible spread of tumor caused by insufficient heating [9,10], and it is imperative to develop more adjuvant therapies sensitizing PTT [11].

Piezo1, a mechanosensitive ion channel, is widely expressed in various tissues in the human body, especially those exposed to mechanical stimuli, such as the colon, vascular endothelium, lung, and breast [12,13,14]. As a non-selective Ca2+-permeable cation channel, it is known to sense various mechanical stresses, including static pressure, shear stress, and membrane stretch [15,16]. Furthermore, increasing evidence revealed that Piezo1 also has important roles in inflammatory and immune regulations [17,18]. Many studies have reported that Piezo1 is associated with many signaling pathways involved in cancer metastasis, such as angiogenesis, cell migration, and proliferation [19,20,21,22]. In breast cancer, high expression of Piezo1 in the primary breast tumor was reported to associate with increased hazard ratio and corresponding shorter overall survival time [23]. Some researchers suggested that Piezo1 is involved in the process of matrix degradation and enhancing the invasive phenotype [24,25,26]. All these have suggested that Piezo1 may be a promising novel therapeutic target for breast cancer. However, no study was conducted to explore the potential role of Piezo1 in heat stress-induced cellular injury. Therefore, further research is necessary to determine whether Piezo1 could be a potential photothermal sensitizer target in hyperthermia therapy.

In this study, we investigated the underlying role of Piezo1 activation in the effects of hyperthermia therapy on breast cancer cells and explored the underlying mechanisms. Our study revealed that Piezo1 activation aggravated the injury of breast cancer cells under the setting of hyperthermia therapy. Mechanistically, the activation of the Piezo1 ion channel significantly increased the expression of NOX2 and reactive oxygen species (ROS), we supposed that Piezo1 is involved in heat stress via the NOX2/ROS signaling pathway. Additionally, the photothermal nanomaterial called TiCN was used as a PTT strategy. The Piezo1-specific agonist Yoda1 enhanced the effect of TiCN on breast tumor ablation under a 1,064 nm laser. Taken together, these results suggest that Piezo1 regionally activation is a potential therapeutic strategy to improve breast cancer.

2 Materials and methods

2.1 Mice

Female Balb/c nude mice with the age of 3–5 weeks were purchased from Sippr B&K Laboratory Animal Ltd (Shanghai, China). All mice were housed in a room with proper conditions (20–24°C, 40–60% humidity) and a 12 h light/dark cycle. Mice had access to food and water freely. All experimental procedures were approved by the Institutional Animal Ethics Committee of the Navy Medical University according to the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.

2.2 Tumor models

Two million 4T1 cell suspended in PBS (0.1 mL) was subcutaneously injected into the axillary of nude mice to establish a tumor model.

2.3 Characterization of TiCN

Transmission electron microscopy (TEM) images of the sample were recorded on a JEM-2100F microscope operated at 200 kV acceleration voltage using super thin carbon films. X-ray diffraction (XRD) patterns were obtained with a Rigaku 18 KW D/max-2550 using Cu Kα radiation. X-ray photoelectron spectroscopy (XPS) measurements were performed using a Kratos Axis Ultra DLD X-ray photoelectron spectrometer. The zeta potential and size of the sample were recorded by a Malvern Zetasizer Nano ZS90 Zeta potential analyzer. UV-vis-NIR absorption spectrum was obtained by Agilent Cary 5000 spectrophotometers. TiCN was purchased by XFNANO Materials Tech Co., Ltd (Jiangsu, China).

2.4 Cell culture

The MDA-MB-231 cells, 4T1 cells, and human umbilical vein endothelial cells (HUVECs) were obtained from the Chinese Academy of Sciences (Shanghai, China). The MDA-MB-231 cells and HUVECs were cultured in DMEM high-glucose medium (Gibco, USA) with 10% fetal bovine serum (FBS) (Gibco, USA). 4T1 cells were cultured with RPMI 1640 supplemented with 10% FBS (Gibco, USA). These cells were incubated at 37°C in 5% CO2.

2.5 Heat treatment

4T1 cells were seeded into a 96-well culture plate (1 × 104/well) or a 6-well culture plate (4 × 105/well) followed by 12 h starvation. Cells were pretreated with Yoda1 (Selleck, China), GSK2795039 (Selleck, China), or catalase (Beyotime, China) for 1 h and then incubated at 37 or 43°C for 5 h. After the heat treatment, the plates were returned to a 37°C incubator for 24 h as recovery. Subsequently, cells were harvested for the following experiments. All incubation temperatures were maintained within ±0.01°C.

As for the experiments of photothermal nanomaterials (TiCN), cells were incubated in a medium with TiCN (100 μg/mL) after 12 h starvation. Then, the cells were given local irradiation with a 1,064 nm laser (0.6 W/cm2) for 7 min/well. After the heat treatment, the plates were returned to a 37°C incubator for 24 h and harvested for the following tests.

In the tumor models, 4T1 cells were used to establish the model, 7 days later, 200 µl of photothermal TiCN (500 µg/mL) were intravenously injected into the 4T1 tumor-bearing mice. One day later, the breast tumors of mice were exposed to a 1,064 nm laser (0.6 W/cm2) for 10 min, and then, the volumes of the tumors were measured daily. Yoda1 was administrated 1 h before laser exposure (1.5 mg/kg, intraperitoneal injection). Ten days later, the mice were sacrificed and the tumors were harvested for measurement.

2.6 Cell viability assays

Cell death and viability were determined by cell counting-8 (CCK-8) assay and live/dead cells assay (Calcein/PI Cell Viability/Cytotoxicity Assay Kit, Beyotime) according to the manufacturer’s instructions. 4T1 cells were seeded into 96-well plates and cultured. After serum starvation for 12 h, the cells were heated at the indicated temperatures and recovered for certain time intervals. After treatment, the medium was removed, 100 μL serum-free medium and 10 μL CCK-8 solution were added to each well, and the cells were incubated for 2 h at 37°C. Optical density at 450 nm was measured with the multifunctional microplate reader (Molecular Devices, USA). The experiments were performed three times. As for the live/dead cells assay, the DMEM containing 5 μL/mL propidium iodide reagent was added into each well, and the medium was incubated for 5 min under dark conditions. The live/dead cell numbers were measured on the machine CYTATION5 (Biotek, USA).

2.7 siRNA transfection

After the 4T1 cells had grown to approximately 60% confluence, they were transfected with either the Piezo1 siRNA or scramble siRNA using Lipofectamine 2000 (ThermoFisher Scientific) according to the manufacturer’s guidelines. The sequences of control and Piezo1 siRNAs are as follows: NC: CCTAAGGTTAAGTCGCCCTCG, si-piezo1: GCTATCAGACACCATTTAT. The expression of Piezo1 was confirmed by western blot and quantitative polymerase chain reaction (qPCR) analysis 48 h post-transfection.

2.8 Measurement of ROS

4T1 cells were seeded into 96-well plates and treated with Yoda1 or DMSO for 1 h and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. The culture medium was removed, and then, the cells were washed with PBS. Cells were then incubated for 30 min at 37°C with 10 μM DCFH-DA (Beyotime, China) to detect intracellular ROS levels. The cells were washed three times with serum-free cell culture solution to fully remove DCFH-DA that did not enter the cells. Cells were then put into the spectrophotometer at the excitation wavelength of 488 nm and emission wavelength of 525 nm. In our experiments, cell viability and normalized level of ROS were detected spontaneously. The normalized ROS level was presented with a relative fluorescence intensity (absorbance/number of cells per well).

2.9 Probing intracellular calcium

4T1 cells were seeded into a 96-well plate and stained with 2 μM Fura-2 AM and 0.05% Pluronic F127 (Yeasen Biotechnology, China) for 30 min in an incubator according to the manufacturer’s guidelines. Cells were washed two times in HEPES. Cells were then put into the spectrophotometer which has its heating elements. The cells were subjected to heat treatment at 43°C for 1 h and the intracellular calcium flux was detected dynamically at 2 min intervals. Changes in intracellular Ca2+ concentrations were expressed as ratios of Fura-2 fluorescence with excitation wavelengths of 340 and 380 nm and an emission wavelength of 510 nm. The fluorescent intensity of Fura‐2 was measured by a dual‐excitation wavelength method (340/380 nm) with the spectrophotometer.

2.10 Western blot

Cell proteins were extracted using RIPA lysis reagent containing protease inhibitors and phosphatase inhibitors, and then, protein quantification was performed using the BCA protein quantification method to calculate protein concentration. After 10% sodium dodecylsulfate-polyacrylamide gel electrophoresis, the protein was transferred to PVDF membranes by eBlot L1 membrane transfer machine (Genscript, Shanghai, China). The protein was sealed with blocking solution at room temperature for 1 h and then added the diluted antibody, anti-Piezo1 (1:300; ab129068), anti-NOX2(1:1000; ab129068), and anti-GAPDH (1:1000; Servicebio) were added and incubated overnight at 4°C. The next day, after washing with TBST three times (10 min/time), an HRP-labeled antibody (1:8000; ICLab, Shanghai, China) was added and incubated for 2 h at room temperature and washed with TBST three times (10 min/time). The proteins were visualized by the machine of GE Amersham AI600 (GE Healthcare, USA).

2.11 RNA isolation and qPCR

Total cellular RNA was extracted with TRIzol reagent (Vazyme Biotech, China), reverse-transcribed into cDNA by reverse transcriptase and oligo (dT) primers (Vazyme Biotech, China), and then amplified in a Real-time PCR Detection System with SYBR Green master mix and specific primers. Gene expression was normalized to Gapdh using the 2−ΔΔCT method. The results were from three independent experiments performed in triplicate. Primers were purchased from Sangon Biotech, China. The primer sequences used were listed: Piezo1-F: 5′-CCCTGTTACGCTTCAATGCT-3′, Piezo1-R: 5′-GCTACCGTTTTGTCCCAGAA-3′; Gapdh-F:5′-AGGTCGGTGTGAACGGATTTG-3′, Gapdh-R 5′-TGTAGACCATGTAGTTGAGGT-3′.

2.12 Statistical analysis

All data are representative of at least three independent experiments. All statistical analyses were performed using the GraphPad Prism 8.3.0 software. The data were presented as the mean ± standard error of the mean (SEM) as indicated in the legends. The one-way analysis of variance was performed for comparing three or more groups. The two-tailed unpaired Student’s t-test was used for comparisons between the two groups. A P value of <0.05 was considered statistically significant.

3 Results

3.1 Piezo1 is highly expressed in 4T1 cells and its agonist Yoda1 aggravates heat-induced injury

Previous studies have reported that Piezo1 is expressed in breast cancer cells. To investigate the potential role of Piezo1 in breast cancer, we first examined the expression of Piezo1 in various breast cancer cells. HUVEC was established as the control. The western blot analysis suggested that Piezo1 had a moderate expression in MDA-MB-231 cells and high expression in the 4T1 breast cancer cells (Figure 1a), indicating the potential role of the Piezo1 ion channel in breast cancer.

Figure 1 Piezo1 activation aggravates the heat-induced injury. (a) Representative western blotting result of Piezo1 proteins immunoprecipitated from HUVEC, 4T1 cell, and MDA-MD-231 cell using the anti-Piezo1 antibody. The GAPDH level was used for loading control. (b) Structural formula of Yoda1. (c) Cell viability of 4T1 cells pretreated with Yoda1 (0, 0.3, 1, 3, 10, 30 μM) for 1 h and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. (d) Representative fluorescence images of LIVE/DEAD viability of 4T1 cells pretreated with Yoda1 (3 μM) for 1 h and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. Alive cells were stained with Calcein (green) and dead cells were stained with PI (red), respectively. The values presented are mean ± SEM (n = 6 for each group; ***P < 0.001, ****P < 0.0001, one-way analysis of variance).
Figure 1

Piezo1 activation aggravates the heat-induced injury. (a) Representative western blotting result of Piezo1 proteins immunoprecipitated from HUVEC, 4T1 cell, and MDA-MD-231 cell using the anti-Piezo1 antibody. The GAPDH level was used for loading control. (b) Structural formula of Yoda1. (c) Cell viability of 4T1 cells pretreated with Yoda1 (0, 0.3, 1, 3, 10, 30 μM) for 1 h and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. (d) Representative fluorescence images of LIVE/DEAD viability of 4T1 cells pretreated with Yoda1 (3 μM) for 1 h and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. Alive cells were stained with Calcein (green) and dead cells were stained with PI (red), respectively. The values presented are mean ± SEM (n = 6 for each group; ***P < 0.001, ****P < 0.0001, one-way analysis of variance).

To investigate the functional role of the Piezo1 in breast cancer, 4T1 cells were subjected to heat treatment under 43°C for 5 h. It was observed that the cell viability decreased significantly after heat stress. With the pretreatment of Yoda1 (Figure 1b), a specific agonist of Piezo1, the cell death triggered by heat stress was significantly aggravated in a dose-dependent manner (Figure 1c). Given that the cytotoxicity was observed at the high concentration of Yoda1 (10 and 30 μM), 3 μM Yoda1 was finally selected in the subsequent experiments. To visually investigate the survival of breast cancer cells with the treatment of Yoda1, we compared the number of live/dead breast cancer cells with/without 3 μM Yoda1 with a fluorescence microscope. As is shown in Figure 1d, the number of dead 4T1 cells increased significantly under heat stress, and Yoda1 further exacerbated the heat-induced cell death. The result was consistent with that measured by the CCK-8 assay. Altogether, these results indicated the potential role of Piezo1 activation in heat stress-induced breast cancer cell injury.

3.2 Yoda1 aggravates heat-induced injury in 4T1 cells through Piezo1 activation

To further investigate the role of Piezo1 in heat stress, 4T1 cells were transfected with siRNA against Piezo1. The expression of Piezo1 was significantly reduced at both mRNA and protein levels (Figure 2a and b), indicating that the level of Piezo1 in 4T1 cells was successfully knocked down. Cells activated with Yoda1 or/and silenced with Piezo1 siRNA were exposed to heat treatment under 43°C for 5 h. It was observed that Piezo1 knockdown alleviates the capacity of Yoda1 to aggravate heat-induced injury. (Figure 2c). These results further demonstrated that Yoda1 aggravates heat-induced breast cancer cell injury through Piezo1 activation.

Figure 2 Yoda1 aggravates heat-induced injury in 4T1 cells through Piezo1 activation. (a) The relative mRNA level of Piezo1 in Piezo1 siRNA-transfected 4T1 cells was detected by real-time polymerase chain reaction. (b) Representative western blotting image of Piezo1 proteins in Piezo1 siRNA-transfected 4T1 cells. (c) Cell viability of 4T1 cells pretreated with Yoda1 (3 μM) or transfected with Piezo1 siRNA and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. (d) Representative average traces of Fura-2 Ca2+ imaging of 4T1 cells (6 wells) or Yoda1 pretreated 4T1 cells (6 wells) in response to heat treatment under 43°C for 1 h. (e) Cell viability of 4T1 cells pretreated with Yoda1 (3 μM) or EDTA (1.8 μM) and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. The values presented are mean ± SEM (n = 6 for each group; **P < 0.01, ****P < 0.0001, one-way analysis of variance).
Figure 2

Yoda1 aggravates heat-induced injury in 4T1 cells through Piezo1 activation. (a) The relative mRNA level of Piezo1 in Piezo1 siRNA-transfected 4T1 cells was detected by real-time polymerase chain reaction. (b) Representative western blotting image of Piezo1 proteins in Piezo1 siRNA-transfected 4T1 cells. (c) Cell viability of 4T1 cells pretreated with Yoda1 (3 μM) or transfected with Piezo1 siRNA and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. (d) Representative average traces of Fura-2 Ca2+ imaging of 4T1 cells (6 wells) or Yoda1 pretreated 4T1 cells (6 wells) in response to heat treatment under 43°C for 1 h. (e) Cell viability of 4T1 cells pretreated with Yoda1 (3 μM) or EDTA (1.8 μM) and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. The values presented are mean ± SEM (n = 6 for each group; **P < 0.01, ****P < 0.0001, one-way analysis of variance).

We next set up to understand how Piezo1 might affect the heat-induced injury in 4T1 cells. Given that Piezo1 is an essential mechanosensitive cation channel that mediates calcium signaling, it prompted us to further assess the role of Piezo1 in regulating Ca2+ homeostasis and heat-induced injury. It was reported that intracellular Ca2+ increased under heat stress, which may destroy intracellular homeostasis and aggravate cell damage. However, it remains unknown whether Piezo1-induced Ca2+ signals are associated with heat-induced injury. To assess the real-time calcium signaling, 4T1 cells were pretreated with Fura-2 AM and directly heated in the spectrophotometer under 43°C for 1 h. Interestingly, the intracellular Ca2+ concentration fluctuated with the heating time, presenting an upward trend (Figure 2d). Remarkably, Yoda1 significantly increased the intracellular Ca2+ concentration of the heated 4T1 cells, indicating the essential role of Piezo1-mediated calcium signaling in heat-induced injury. To further assess the role of the increased calcium flux, EDTA was used to reduce free Ca2+ in the culture media. It was observed that the chelation of extracellular free Ca2+ with EDTA (1.8 μM) significantly inhibited heat-induced cellular injury (Figure 2e). However, Yoda1-mediated cellular injury remains with the existence of EDTA, which may indicate that intracellular calcium homeostasis is also involved in the aggravation effect, given that Piezo1 is highly expressed in the endoplasmic reticulum (ER). Altogether, these results indicated that Yoda1 aggravates heat-induced injury through increased calcium flux.

3.3 Piezo1 mediates the heat-induced injury in 4T1 cells through NOX2-ROS signaling pathway

ROS are byproducts of aerobic metabolism during cellular respiration. An imbalance between ROS generation and the available antioxidant defense against them can lead to oxidative stress. Oxidative stress has been linked to heat stress in animals. However, the potential involvement of Piezo1 in the ROS signaling pathway in the heat-induced damage to 4T1 cells remains unknown. To test this hypothesis, we measured ROS generation in 4T1 cells using the DCFH-DA. Following heat stress, ROS production was observed to increase considerably, while Yoda1 exacerbated the rise in ROS after heat stress (Figure 3a). Furthermore, Piezo1 knockdown significantly alleviated the heat-induced ROS elevation (Figure 3b). These data provide compelling genetic evidence that Piezo1 is involved in inducing ROS release in the setting of heat stress. To further assess the role of ROS signaling in heat stress, the ROS scavenger catalase was administrated. Remarkably, the Yoda1-mediated aggravation of heat stress was significantly reversed with the use of catalase, and both the impaired cell activity and the rise of ROS production were reversed (Figure 3c and d). These results suggested that ROS signaling is essential for heat-induced injury in 4T1 cells, and the Yoda1-induced aggravation can be partly attributed to promoting ROS release.

Figure 3 Piezo1 mediates the heat-induced injury in 4T1 cells through the NOX2-ROS signaling pathway. (a) Bar plot of normalized level of ROS in 4T1 cells before and after administration of Yoda1 in the presence or absence of heat treatment under 43°C for 5 h and recovery for 24 h. (b) Bar plot of normalized level of ROS in 4T1 cells pretreated with Yoda1 (3 μM) or transfected with Piezo1 siRNA and then subjected to heat treatment. (c and d) 4T1 cells were pretreated with catalase (300 μg/mL) or Yoda1 (3 μM) and then subjected to heat treatment. Cell viability and normalized level of ROS were detected. (e) Representative western blotting result of NOX2 proteins in 4T1 cells pretreated with Yoda1 (3 μM) and then subjected to heat treatment. (f) Cell viability of 4T1 cells pretreated with GSK2795039 (0, 10, 20, 30 μM) and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. (g and h) 4T1 cells were pretreated with GSK2795039 (30 μM) or Yoda1 (3 μM) and then subjected to heat treatment. Cell viability and normalized level of ROS were detected. The values presented are mean ± SEM (n = 6 for each group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, one-way analysis of variance).
Figure 3

Piezo1 mediates the heat-induced injury in 4T1 cells through the NOX2-ROS signaling pathway. (a) Bar plot of normalized level of ROS in 4T1 cells before and after administration of Yoda1 in the presence or absence of heat treatment under 43°C for 5 h and recovery for 24 h. (b) Bar plot of normalized level of ROS in 4T1 cells pretreated with Yoda1 (3 μM) or transfected with Piezo1 siRNA and then subjected to heat treatment. (c and d) 4T1 cells were pretreated with catalase (300 μg/mL) or Yoda1 (3 μM) and then subjected to heat treatment. Cell viability and normalized level of ROS were detected. (e) Representative western blotting result of NOX2 proteins in 4T1 cells pretreated with Yoda1 (3 μM) and then subjected to heat treatment. (f) Cell viability of 4T1 cells pretreated with GSK2795039 (0, 10, 20, 30 μM) and then subjected to heat treatment under 43°C for 5 h and recovering for 24 h. (g and h) 4T1 cells were pretreated with GSK2795039 (30 μM) or Yoda1 (3 μM) and then subjected to heat treatment. Cell viability and normalized level of ROS were detected. The values presented are mean ± SEM (n = 6 for each group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, one-way analysis of variance).

NADPH oxidase 2 (NOX2), a superoxide-generating enzyme, was identified as one of the key sources of ROS generation. For testing the role of NOX2, the western blot of the 4T1 cells was performed. It was observed that the protein level of NOX2 increased with exposure to heat stress, and it was further enhanced with the treatment of Yoda1 (Figure 3e). GSK2795039, an inhibitor of NOX2, which can competitively inhibit the substrate of NOX2 and the production of ROS. The cell vitality test revealed that GSK2795039 alleviated the heat-induced damage to 4T1 cells in a dose-dependent manner (Figure 3f). GSK2795039 also reversed the Yoda1-mediated aggravation of cellular injury and ROS generation after heat stress (Figure 3g and h). Altogether, these data collectively demonstrate that Piezo1 activation might mediate the heat-induced injury in 4T1 cells through the NOX2-ROS signaling pathway.

3.4 Structural characterization of TiCN

TiCN is a novel and promising nanomaterial for the application of hyperthermia therapy. The microstructure of TiCN nanosheets was investigated by TEM, XRD, and XPS. After HF etching from bulk TiCN ceramics, the as-synthesized TiCN was in the form of nanosheets. TiCN nanosheets showed a broad absorbance in wavelength of 300–900 nm (Figure 4a). The hydrodynamic diameter of TiCN nanosheets determined by DLS was 105 ± 2.2 nm, which was similar to the TEM results (Figure 4i). Furthermore, the zeta potential of TiCN nanosheets was determined to be −17 ± 0.5 mV (Figure 4c), which could be ascribed to the presence of hydroxyl on the surface of TiCN nanosheets. The XRD pattern of TiCN nanosheets exhibited five dominant peaks at approximately 36, 42, 61, 73, and 77°, corresponding to the (111), (200), (220), (311), and (222) planes of TiCN, respectively (Figure 4d). XPS analysis revealed that TiCN nanosheets contained C, N, Ti, and O elements (Figure 4e), indicating the successful preparation of TiCN nanosheets. C–Ti, C–C, and C–N were presented in the high-resolution C 1s spectrum (Figure 4f). The Ti-containing species of Ti2+ 2p3/2, Ti4+ 2p3/2, Ti2+ 2p1/2, and Ti4+ 2p3/2 were observed in the high-resolution Ti 2p spectrum (Figure 4g), suggesting the presence of Ti2+ and Ti4+ in TiCN nanosheets. Moreover, C–N, Ti–N, and pyridine N can be detected in the high-resolution N 1s spectrum (Figure 4h). The HRTEM image presented in Figure 4j demonstrated the high crystallinity of well-dispersed TiCN nanosheets with distinct lattice fringe.

Figure 4 Structural characterization of TiCN. (a) Absorption spectrum of TiCN. (b) Hydrodynamic diameter of TiCN. (c) Zeta potential of TiCN. (d) XRD pattern of TiCN. (e–h) Survey XPS spectrum. High-resolution C 1s, Ti 2p, and N 1s spectra of TiCN. (i and j) TEM and HRTEM images of TiCN.
Figure 4

Structural characterization of TiCN. (a) Absorption spectrum of TiCN. (b) Hydrodynamic diameter of TiCN. (c) Zeta potential of TiCN. (d) XRD pattern of TiCN. (e–h) Survey XPS spectrum. High-resolution C 1s, Ti 2p, and N 1s spectra of TiCN. (i and j) TEM and HRTEM images of TiCN.

3.5 Piezo1 activation has the potential to increase the sensitivity of breast cancer cells to hyperthermia therapy mediated by a novel photothermal nanomaterial

4T1 cells were seeded into 96-well plates and incubated in a medium with TiCN (100 μg/mL) for 1 h. The cells were then treated with a 1,064 nm laser (0.6 W/cm2) for 7 min, and the effects of the photothermal conversion of the nanomaterials were detected with a thermal imager. The ambient temperature of cell culture rapidly ascends within the first 3 min and eventually reaches 48°C at 7 min after a plateau period (Figure 5a and b). After the heat treatment of 7 min, the plates were returned to a 37°C incubator for 24 h and the cell viability was measured. As is shown in Figure 5c, the application of nanomaterials had no toxic damage to cells. The cell viability gradually decreased with the prolongation of the laser irradiation and reduced to 37.18% at 7 min. Furthermore, cell viability decreased to 18.47% in the group of Yoda1 administration. These results suggested the successful establishment of TiCN and the potential sensitizing effects of Yoda1.

Figure 5 Piezo1 activation has potential in increasing the sensitivity of breast cancer cells to photothermal therapy in vitro. (a) Photothermal effect of the TiCN under the 1,064 nm laser at five-ampere. The lasers were shut off after 420 s irradiation. (b) Maximum temperature within the 96-well plates recorded by a thermal imager after a certain time of exposure to a 1,064 nm laser. (c) 4T1 cells were pretreated with TiCN in the presence or absence of Yoda1 (3 μM) and then subjected to heat treatment of 1,064 nm laser for certain durations. 4T1 cells were sent back to a 37°C incubator and then cell viability was detected. The values presented are mean ± SEM (n = 6 for each group; ns P＞0.05, **P < 0.01, ****P < 0.0001, one-way analysis of variance).
Figure 5

Piezo1 activation has potential in increasing the sensitivity of breast cancer cells to photothermal therapy in vitro. (a) Photothermal effect of the TiCN under the 1,064 nm laser at five-ampere. The lasers were shut off after 420 s irradiation. (b) Maximum temperature within the 96-well plates recorded by a thermal imager after a certain time of exposure to a 1,064 nm laser. (c) 4T1 cells were pretreated with TiCN in the presence or absence of Yoda1 (3 μM) and then subjected to heat treatment of 1,064 nm laser for certain durations. 4T1 cells were sent back to a 37°C incubator and then cell viability was detected. The values presented are mean ± SEM (n = 6 for each group; ns P＞0.05, **P < 0.01, ****P < 0.0001, one-way analysis of variance).

3.6 Piezo1 activation increases the sensitivity of breast cancer cells to hyperthermia therapy in mice

In the tumor models, TiCN solutions were intravenously injected into the 4T1 tumor-bearing mice via the tail vein, and the breast tumors of mice were exposed to a 1,064 nm laser (0.6 W/cm2) 1 day later. The effects of the photothermal conversion of the nanomaterials were detected with a thermal imager, and the representative images of the local temperature of tumors are shown in Figure 6b. After 10 min hyperthermia therapy, the mice were returned to cages, and the tumor growth curves were recorded for 10 days (Figure 6c). The complete tumor ablation was determined eventually (Figure 6d–f). In mice administrated with nanomaterials, the growth of tumors was significantly reduced after laser irradiation. Although Yoda1 alone did not change the tumor growth, it further enhanced the slowdown of tumor growth in the presence of TiCN.

Figure 6 Piezo1 activation increases the sensitivity of breast cancer cells to hyperthermia therapy in mice. (a) Schematic illustration of TiCN-mediated photothermal therapy and administration of Yoda1 for 4T1 tumor-bearing mice. (b) Maximum temperature within the tumor region was recorded by a thermal imager after local administration of 1,064 nm laser irradiation at the power density of 0.6 W/cm2. (c) Tumor growth curves of mice after receiving different treatments, including TiCN, TiCN + Yoda1, TiCN + laser, and TiCN + Yoda1 + laser. (d) Pictures of tumors obtained from mice on day 10 after receiving different treatments. (e) Tumor volume and (f) tumor weight of mice were recorded on day 10 after receiving different treatments. The values presented are mean ± SEM (n = 5 for each group; *P < 0.05, **P < 0.01, one-way analysis of variance).
Figure 6

Piezo1 activation increases the sensitivity of breast cancer cells to hyperthermia therapy in mice. (a) Schematic illustration of TiCN-mediated photothermal therapy and administration of Yoda1 for 4T1 tumor-bearing mice. (b) Maximum temperature within the tumor region was recorded by a thermal imager after local administration of 1,064 nm laser irradiation at the power density of 0.6 W/cm2. (c) Tumor growth curves of mice after receiving different treatments, including TiCN, TiCN + Yoda1, TiCN + laser, and TiCN + Yoda1 + laser. (d) Pictures of tumors obtained from mice on day 10 after receiving different treatments. (e) Tumor volume and (f) tumor weight of mice were recorded on day 10 after receiving different treatments. The values presented are mean ± SEM (n = 5 for each group; *P < 0.05, **P < 0.01, one-way analysis of variance).

4 Discussion

Piezo1 is an essential mechanical-sensitive ion channel. Through its unique three-blade propeller-shape architecture, Piezo1 transduces various mechanical stimuli into cellular signals via cation influx, mainly Ca2+ [12,27]. Yoda1 is the specific agonist of Piezo1, which can effectively lower the channel’s mechanical threshold for activation and trigger Ca2+ influx. Transient receptor potential vanilloid 1 (TRPV1), a capsaicin receptor, was previously reported to be activated and open the channel under heat stress. The entry of substantial extracellular Ca2+ into the cell consequently caused cell damage [28,29]. However, as a Ca2+-permeable channel, Piezo1 has not been reported for its potential role in heat stress. In the current study, the breast cancer cells, 4T1 cells, were transfected by Piezo1 siRNA or administrated with the Piezo1 agonist Yoda1, followed by exposure to heat stress. The results showed that Piezo1 could aggregate the heat-induced injury of 4T1 cells, indicating that Piezo1 can be a promising target for the treatment of breast cancer with heat therapy. This provoked us to think about the role of Piezo1 in the perception of cells to heat stress. We observed that the morphology of some 4T1 cells changed from fibrous to round after the hit of heat stress. We supposed that heat changed the shape of cells and thus brought changes in mechanical forces of cells. Just as the principle of thermal expansion and cold contraction, the deformation of cell membranes was induced by heat and led to the activation of Piezo1.

Ca2+ homeostasis plays a critical role in the normal function of cells and tissues. Once an imbalanced homeostasis occurs due to excessive Ca2+ influx, cells can come to death. For instance, under the stimulation of noxious heat, the TRPV1 channel is activated by the increases in temperature, and the entry of extracellular Ca2+ ensues, which leads to the imbalance of Ca2+ homeostasis and cell damage [30,31]. Ryanodine receptor 1 (RyR1), the skeletal muscle ryanodine receptor, is a Ca2+-release channel located in the sarcoplasmic reticulum. Its mutation is known to be responsible for the pathogenesis of malignant hyperthermia (MH) [32]. The RYR1-selective inhibitor, Compound 1(Cpd1), effectively prevented and treated the MH and heat stress-induced cellular damage [33]. In addition, the susceptibility to exertional heat stroke is related to the mutation of the RYR1 gene [33,34,35,36]. Mechanically, heat stress can cause the leakage of Ca2+ in the sarcoplasmic reticulum and decrease the ability of the sarcoplasmic reticulum to recover Ca2+ [37,38]. Our current experimental results showed that heat stress indeed induced elevated intracellular Ca2+ concentration. Strikingly, the Piezo1 agonist Yoda1 further increased the concentration of intracellular Ca2+. So, we hypothesized that Yoda1 may aggravate the heat-induced injury by increasing the Ca2+ influx. Ca2+ -free medium was then used for further experiments. Interestingly, the group of Yoda1 still showed an exacerbated injury, which was though partly alleviated. The results suggested that, apart from the Ca2+ homeostasis sustained by the internal and external balance, self-regulation of cells is also of great importance, especially the Ca2+ homeostasis in the ER. ER is known as an important Ca2+ pool. Under the stimulation of heat stress, ER stress can be triggered due to the imbalanced Ca2+ homeostasis and substantial misfolded proteins in the ER, which can eventually cause cell apoptosis [39]. Notably, Piezo1 is also highly expressed in the ER. The exact effect of Yoda1 on Ca2+ deserves further investigation. In general, Piezo1 is pivotal in the stability of intracellular Ca2+ under heat stress. Yoda1 disrupts the balance and aggravates cell death.

ROS is known to play essential roles in cell physiology and participate in many pathological processes. In the malignant microenvironment, ROS exerts multiple actions in the growth and death during different periods of cancer. ROS mediates various DNA damage and is closely associated with the initiation and development of cancer [40]. However, ROS can induce cell apoptosis and death, which can be used as an important prescription for cancer treatment [41,42,43]. Currently, considerable methods have been developed to improve the level of ROS to induce cancer cell death, and some chemical compounds have been approved as anticancer drugs [44]. Mounting literature has reported that the level of intracellular ROS could be increased by the stimulation of heat stress [45,46]. Consistently, our experiment observed that intracellular ROS of 4T1 cells was increased under heat stress. Notably, the administration of Yoda1 further increased the level of ROS. To identify the role of ROS in the Yoda1 facilitated cell death, a ROS scavenger, catalase, was used. We observed that catalase ameliorated both the heat stress induced cell death and the aggravation effect of Yoda1. This suggested that ROS plays a pivotal role in the precession of heat stress and Piezo1 activation-associated cell injury. Moreover, 4T1 cells treated with Ca2+-free medium and Piezo1 siRNA showed alleviated injury under heat stress, indicating that the elevated intracellular Ca2+ is triggered by Piezo1 and is responsible for the increased ROS level and the aggravation effect of Yoda1.

The generation of intracellular ROS is mainly through two pathways. One resource is the mitochondrial respiratory chain, which produces ROS as by-products of cellular metabolism [47]. Another resource relies on the activity of NADPH oxidase (NOX), the main function of this enzyme is ROS production [48]. It is reported that NOX2 is a promising target for cancer therapy [48,49]. In our experiment, heat stress and Piezo1 activation increased the expression of NOX2 in the 4T1 cell. So, we next treated the breast cancer cell with a NOX2 inhibitor (GSK2795039). The results showed that the aggravated cell injury induced by Yoda1 under heat stress was significantly alleviated, which manifested in improved cell viability and declining ROS. Taken together, the elevated ROS induced by heat stress and Yoda1 can be attributable to NOX2 activity. To our knowledge, this mechanism has not been reported in any other literature. After the administration of Ca2+-free medium or Piezo1 siRNA, the elevated expression of NOX2 was eliminated under heat stress and Yoda1 treatment. Altogether, heat stress or Yoda1 can activate Piezo1, which increases Ca2+ influx and NOX2 expression, leading to increased ROS and cell damage (Figure 7).

Figure 7 Model of Piezo1-mediated heat stress in photothermal therapy of breast cancer cells. Scheme of Piezo1-mediated heat stress in the breast cancer cell. Photothermal therapy or Yoda1 activates Piezo1, increases the expression of NOX2, and sequentially promotes the release of ROS in the breast cancer cell.
Figure 7

Model of Piezo1-mediated heat stress in photothermal therapy of breast cancer cells. Scheme of Piezo1-mediated heat stress in the breast cancer cell. Photothermal therapy or Yoda1 activates Piezo1, increases the expression of NOX2, and sequentially promotes the release of ROS in the breast cancer cell.

We further investigated the potential effect of Piezo1 activation on hyperthermia therapy of breast cancer. The photothermal conversion efficiency of TiCN was determined and the Piezo1-specific agonist significantly enhanced the antitumor effect of TiCN, indicating the excellent potential of Piezo1 activation in breast cancer treatment. Thus, a lot of work is urgently needed in elucidating the biological functions of Piezo1 ion channel in response to heat exposure. In the future, it might be important to alter the regional activity of Piezo1 ion channel in tumor, and the discovery of clinically applicable Piezo1 agonist or antagonist might be of great significance in clinical practice.

5 Conclusion

In summary, we proposed a novel target for sensitizing breast cancer to hyperthermia therapy. The activation of Piezo1 ion channel exacerbated heat-induced injury of 4T1 cells, and this property was appropriate for the application of hyperthermia therapy in cancer. The photothermal nanomaterial called TiCN was used to assess the role of Piezo1 activation in PTT of breast tumor. Both the in vivo and in vitro experiments validated the photothermal conversion efficiency of TiCN and witnessed the efficacy of Piezo1 specific agonist in enhancing the sensitivity of breast tumor to hyperthermia therapy under the 1,064 nm laser irradiation. Mechanistically, Piezo1 activation significantly increased the expression of NOX2 in the breast cancer cells, which may exert the antitumor effect in a ROS-dependent way. Thus, it is imperative to pay more attention to this mechanosensitive ion channel in the setting of heat stress, which may benefit the development of novel medication candidates for antitumor therapy.

Abbreviations

CCK-8

Cell counting-8

HUVECs

Human umbilical vein endothelial cells

MH

Malignant hyperthermia

NADPH

Nicotinamide adenine dinucleotide phosphate

NOX2

NADPH oxidase 2

PTT

Photothermal therapy

TEM

Transmission electron microscopy

TRPV1

Transient receptor potential vanilloid 1

XPS

X-ray photoelectron spectroscopy

XRD

X-ray diffraction

ROS

Reactive oxygen species

RyR1

Ryanodine receptor 1

# These authors contributed equally to this work.

Acknowledgements

Not applicable.

  1. Funding information: This work was supported by the National Natural Science Foundation of China (8237121269, 82173649, 81872660, 81803643) and the National Key Basic Research (2022-JCJQ-ZD-097-11).

  2. Author contributions: Shao-kang Wang, Xiao-ting Zhang, and Xuan-yao Jiang: conceptualization, methodology, investigation, writing-reviewing, and editing. Shuo-gui Xu, Jiang-bo Zhu, Mei-tang Wang, Xiao-fang Zhang, and Ji-kuai Chen: supervision and review. Bi-jiang Geng, Tao-lin Qing, Lei Li, Lan Yan, Yun Chen, and Jin-feng Li: technical, material support; acquisition of data.

  3. Conflict of interest: The authors declare no conflict of interest.

  4. Data availability statement: The analytical datasets that support the findings of this study are available from the corresponding author upon reasonable request.

References

[1] Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209–49.10.3322/caac.21660Suche in Google Scholar PubMed

[2] Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA: A Cancer J Clin. 2022;72:7–33.10.3322/caac.21708Suche in Google Scholar PubMed

[3] Mantso T, Goussetis G, Franco R, Botaitis S, Pappa A, Panayiotidis M. Effects of hyperthermia as a mitigation strategy in DNA damage-based cancer therapies. Semin Cancer Biol. 2016;37–38:96–105.10.1016/j.semcancer.2016.03.004Suche in Google Scholar PubMed

[4] Mortezaee K, Narmani A, Salehi M, Bagheri H, Farhood B, Haghi-Aminjan H, et al. Synergic effects of nanoparticles-mediated hyperthermia in radiotherapy/chemotherapy of cancer. Life Sci. 2021;269:119020.10.1016/j.lfs.2021.119020Suche in Google Scholar PubMed

[5] Stephen ZR, Zhang M. Recent progress in the synergistic combination of nanoparticle-mediated hyperthermia and immunotherapy for treatment of cancer. Adv Healthc Mater. 2021;10:e2001415.10.1002/adhm.202001415Suche in Google Scholar PubMed PubMed Central

[6] Shanmugam V, Selvakumar S, Yeh CS. Near-infrared light-responsive nanomaterials in cancer therapeutics. Chem Soc Rev. 2014;43:6254–87.10.1039/C4CS00011KSuche in Google Scholar PubMed

[7] Melancon MP, Zhou M, Li C. Cancer theranostics with near-infrared light-activatable multimodal nanoparticles. Acc Chem Res. 2011;44:947–56.10.1021/ar200022eSuche in Google Scholar PubMed PubMed Central

[8] Geng B, Shen W, Fang F, Qin H, Li P, Wang X, et al. Enriched graphitic N dopants of carbon dots as F cores mediate photothermal conversion in the NIR-II window with high efficiency. Carbon (N Y). 2020;162:220–33.10.1016/j.carbon.2020.02.053Suche in Google Scholar

[9] Garanina AS, Naumenko VA, Nikitin AA, Myrovali E, Petukhova AY, Klimyuk SV, et al. Temperature-controlled magnetic nanoparticles hyperthermia inhibits primary tumor growth and metastases dissemination. Nanomed: Nanotechnol Biol Med. 2020;25:102171.10.1016/j.nano.2020.102171Suche in Google Scholar PubMed

[10] Diederich CJ. Thermal ablation and high-temperature thermal therapy: Overview of technology and clinical implementation. Int J Hyperther. 2011;21:745–53.10.1080/02656730500271692Suche in Google Scholar PubMed

[11] Alamdari SG, Amini M, Jalilzadeh N, Baradaran B, Mohammadzadeh R, Mokhtarzadeh A, et al. Recent advances in nanoparticle-based photothermal therapy for breast cancer. J Control Rel. 2022;349:269–303.10.1016/j.jconrel.2022.06.050Suche in Google Scholar PubMed

[12] Ge J, Li W, Zhao Q, Li N, Chen M, Zhi P, et al. Architecture of the mammalian mechanosensitive Piezo1 channel. Nature (London). 2015;527:64–9.10.1038/nature15247Suche in Google Scholar PubMed

[13] Zhong M, Wu W, Kang H, Hong Z, Xiong S, Gao X, et al. Alveolar stretch activation of endothelial piezo1 protects adherens junctions and lung vascular barrier. Am J Resp Cell Mol. 2020;62:168–77.10.1165/rcmb.2019-0024OCSuche in Google Scholar PubMed PubMed Central

[14] Friedrich EE, Hong Z, Xiong S, Zhong M, Di A, Rehman J, et al. Endothelial cell Piezo1 mediates pressure-induced lung vascular hyperpermeability via disruption of adherens junctions. Proc Natl Acad Sci. 2019;116:12980–5.10.1073/pnas.1902165116Suche in Google Scholar PubMed PubMed Central

[15] Li J, Hou B, Tumova S, Muraki K, Bruns A, Ludlow MJ, et al. Piezo1 integration of vascular architecture with physiological force. Nature. 2014;515:279–82.10.1038/nature13701Suche in Google Scholar PubMed PubMed Central

[16] Xiao B. Levering mechanically activated piezo channels for potential pharmacological intervention. Annu Rev Pharmacol. 2020;60:195–218.10.1146/annurev-pharmtox-010919-023703Suche in Google Scholar PubMed

[17] Solis AG, Bielecki P, Steach HR, Sharma L, Harman CCD, Yun S, et al. Mechanosensation of cyclical force by PIEZO1 is essential for innate immunity. Nature. 2019;573:69–74.10.1038/s41586-019-1485-8Suche in Google Scholar PubMed PubMed Central

[18] Aykut B, Chen R, Kim JI, Wu D, Shadaloey S, Abengozar R, et al. Targeting Piezo1 unleashes innate immunity against cancer and infectious disease. Sci Immunol. 2020;5(50):eabb5168.10.1126/sciimmunol.abb5168Suche in Google Scholar PubMed

[19] Sun Y, Li M, Liu G, Zhang X, Zhi L, Zhao J, et al. The function of Piezo1 in colon cancer metastasis and its potential regulatory mechanism. J Cancer Res Clin. 2020;146:1139–52.10.1007/s00432-020-03179-wSuche in Google Scholar PubMed PubMed Central

[20] Han Y, Liu C, Zhang D, Men H, Huo L, Geng Q, et al. Mechanosensitive ion channel Piezo1 promotes prostate cancer development through the activation of the Akt/mTOR pathway and acceleration of cell cycle. Int J Oncol. 2019;55:629–44.10.3892/ijo.2019.4839Suche in Google Scholar PubMed PubMed Central

[21] Wang X, Cheng G, Miao Y, Qiu F, Bai L, Gao Z, et al. Piezo type mechanosensitive ion channel component 1 facilitates gastric cancer omentum metastasis. J Cell Mol Med. 2021;25:2238–53.10.1111/jcmm.16217Suche in Google Scholar PubMed PubMed Central

[22] Dombroski JA, Hope JM, Sarna NS, King MR. Channeling the force: Piezo1 mechanotransduction in cancer metastasis. Cells-Basel. 2021;10:2815.10.3390/cells10112815Suche in Google Scholar PubMed PubMed Central

[23] Li C, Rezania S, Kammerer S, Sokolowski A, Devaney T, Gorischek A, et al. Piezo1 forms mechanosensitive ion channels in the human MCF-7 breast cancer cell line. Sci Rep-UK. 2015;5:8364.10.1038/srep08364Suche in Google Scholar PubMed PubMed Central

[24] O’Callaghan P, Engberg A, Eriksson O, Fatsis-Kavalopoulos N, Stelzl C, Sanchez G, et al. Piezo1 activation attenuates thrombin-induced blebbing in breast cancer cells. J Cell Sci. 2022;135(7):jcs258809.10.1242/jcs.258809Suche in Google Scholar PubMed PubMed Central

[25] Yu Y, Wu XA, Liu S, Zhao H, Li B, Zhao H, et al. Piezo1 regulates migration and invasion of breast cancer cells via modulating cell mechanobiological properties. Acta Biochim Biophys Sin. 2020;53(1):10–8.10.1093/abbs/gmaa112Suche in Google Scholar PubMed

[26] Luo M, Cai G, Ho KKY, Wen K, Tong Z, Deng L, et al. Compression enhances invasive phenotype and matrix degradation of breast Cancer cells via Piezo1 activation. BMC Mol Cell Biol. 2022;23(1):1.10.1186/s12860-021-00401-6Suche in Google Scholar PubMed PubMed Central

[27] Wang Y, Chi S, Zhao Q, Wang J, Zhang T, Geng J, et al. A lever-like transduction pathway for long-distance chemical- and mechano-gating of the mechanosensitive piezo1 channel. Biophys J. 2018;114:113a–4a.10.1016/j.bpj.2017.11.655Suche in Google Scholar

[28] Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, Julius D. The capsaicin receptor: A heat-activated ion channel in the pain pathway. Nature. 1997;389:816–24.10.1038/39807Suche in Google Scholar PubMed

[29] Voets T, Droogmans G, Wissenbach U, Janssens A, Flockerzi V, Nilius B. The principle of temperature-dependent gating in cold- and heat-sensitive TRP channels. Nature. 2004;430:748–54.10.1038/nature02732Suche in Google Scholar PubMed

[30] Harding HP, Zhang Y, Ron D. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature. 1999;397:271–4.10.1038/16729Suche in Google Scholar PubMed

[31] Balch WE, Morimoto RI, Dillin A, Kelly JW. Adapting proteostasis for disease intervention. Science (Am Assoc Adv Sci). 2008;319:916–9.10.1126/science.1141448Suche in Google Scholar PubMed

[32] Sun Z, Wang L, Han L, Wang Y, Zhou Y, Li Q, et al. Functional calsequestrin-1 is expressed in the heart and its deficiency is causally related to malignant hyperthermia-like arrhythmia. Circulation. 2021;144:788–804.10.1161/CIRCULATIONAHA.121.053255Suche in Google Scholar PubMed

[33] Yamazawa T, Kobayashi T, Kurebayashi N, Konishi M, Noguchi S, Inoue T, et al. A novel RyR1-selective inhibitor prevents and rescues sudden death in mouse models of malignant hyperthermia and heat stroke. Nat Commun. 2021;12:4293.10.1038/s41467-021-24644-1Suche in Google Scholar PubMed PubMed Central

[34] Durham WJ, Aracena-Parks P, Long C, Rossi AE, Goonasekera SA, Boncompagni S, et al. RyR1 S-nitrosylation underlies environmental heat stroke and sudden death in Y522S RyR1 knockin mice. Cell. 2008;133:53–65.10.1016/j.cell.2008.02.042Suche in Google Scholar PubMed PubMed Central

[35] Serano M, Pietrangelo L, Paolini C, Guarnier FA, Protasi F. Oxygen consumption and basal metabolic rate as markers of susceptibility to malignant hyperthermia and heat stroke. Cells. 2022;11(16):2468.10.3390/cells11162468Suche in Google Scholar PubMed PubMed Central

[36] Wang HJ, Lee CS, Yee RSZ, Groom L, Friedman I, Babcock L, et al. Adaptive thermogenesis enhances the life-threatening response to heat in mice with an Ryr1 mutation. Nat Commun. 2020;11:5099.10.1038/s41467-020-18865-zSuche in Google Scholar PubMed PubMed Central

[37] He S, Li R, Peng Y, Wang Z, Huang J, Meng H, et al. ACSL4 contributes to ferroptosis‐mediated rhabdomyolysis in exertional heat stroke. J Cachexia Sarcopenia Muscle. 2022;13:1717–30.10.1002/jcsm.12953Suche in Google Scholar PubMed PubMed Central

[38] Laitano O, Sheikh LH, Mattingly AJ, Murray KO, Ferreira LF, Clanton TL. Osmolality selectively offsets the impact of hyperthermia on mouse skeletal muscle in vitro. Front Physiol. 2018;9:1496.10.3389/fphys.2018.01496Suche in Google Scholar PubMed PubMed Central

[39] Groenendyk J, Agellon LB, Michalak M. Calcium signaling and endoplasmic reticulum stress. Int Rev Cell Mol Biol. 2021;363:1–20.10.1016/bs.ircmb.2021.03.003Suche in Google Scholar PubMed

[40] Aggarwal V, Tuli HS, Varol A, Thakral F, Yerer MB, Sak K, et al. Role of reactive oxygen species in cancer progression: Molecular mechanisms and recent advancements. Biomolecules. 2019;9(11):735.10.3390/biom9110735Suche in Google Scholar PubMed PubMed Central

[41] Chen M, Yang J, Zhou L, Hu X, Wang C, Chai K, et al. Dual-responsive and ROS-augmented nanoplatform for chemo/photodynamic/chemodynamic combination therapy of triple negative breast cancer. ACS Appl Mater Inter. 2022;14:57–68.10.1021/acsami.1c14135Suche in Google Scholar PubMed

[42] Dewaele M, Maes H, Agostinis P. ROS-mediated mechanisms of autophagy stimulation and their relevance in cancer therapy. Autophagy. 2010;6:838–54.10.4161/auto.6.7.12113Suche in Google Scholar PubMed

[43] Srinivas US, Tan BWQ, Vellayappan BA, Jeyasekharan AD. ROS and the DNA damage response in cancer. Redox Biol. 2019;25:101084.10.1016/j.redox.2018.101084Suche in Google Scholar PubMed PubMed Central

[44] Marullo R, Werner E, Degtyareva N, Moore B, Altavilla G, Ramalingam SS, et al. Cisplatin induces a mitochondrial-ROS response that contributes to cytotoxicity depending on mitochondrial redox status and bioenergetic functions. PLoS One. 2013;8:e81162.10.1371/journal.pone.0081162Suche in Google Scholar PubMed PubMed Central

[45] Atta MS, Farrag FA, Almadaly EA, Ghoneim HA, Hafez AS, Al Jaouni SK, et al. Transcriptomic and biochemical effects of pycnogenol in ameliorating heat stress-related oxidative alterations in rats. J Therm Biol. 2020;93:102683.10.1016/j.jtherbio.2020.102683Suche in Google Scholar PubMed

[46] Tsai H, Hsu Y, Lu C, Tsai M, Hung W, Chen P, et al. Pharmacological activation of aldehyde dehydrogenase 2 protects against heatstroke-induced acute lung injury by modulating oxidative stress and endothelial dysfunction. Front Immunol. 2021;12:740562.10.3389/fimmu.2021.740562Suche in Google Scholar PubMed PubMed Central

[47] Jastroch M, Divakaruni AS, Mookerjee S, Treberg JR, Brand MD. Mitochondrial proton and electron leaks. Essays Biochem. 2010;47:53–67.10.1042/bse0470053Suche in Google Scholar PubMed PubMed Central

[48] Wang Y, Qi H, Liu Y, Duan C, Liu X, Xia T, et al. The double-edged roles of ROS in cancer prevention and therapy. Theranostics. 2021;11:4839–57.10.7150/thno.56747Suche in Google Scholar PubMed PubMed Central

[49] Mukawera E, Chartier S, Williams V, Pagano PJ, Lapointe R, Grandvaux N. Redox-modulating agents target NOX2-dependent IKKε oncogenic kinase expression and proliferation in human breast cancer cell lines. Redox Biol. 2015;6:9–18.10.1016/j.redox.2015.06.010Suche in Google Scholar PubMed PubMed Central

Received: 2023-07-19
Revised: 2023-11-23
Accepted: 2023-12-15
Published Online: 2024-03-04

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway
  3. STK11 (LKB1) mutation suppresses ferroptosis in lung adenocarcinoma by facilitating monounsaturated fatty acid synthesis
  4. Association of SOX6 gene polymorphisms with Kashin-Beck disease risk in the Chinese Han population
  5. The pyroptosis-related signature predicts prognosis and influences the tumor immune microenvironment in dedifferentiated liposarcoma
  6. METTL3 attenuates ferroptosis sensitivity in lung cancer via modulating TFRC
  7. Identification and validation of molecular subtypes and prognostic signature for stage I and stage II gastric cancer based on neutrophil extracellular traps
  8. Novel lumbar plexus block versus femoral nerve block for analgesia and motor recovery after total knee arthroplasty
  9. Correlation between ABCB1 and OLIG2 polymorphisms and the severity and prognosis of patients with cerebral infarction
  10. Study on the radiotherapy effect and serum neutral granulocyte lymphocyte ratio and inflammatory factor expression of nasopharyngeal carcinoma
  11. Transcriptome analysis of effects of Tecrl deficiency on cardiometabolic and calcium regulation in cardiac tissue
  12. Aflatoxin B1 induces infertility, fetal deformities, and potential therapies
  13. Serum levels of HMW adiponectin and its receptors are associated with cytokine levels and clinical characteristics in chronic obstructive pulmonary disease
  14. METTL3-mediated methylation of CYP2C19 mRNA may aggravate clopidogrel resistance in ischemic stroke patients
  15. Understand how machine learning impact lung cancer research from 2010 to 2021: A bibliometric analysis
  16. Pressure ulcers in German hospitals: Analysis of reimbursement and length of stay
  17. Metformin plus L-carnitine enhances brown/beige adipose tissue activity via Nrf2/HO-1 signaling to reduce lipid accumulation and inflammation in murine obesity
  18. Downregulation of carbonic anhydrase IX expression in mouse xenograft nasopharyngeal carcinoma model via doxorubicin nanobubble combined with ultrasound
  19. Feasibility of 3-dimensional printed models in simulated training and teaching of transcatheter aortic valve replacement
  20. miR-335-3p improves type II diabetes mellitus by IGF-1 regulating macrophage polarization
  21. The analyses of human MCPH1 DNA repair machinery and genetic variations
  22. Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy
  23. Comprehensive analysis based on the disulfidptosis-related genes identifies hub genes and immune infiltration for pancreatic adenocarcinoma
  24. Changes of serum CA125 and PGE2 before and after high-intensity focused ultrasound combined with GnRH-a in treatment of patients with adenomyosis
  25. The clinical value of the hepatic venous pressure gradient in patients undergoing hepatic resection for hepatocellular carcinoma with or without liver cirrhosis
  26. Development and validation of a novel model to predict pulmonary embolism in cardiology suspected patients: A 10-year retrospective analysis
  27. Downregulation of lncRNA XLOC_032768 in diabetic patients predicts the occurrence of diabetic nephropathy
  28. Circ_0051428 targeting miR-885-3p/MMP2 axis enhances the malignancy of cervical cancer
  29. Effectiveness of ginkgo diterpene lactone meglumine on cognitive function in patients with acute ischemic stroke
  30. The construction of a novel prognostic prediction model for glioma based on GWAS-identified prognostic-related risk loci
  31. Evaluating the impact of childhood BMI on the risk of coronavirus disease 2019: A Mendelian randomization study
  32. Lactate dehydrogenase to albumin ratio is associated with in-hospital mortality in patients with acute heart failure: Data from the MIMIC-III database
  33. CD36-mediated podocyte lipotoxicity promotes foot process effacement
  34. Efficacy of etonogestrel subcutaneous implants versus the levonorgestrel-releasing intrauterine system in the conservative treatment of adenomyosis
  35. FLRT2 mediates chondrogenesis of nasal septal cartilage and mandibular condyle cartilage
  36. Challenges in treating primary immune thrombocytopenia patients undergoing COVID-19 vaccination: A retrospective study
  37. Let-7 family regulates HaCaT cell proliferation and apoptosis via the ΔNp63/PI3K/AKT pathway
  38. Phospholipid transfer protein ameliorates sepsis-induced cardiac dysfunction through NLRP3 inflammasome inhibition
  39. Postoperative cognitive dysfunction in elderly patients with colorectal cancer: A randomized controlled study comparing goal-directed and conventional fluid therapy
  40. Long-pulsed ultrasound-mediated microbubble thrombolysis in a rat model of microvascular obstruction
  41. High SEC61A1 expression predicts poor outcome of acute myeloid leukemia
  42. Comparison of polymerase chain reaction and next-generation sequencing with conventional urine culture for the diagnosis of urinary tract infections: A meta-analysis
  43. Secreted frizzled-related protein 5 protects against renal fibrosis by inhibiting Wnt/β-catenin pathway
  44. Pan-cancer and single-cell analysis of actin cytoskeleton genes related to disulfidptosis
  45. Overexpression of miR-532-5p restrains oxidative stress response of chondrocytes in nontraumatic osteonecrosis of the femoral head by inhibiting ABL1
  46. Autologous liver transplantation for unresectable hepatobiliary malignancies in enhanced recovery after surgery model
  47. Clinical analysis of incomplete rupture of the uterus secondary to previous cesarean section
  48. Abnormal sleep duration is associated with sarcopenia in older Chinese people: A large retrospective cross-sectional study
  49. No genetic causality between obesity and benign paroxysmal vertigo: A two-sample Mendelian randomization study
  50. Identification and validation of autophagy-related genes in SSc
  51. Long non-coding RNA SRA1 suppresses radiotherapy resistance in esophageal squamous cell carcinoma by modulating glycolytic reprogramming
  52. Evaluation of quality of life in patients with schizophrenia: An inpatient social welfare institution-based cross-sectional study
  53. The possible role of oxidative stress marker glutathione in the assessment of cognitive impairment in multiple sclerosis
  54. Compilation of a self-management assessment scale for postoperative patients with aortic dissection
  55. Left atrial appendage closure in conjunction with radiofrequency ablation: Effects on left atrial functioning in patients with paroxysmal atrial fibrillation
  56. Effect of anterior femoral cortical notch grade on postoperative function and complications during TKA surgery: A multicenter, retrospective study
  57. Clinical characteristics and assessment of risk factors in patients with influenza A-induced severe pneumonia after the prevalence of SARS-CoV-2
  58. Analgesia nociception index is an indicator of laparoscopic trocar insertion-induced transient nociceptive stimuli
  59. High STAT4 expression correlates with poor prognosis in acute myeloid leukemia and facilitates disease progression by upregulating VEGFA expression
  60. Factors influencing cardiovascular system-related post-COVID-19 sequelae: A single-center cohort study
  61. HOXD10 regulates intestinal permeability and inhibits inflammation of dextran sulfate sodium-induced ulcerative colitis through the inactivation of the Rho/ROCK/MMPs axis
  62. Mesenchymal stem cell-derived exosomal miR-26a induces ferroptosis, suppresses hepatic stellate cell activation, and ameliorates liver fibrosis by modulating SLC7A11
  63. Endovascular thrombectomy versus intravenous thrombolysis for primary distal, medium vessel occlusion in acute ischemic stroke
  64. ANO6 (TMEM16F) inhibits gastrointestinal stromal tumor growth and induces ferroptosis
  65. Prognostic value of EIF5A2 in solid tumors: A meta-analysis and bioinformatics analysis
  66. The role of enhanced expression of Cx43 in patients with ulcerative colitis
  67. Choosing a COVID-19 vaccination site might be driven by anxiety and body vigilance
  68. Role of ICAM-1 in triple-negative breast cancer
  69. Cost-effectiveness of ambroxol in the treatment of Gaucher disease type 2
  70. HLA-DRB5 promotes immune thrombocytopenia via activating CD8+ T cells
  71. Efficacy and factors of myofascial release therapy combined with electrical and magnetic stimulation in the treatment of chronic pelvic pain syndrome
  72. Efficacy of tacrolimus monotherapy in primary membranous nephropathy
  73. Mechanisms of Tripterygium wilfordii Hook F on treating rheumatoid arthritis explored by network pharmacology analysis and molecular docking
  74. FBXO45 levels regulated ferroptosis renal tubular epithelial cells in a model of diabetic nephropathy by PLK1
  75. Optimizing anesthesia strategies to NSCLC patients in VATS procedures: Insights from drug requirements and patient recovery patterns
  76. Alpha-lipoic acid upregulates the PPARγ/NRF2/GPX4 signal pathway to inhibit ferroptosis in the pathogenesis of unexplained recurrent pregnancy loss
  77. Correlation between fat-soluble vitamin levels and inflammatory factors in paediatric community-acquired pneumonia: A prospective study
  78. CD1d affects the proliferation, migration, and apoptosis of human papillary thyroid carcinoma TPC-1 cells via regulating MAPK/NF-κB signaling pathway
  79. miR-let-7a inhibits sympathetic nerve remodeling after myocardial infarction by downregulating the expression of nerve growth factor
  80. Immune response analysis of solid organ transplantation recipients inoculated with inactivated COVID-19 vaccine: A retrospective analysis
  81. The H2Valdien derivatives regulate the epithelial–mesenchymal transition of hepatoma carcinoma cells through the Hedgehog signaling pathway
  82. Clinical efficacy of dexamethasone combined with isoniazid in the treatment of tuberculous meningitis and its effect on peripheral blood T cell subsets
  83. Comparison of short-segment and long-segment fixation in treatment of degenerative scoliosis and analysis of factors associated with adjacent spondylolisthesis
  84. Lycopene inhibits pyroptosis of endothelial progenitor cells induced by ox-LDL through the AMPK/mTOR/NLRP3 pathway
  85. Methylation regulation for FUNDC1 stability in childhood leukemia was up-regulated and facilitates metastasis and reduces ferroptosis of leukemia through mitochondrial damage by FBXL2
  86. Correlation of single-fiber electromyography studies and functional status in patients with amyotrophic lateral sclerosis
  87. Risk factors of postoperative airway obstruction complications in children with oral floor mass
  88. Expression levels and clinical significance of serum miR-19a/CCL20 in patients with acute cerebral infarction
  89. Physical activity and mental health trends in Korean adolescents: Analyzing the impact of the COVID-19 pandemic from 2018 to 2022
  90. Evaluating anemia in HIV-infected patients using chest CT
  91. Ponticulus posticus and skeletal malocclusion: A pilot study in a Southern Italian pre-orthodontic court
  92. Causal association of circulating immune cells and lymphoma: A Mendelian randomization study
  93. Assessment of the renal function and fibrosis indexes of conventional western medicine with Chinese medicine for dredging collaterals on treating renal fibrosis: A systematic review and meta-analysis
  94. Comprehensive landscape of integrator complex subunits and their association with prognosis and tumor microenvironment in gastric cancer
  95. New target-HMGCR inhibitors for the treatment of primary sclerosing cholangitis: A drug Mendelian randomization study
  96. Population pharmacokinetics of meropenem in critically ill patients
  97. Comparison of the ability of newly inflammatory markers to predict complicated appendicitis
  98. Comparative morphology of the cruciate ligaments: A radiological study
  99. Immune landscape of hepatocellular carcinoma: The central role of TP53-inducible glycolysis and apoptosis regulator
  100. Serum SIRT3 levels in epilepsy patients and its association with clinical outcomes and severity: A prospective observational study
  101. SHP-1 mediates cigarette smoke extract-induced epithelial–mesenchymal transformation and inflammation in 16HBE cells
  102. Acute hyper-hypoxia accelerates the development of depression in mice via the IL-6/PGC1α/MFN2 signaling pathway
  103. The GJB3 correlates with the prognosis, immune cell infiltration, and therapeutic responses in lung adenocarcinoma
  104. Physical fitness and blood parameters outcomes of breast cancer survivor in a low-intensity circuit resistance exercise program
  105. Exploring anesthetic-induced gene expression changes and immune cell dynamics in atrial tissue post-coronary artery bypass graft surgery
  106. Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism
  107. Analysis of the risk factors of the radiation-induced encephalopathy in nasopharyngeal carcinoma: A retrospective cohort study
  108. Reproductive outcomes in women with BRCA 1/2 germline mutations: A retrospective observational study and literature review
  109. Evaluation of upper airway ultrasonographic measurements in predicting difficult intubation: A cross-section of the Turkish population
  110. Prognostic and diagnostic value of circulating IGFBP2 in pancreatic cancer
  111. Postural stability after operative reconstruction of the AFTL in chronic ankle instability comparing three different surgical techniques
  112. Research trends related to emergence agitation in the post-anaesthesia care unit from 2001 to 2023: A bibliometric analysis
  113. Frequency and clinicopathological correlation of gastrointestinal polyps: A six-year single center experience
  114. ACSL4 mediates inflammatory bowel disease and contributes to LPS-induced intestinal epithelial cell dysfunction by activating ferroptosis and inflammation
  115. Affibody-based molecular probe 99mTc-(HE)3ZHER2:V2 for non-invasive HER2 detection in ovarian and breast cancer xenografts
  116. Effectiveness of nutritional support for clinical outcomes in gastric cancer patients: A meta-analysis of randomized controlled trials
  117. The relationship between IFN-γ, IL-10, IL-6 cytokines, and severity of the condition with serum zinc and Fe in children infected with Mycoplasma pneumoniae
  118. Paraquat disrupts the blood–brain barrier by increasing IL-6 expression and oxidative stress through the activation of PI3K/AKT signaling pathway
  119. Sleep quality associate with the increased prevalence of cognitive impairment in coronary artery disease patients: A retrospective case–control study
  120. Dioscin protects against chronic prostatitis through the TLR4/NF-κB pathway
  121. Association of polymorphisms in FBN1, MYH11, and TGF-β signaling-related genes with susceptibility of sporadic thoracic aortic aneurysm and dissection in the Zhejiang Han population
  122. Application value of multi-parameter magnetic resonance image-transrectal ultrasound cognitive fusion in prostate biopsy
  123. Laboratory variables‐based artificial neural network models for predicting fatty liver disease: A retrospective study
  124. Decreased BIRC5-206 promotes epithelial–mesenchymal transition in nasopharyngeal carcinoma through sponging miR-145-5p
  125. Sepsis induces the cardiomyocyte apoptosis and cardiac dysfunction through activation of YAP1/Serpine1/caspase-3 pathway
  126. Assessment of iron metabolism and iron deficiency in incident patients on incident continuous ambulatory peritoneal dialysis
  127. Tibial periosteum flap combined with autologous bone grafting in the treatment of Gustilo-IIIB/IIIC open tibial fractures
  128. The application of intravenous general anesthesia under nasopharyngeal airway assisted ventilation undergoing ureteroscopic holmium laser lithotripsy: A prospective, single-center, controlled trial
  129. Long intergenic noncoding RNA for IGF2BP2 stability suppresses gastric cancer cell apoptosis by inhibiting the maturation of microRNA-34a
  130. Role of FOXM1 and AURKB in regulating keratinocyte function in psoriasis
  131. Parental control attitudes over their pre-school children’s diet
  132. The role of auto-HSCT in extranodal natural killer/T cell lymphoma
  133. Significance of negative cervical cytology and positive HPV in the diagnosis of cervical lesions by colposcopy
  134. Echinacoside inhibits PASMCs calcium overload to prevent hypoxic pulmonary artery remodeling by regulating TRPC1/4/6 and calmodulin
  135. ADAR1 plays a protective role in proximal tubular cells under high glucose conditions by attenuating the PI3K/AKT/mTOR signaling pathway
  136. The risk of cancer among insulin glargine users in Lithuania: A retrospective population-based study
  137. The unusual location of primary hydatid cyst: A case series study
  138. Intraoperative changes in electrophysiological monitoring can be used to predict clinical outcomes in patients with spinal cavernous malformation
  139. Obesity and risk of placenta accreta spectrum: A meta-analysis
  140. Shikonin alleviates asthma phenotypes in mice via an airway epithelial STAT3-dependent mechanism
  141. NSUN6 and HTR7 disturbed the stability of carotid atherosclerotic plaques by regulating the immune responses of macrophages
  142. The effect of COVID-19 lockdown on admission rates in Maternity Hospital
  143. Temporal muscle thickness is not a prognostic predictor in patients with high-grade glioma, an experience at two centers in China
  144. Luteolin alleviates cerebral ischemia/reperfusion injury by regulating cell pyroptosis
  145. Therapeutic role of respiratory exercise in patients with tuberculous pleurisy
  146. Effects of CFTR-ENaC on spinal cord edema after spinal cord injury
  147. Irisin-regulated lncRNAs and their potential regulatory functions in chondrogenic differentiation of human mesenchymal stem cells
  148. DMD mutations in pediatric patients with phenotypes of Duchenne/Becker muscular dystrophy
  149. Combination of C-reactive protein and fibrinogen-to-albumin ratio as a novel predictor of all-cause mortality in heart failure patients
  150. Significant role and the underly mechanism of cullin-1 in chronic obstructive pulmonary disease
  151. Ferroptosis-related prognostic model of mantle cell lymphoma
  152. Observation of choking reaction and other related indexes in elderly painless fiberoptic bronchoscopy with transnasal high-flow humidification oxygen therapy
  153. A bibliometric analysis of Prader-Willi syndrome from 2002 to 2022
  154. The causal effects of childhood sunburn occasions on melanoma: A univariable and multivariable Mendelian randomization study
  155. Oxidative stress regulates glycogen synthase kinase-3 in lymphocytes of diabetes mellitus patients complicated with cerebral infarction
  156. Role of COX6C and NDUFB3 in septic shock and stroke
  157. Trends in disease burden of type 2 diabetes, stroke, and hypertensive heart disease attributable to high BMI in China: 1990–2019
  158. Purinergic P2X7 receptor mediates hyperoxia-induced injury in pulmonary microvascular endothelial cells via NLRP3-mediated pyroptotic pathway
  159. Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation
  160. Analgesic effect of external oblique intercostal block in laparoscopic cholecystectomy: A retrospective study
  161. Elevated serum miR-142-5p correlates with ischemic lesions and both NSE and S100β in ischemic stroke patients
  162. Correlation between the mechanism of arteriopathy in IgA nephropathy and blood stasis syndrome: A cohort study
  163. Risk factors for progressive kyphosis after percutaneous kyphoplasty in osteoporotic vertebral compression fracture
  164. Predictive role of neuron-specific enolase and S100-β in early neurological deterioration and unfavorable prognosis in patients with ischemic stroke
  165. The potential risk factors of postoperative cognitive dysfunction for endovascular therapy in acute ischemic stroke with general anesthesia
  166. Fluoxetine inhibited RANKL-induced osteoclastic differentiation in vitro
  167. Detection of serum FOXM1 and IGF2 in patients with ARDS and their correlation with disease and prognosis
  168. Rhein promotes skin wound healing by activating the PI3K/AKT signaling pathway
  169. Differences in mortality risk by levels of physical activity among persons with disabilities in South Korea
  170. Review Articles
  171. Cutaneous signs of selected cardiovascular disorders: A narrative review
  172. XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis
  173. A narrative review on adverse drug reactions of COVID-19 treatments on the kidney
  174. Emerging role and function of SPDL1 in human health and diseases
  175. Adverse reactions of piperacillin: A literature review of case reports
  176. Molecular mechanism and intervention measures of microvascular complications in diabetes
  177. Regulation of mesenchymal stem cell differentiation by autophagy
  178. Molecular landscape of borderline ovarian tumours: A systematic review
  179. Advances in synthetic lethality modalities for glioblastoma multiforme
  180. Investigating hormesis, aging, and neurodegeneration: From bench to clinics
  181. Frankincense: A neuronutrient to approach Parkinson’s disease treatment
  182. Sox9: A potential regulator of cancer stem cells in osteosarcoma
  183. Early detection of cardiovascular risk markers through non-invasive ultrasound methodologies in periodontitis patients
  184. Advanced neuroimaging and criminal interrogation in lie detection
  185. Maternal factors for neural tube defects in offspring: An umbrella review
  186. The chemoprotective hormetic effects of rosmarinic acid
  187. CBD’s potential impact on Parkinson’s disease: An updated overview
  188. Progress in cytokine research for ARDS: A comprehensive review
  189. Utilizing reactive oxygen species-scavenging nanoparticles for targeting oxidative stress in the treatment of ischemic stroke: A review
  190. NRXN1-related disorders, attempt to better define clinical assessment
  191. Lidocaine infusion for the treatment of complex regional pain syndrome: Case series and literature review
  192. Trends and future directions of autophagy in osteosarcoma: A bibliometric analysis
  193. Iron in ventricular remodeling and aneurysms post-myocardial infarction
  194. Case Reports
  195. Sirolimus potentiated angioedema: A case report and review of the literature
  196. Identification of mixed anaerobic infections after inguinal hernia repair based on metagenomic next-generation sequencing: A case report
  197. Successful treatment with bortezomib in combination with dexamethasone in a middle-aged male with idiopathic multicentric Castleman’s disease: A case report
  198. Complete heart block associated with hepatitis A infection in a female child with fatal outcome
  199. Elevation of D-dimer in eosinophilic gastrointestinal diseases in the absence of venous thrombosis: A case series and literature review
  200. Four years of natural progressive course: A rare case report of juvenile Xp11.2 translocations renal cell carcinoma with TFE3 gene fusion
  201. Advancing prenatal diagnosis: Echocardiographic detection of Scimitar syndrome in China – A case series
  202. Outcomes and complications of hemodialysis in patients with renal cancer following bilateral nephrectomy
  203. Anti-HMGCR myopathy mimicking facioscapulohumeral muscular dystrophy
  204. Recurrent opportunistic infections in a HIV-negative patient with combined C6 and NFKB1 mutations: A case report, pedigree analysis, and literature review
  205. Letter to the Editor
  206. Letter to the Editor: Total parenteral nutrition-induced Wernicke’s encephalopathy after oncologic gastrointestinal surgery
  207. Erratum
  208. Erratum to “Bladder-embedded ectopic intrauterine device with calculus”
  209. Retraction
  210. Retraction of “XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis”
  211. Corrigendum
  212. Corrigendum to “Investigating hormesis, aging, and neurodegeneration: From bench to clinics”
  213. Corrigendum to “Frankincense: A neuronutrient to approach Parkinson’s disease treatment”
  214. Special Issue The evolving saga of RNAs from bench to bedside - Part II
  215. Machine-learning-based prediction of a diagnostic model using autophagy-related genes based on RNA sequencing for patients with papillary thyroid carcinoma
  216. Unlocking the future of hepatocellular carcinoma treatment: A comprehensive analysis of disulfidptosis-related lncRNAs for prognosis and drug screening
  217. Elevated mRNA level indicates FSIP1 promotes EMT and gastric cancer progression by regulating fibroblasts in tumor microenvironment
  218. Special Issue Advancements in oncology: bridging clinical and experimental research - Part I
  219. Ultrasound-guided transperineal vs transrectal prostate biopsy: A meta-analysis of diagnostic accuracy and complication rates
  220. Assessment of diagnostic value of unilateral systematic biopsy combined with targeted biopsy in detecting clinically significant prostate cancer
  221. SENP7 inhibits glioblastoma metastasis and invasion by dissociating SUMO2/3 binding to specific target proteins
  222. MARK1 suppress malignant progression of hepatocellular carcinoma and improves sorafenib resistance through negatively regulating POTEE
  223. Analysis of postoperative complications in bladder cancer patients
  224. Carboplatin combined with arsenic trioxide versus carboplatin combined with docetaxel treatment for LACC: A randomized, open-label, phase II clinical study
  225. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part I
  226. Comprehensive pan-cancer investigation of carnosine dipeptidase 1 and its prospective prognostic significance in hepatocellular carcinoma
  227. Identification of signatures associated with microsatellite instability and immune characteristics to predict the prognostic risk of colon cancer
  228. Single-cell analysis identified key macrophage subpopulations associated with atherosclerosis
https://doi.org/10.1515/med-2024-0898
Schlagwörter für diesen Artikel
photothermal therapy; heat stress; Piezo1; breast cancer
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway
  3. STK11 (LKB1) mutation suppresses ferroptosis in lung adenocarcinoma by facilitating monounsaturated fatty acid synthesis
  4. Association of SOX6 gene polymorphisms with Kashin-Beck disease risk in the Chinese Han population
  5. The pyroptosis-related signature predicts prognosis and influences the tumor immune microenvironment in dedifferentiated liposarcoma
  6. METTL3 attenuates ferroptosis sensitivity in lung cancer via modulating TFRC
  7. Identification and validation of molecular subtypes and prognostic signature for stage I and stage II gastric cancer based on neutrophil extracellular traps
  8. Novel lumbar plexus block versus femoral nerve block for analgesia and motor recovery after total knee arthroplasty
  9. Correlation between ABCB1 and OLIG2 polymorphisms and the severity and prognosis of patients with cerebral infarction
  10. Study on the radiotherapy effect and serum neutral granulocyte lymphocyte ratio and inflammatory factor expression of nasopharyngeal carcinoma
  11. Transcriptome analysis of effects of Tecrl deficiency on cardiometabolic and calcium regulation in cardiac tissue
  12. Aflatoxin B1 induces infertility, fetal deformities, and potential therapies
  13. Serum levels of HMW adiponectin and its receptors are associated with cytokine levels and clinical characteristics in chronic obstructive pulmonary disease
  14. METTL3-mediated methylation of CYP2C19 mRNA may aggravate clopidogrel resistance in ischemic stroke patients
  15. Understand how machine learning impact lung cancer research from 2010 to 2021: A bibliometric analysis
  16. Pressure ulcers in German hospitals: Analysis of reimbursement and length of stay
  17. Metformin plus L-carnitine enhances brown/beige adipose tissue activity via Nrf2/HO-1 signaling to reduce lipid accumulation and inflammation in murine obesity
  18. Downregulation of carbonic anhydrase IX expression in mouse xenograft nasopharyngeal carcinoma model via doxorubicin nanobubble combined with ultrasound
  19. Feasibility of 3-dimensional printed models in simulated training and teaching of transcatheter aortic valve replacement
  20. miR-335-3p improves type II diabetes mellitus by IGF-1 regulating macrophage polarization
  21. The analyses of human MCPH1 DNA repair machinery and genetic variations
  22. Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy
  23. Comprehensive analysis based on the disulfidptosis-related genes identifies hub genes and immune infiltration for pancreatic adenocarcinoma
  24. Changes of serum CA125 and PGE2 before and after high-intensity focused ultrasound combined with GnRH-a in treatment of patients with adenomyosis
  25. The clinical value of the hepatic venous pressure gradient in patients undergoing hepatic resection for hepatocellular carcinoma with or without liver cirrhosis
  26. Development and validation of a novel model to predict pulmonary embolism in cardiology suspected patients: A 10-year retrospective analysis
  27. Downregulation of lncRNA XLOC_032768 in diabetic patients predicts the occurrence of diabetic nephropathy
  28. Circ_0051428 targeting miR-885-3p/MMP2 axis enhances the malignancy of cervical cancer
  29. Effectiveness of ginkgo diterpene lactone meglumine on cognitive function in patients with acute ischemic stroke
  30. The construction of a novel prognostic prediction model for glioma based on GWAS-identified prognostic-related risk loci
  31. Evaluating the impact of childhood BMI on the risk of coronavirus disease 2019: A Mendelian randomization study
  32. Lactate dehydrogenase to albumin ratio is associated with in-hospital mortality in patients with acute heart failure: Data from the MIMIC-III database
  33. CD36-mediated podocyte lipotoxicity promotes foot process effacement
  34. Efficacy of etonogestrel subcutaneous implants versus the levonorgestrel-releasing intrauterine system in the conservative treatment of adenomyosis
  35. FLRT2 mediates chondrogenesis of nasal septal cartilage and mandibular condyle cartilage
  36. Challenges in treating primary immune thrombocytopenia patients undergoing COVID-19 vaccination: A retrospective study
  37. Let-7 family regulates HaCaT cell proliferation and apoptosis via the ΔNp63/PI3K/AKT pathway
  38. Phospholipid transfer protein ameliorates sepsis-induced cardiac dysfunction through NLRP3 inflammasome inhibition
  39. Postoperative cognitive dysfunction in elderly patients with colorectal cancer: A randomized controlled study comparing goal-directed and conventional fluid therapy
  40. Long-pulsed ultrasound-mediated microbubble thrombolysis in a rat model of microvascular obstruction
  41. High SEC61A1 expression predicts poor outcome of acute myeloid leukemia
  42. Comparison of polymerase chain reaction and next-generation sequencing with conventional urine culture for the diagnosis of urinary tract infections: A meta-analysis
  43. Secreted frizzled-related protein 5 protects against renal fibrosis by inhibiting Wnt/β-catenin pathway
  44. Pan-cancer and single-cell analysis of actin cytoskeleton genes related to disulfidptosis
  45. Overexpression of miR-532-5p restrains oxidative stress response of chondrocytes in nontraumatic osteonecrosis of the femoral head by inhibiting ABL1
  46. Autologous liver transplantation for unresectable hepatobiliary malignancies in enhanced recovery after surgery model
  47. Clinical analysis of incomplete rupture of the uterus secondary to previous cesarean section
  48. Abnormal sleep duration is associated with sarcopenia in older Chinese people: A large retrospective cross-sectional study
  49. No genetic causality between obesity and benign paroxysmal vertigo: A two-sample Mendelian randomization study
  50. Identification and validation of autophagy-related genes in SSc
  51. Long non-coding RNA SRA1 suppresses radiotherapy resistance in esophageal squamous cell carcinoma by modulating glycolytic reprogramming
  52. Evaluation of quality of life in patients with schizophrenia: An inpatient social welfare institution-based cross-sectional study
  53. The possible role of oxidative stress marker glutathione in the assessment of cognitive impairment in multiple sclerosis
  54. Compilation of a self-management assessment scale for postoperative patients with aortic dissection
  55. Left atrial appendage closure in conjunction with radiofrequency ablation: Effects on left atrial functioning in patients with paroxysmal atrial fibrillation
  56. Effect of anterior femoral cortical notch grade on postoperative function and complications during TKA surgery: A multicenter, retrospective study
  57. Clinical characteristics and assessment of risk factors in patients with influenza A-induced severe pneumonia after the prevalence of SARS-CoV-2
  58. Analgesia nociception index is an indicator of laparoscopic trocar insertion-induced transient nociceptive stimuli
  59. High STAT4 expression correlates with poor prognosis in acute myeloid leukemia and facilitates disease progression by upregulating VEGFA expression
  60. Factors influencing cardiovascular system-related post-COVID-19 sequelae: A single-center cohort study
  61. HOXD10 regulates intestinal permeability and inhibits inflammation of dextran sulfate sodium-induced ulcerative colitis through the inactivation of the Rho/ROCK/MMPs axis
  62. Mesenchymal stem cell-derived exosomal miR-26a induces ferroptosis, suppresses hepatic stellate cell activation, and ameliorates liver fibrosis by modulating SLC7A11
  63. Endovascular thrombectomy versus intravenous thrombolysis for primary distal, medium vessel occlusion in acute ischemic stroke
  64. ANO6 (TMEM16F) inhibits gastrointestinal stromal tumor growth and induces ferroptosis
  65. Prognostic value of EIF5A2 in solid tumors: A meta-analysis and bioinformatics analysis
  66. The role of enhanced expression of Cx43 in patients with ulcerative colitis
  67. Choosing a COVID-19 vaccination site might be driven by anxiety and body vigilance
  68. Role of ICAM-1 in triple-negative breast cancer
  69. Cost-effectiveness of ambroxol in the treatment of Gaucher disease type 2
  70. HLA-DRB5 promotes immune thrombocytopenia via activating CD8+ T cells
  71. Efficacy and factors of myofascial release therapy combined with electrical and magnetic stimulation in the treatment of chronic pelvic pain syndrome
  72. Efficacy of tacrolimus monotherapy in primary membranous nephropathy
  73. Mechanisms of Tripterygium wilfordii Hook F on treating rheumatoid arthritis explored by network pharmacology analysis and molecular docking
  74. FBXO45 levels regulated ferroptosis renal tubular epithelial cells in a model of diabetic nephropathy by PLK1
  75. Optimizing anesthesia strategies to NSCLC patients in VATS procedures: Insights from drug requirements and patient recovery patterns
  76. Alpha-lipoic acid upregulates the PPARγ/NRF2/GPX4 signal pathway to inhibit ferroptosis in the pathogenesis of unexplained recurrent pregnancy loss
  77. Correlation between fat-soluble vitamin levels and inflammatory factors in paediatric community-acquired pneumonia: A prospective study
  78. CD1d affects the proliferation, migration, and apoptosis of human papillary thyroid carcinoma TPC-1 cells via regulating MAPK/NF-κB signaling pathway
  79. miR-let-7a inhibits sympathetic nerve remodeling after myocardial infarction by downregulating the expression of nerve growth factor
  80. Immune response analysis of solid organ transplantation recipients inoculated with inactivated COVID-19 vaccine: A retrospective analysis
  81. The H2Valdien derivatives regulate the epithelial–mesenchymal transition of hepatoma carcinoma cells through the Hedgehog signaling pathway
  82. Clinical efficacy of dexamethasone combined with isoniazid in the treatment of tuberculous meningitis and its effect on peripheral blood T cell subsets
  83. Comparison of short-segment and long-segment fixation in treatment of degenerative scoliosis and analysis of factors associated with adjacent spondylolisthesis
  84. Lycopene inhibits pyroptosis of endothelial progenitor cells induced by ox-LDL through the AMPK/mTOR/NLRP3 pathway
  85. Methylation regulation for FUNDC1 stability in childhood leukemia was up-regulated and facilitates metastasis and reduces ferroptosis of leukemia through mitochondrial damage by FBXL2
  86. Correlation of single-fiber electromyography studies and functional status in patients with amyotrophic lateral sclerosis
  87. Risk factors of postoperative airway obstruction complications in children with oral floor mass
  88. Expression levels and clinical significance of serum miR-19a/CCL20 in patients with acute cerebral infarction
  89. Physical activity and mental health trends in Korean adolescents: Analyzing the impact of the COVID-19 pandemic from 2018 to 2022
  90. Evaluating anemia in HIV-infected patients using chest CT
  91. Ponticulus posticus and skeletal malocclusion: A pilot study in a Southern Italian pre-orthodontic court
  92. Causal association of circulating immune cells and lymphoma: A Mendelian randomization study
  93. Assessment of the renal function and fibrosis indexes of conventional western medicine with Chinese medicine for dredging collaterals on treating renal fibrosis: A systematic review and meta-analysis
  94. Comprehensive landscape of integrator complex subunits and their association with prognosis and tumor microenvironment in gastric cancer
  95. New target-HMGCR inhibitors for the treatment of primary sclerosing cholangitis: A drug Mendelian randomization study
  96. Population pharmacokinetics of meropenem in critically ill patients
  97. Comparison of the ability of newly inflammatory markers to predict complicated appendicitis
  98. Comparative morphology of the cruciate ligaments: A radiological study
  99. Immune landscape of hepatocellular carcinoma: The central role of TP53-inducible glycolysis and apoptosis regulator
  100. Serum SIRT3 levels in epilepsy patients and its association with clinical outcomes and severity: A prospective observational study
  101. SHP-1 mediates cigarette smoke extract-induced epithelial–mesenchymal transformation and inflammation in 16HBE cells
  102. Acute hyper-hypoxia accelerates the development of depression in mice via the IL-6/PGC1α/MFN2 signaling pathway
  103. The GJB3 correlates with the prognosis, immune cell infiltration, and therapeutic responses in lung adenocarcinoma
  104. Physical fitness and blood parameters outcomes of breast cancer survivor in a low-intensity circuit resistance exercise program
  105. Exploring anesthetic-induced gene expression changes and immune cell dynamics in atrial tissue post-coronary artery bypass graft surgery
  106. Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism
  107. Analysis of the risk factors of the radiation-induced encephalopathy in nasopharyngeal carcinoma: A retrospective cohort study
  108. Reproductive outcomes in women with BRCA 1/2 germline mutations: A retrospective observational study and literature review
  109. Evaluation of upper airway ultrasonographic measurements in predicting difficult intubation: A cross-section of the Turkish population
  110. Prognostic and diagnostic value of circulating IGFBP2 in pancreatic cancer
  111. Postural stability after operative reconstruction of the AFTL in chronic ankle instability comparing three different surgical techniques
  112. Research trends related to emergence agitation in the post-anaesthesia care unit from 2001 to 2023: A bibliometric analysis
  113. Frequency and clinicopathological correlation of gastrointestinal polyps: A six-year single center experience
  114. ACSL4 mediates inflammatory bowel disease and contributes to LPS-induced intestinal epithelial cell dysfunction by activating ferroptosis and inflammation
  115. Affibody-based molecular probe 99mTc-(HE)3ZHER2:V2 for non-invasive HER2 detection in ovarian and breast cancer xenografts
  116. Effectiveness of nutritional support for clinical outcomes in gastric cancer patients: A meta-analysis of randomized controlled trials
  117. The relationship between IFN-γ, IL-10, IL-6 cytokines, and severity of the condition with serum zinc and Fe in children infected with Mycoplasma pneumoniae
  118. Paraquat disrupts the blood–brain barrier by increasing IL-6 expression and oxidative stress through the activation of PI3K/AKT signaling pathway
  119. Sleep quality associate with the increased prevalence of cognitive impairment in coronary artery disease patients: A retrospective case–control study
  120. Dioscin protects against chronic prostatitis through the TLR4/NF-κB pathway
  121. Association of polymorphisms in FBN1, MYH11, and TGF-β signaling-related genes with susceptibility of sporadic thoracic aortic aneurysm and dissection in the Zhejiang Han population
  122. Application value of multi-parameter magnetic resonance image-transrectal ultrasound cognitive fusion in prostate biopsy
  123. Laboratory variables‐based artificial neural network models for predicting fatty liver disease: A retrospective study
  124. Decreased BIRC5-206 promotes epithelial–mesenchymal transition in nasopharyngeal carcinoma through sponging miR-145-5p
  125. Sepsis induces the cardiomyocyte apoptosis and cardiac dysfunction through activation of YAP1/Serpine1/caspase-3 pathway
  126. Assessment of iron metabolism and iron deficiency in incident patients on incident continuous ambulatory peritoneal dialysis
  127. Tibial periosteum flap combined with autologous bone grafting in the treatment of Gustilo-IIIB/IIIC open tibial fractures
  128. The application of intravenous general anesthesia under nasopharyngeal airway assisted ventilation undergoing ureteroscopic holmium laser lithotripsy: A prospective, single-center, controlled trial
  129. Long intergenic noncoding RNA for IGF2BP2 stability suppresses gastric cancer cell apoptosis by inhibiting the maturation of microRNA-34a
  130. Role of FOXM1 and AURKB in regulating keratinocyte function in psoriasis
  131. Parental control attitudes over their pre-school children’s diet
  132. The role of auto-HSCT in extranodal natural killer/T cell lymphoma
  133. Significance of negative cervical cytology and positive HPV in the diagnosis of cervical lesions by colposcopy
  134. Echinacoside inhibits PASMCs calcium overload to prevent hypoxic pulmonary artery remodeling by regulating TRPC1/4/6 and calmodulin
  135. ADAR1 plays a protective role in proximal tubular cells under high glucose conditions by attenuating the PI3K/AKT/mTOR signaling pathway
  136. The risk of cancer among insulin glargine users in Lithuania: A retrospective population-based study
  137. The unusual location of primary hydatid cyst: A case series study
  138. Intraoperative changes in electrophysiological monitoring can be used to predict clinical outcomes in patients with spinal cavernous malformation
  139. Obesity and risk of placenta accreta spectrum: A meta-analysis
  140. Shikonin alleviates asthma phenotypes in mice via an airway epithelial STAT3-dependent mechanism
  141. NSUN6 and HTR7 disturbed the stability of carotid atherosclerotic plaques by regulating the immune responses of macrophages
  142. The effect of COVID-19 lockdown on admission rates in Maternity Hospital
  143. Temporal muscle thickness is not a prognostic predictor in patients with high-grade glioma, an experience at two centers in China
  144. Luteolin alleviates cerebral ischemia/reperfusion injury by regulating cell pyroptosis
  145. Therapeutic role of respiratory exercise in patients with tuberculous pleurisy
  146. Effects of CFTR-ENaC on spinal cord edema after spinal cord injury
  147. Irisin-regulated lncRNAs and their potential regulatory functions in chondrogenic differentiation of human mesenchymal stem cells
  148. DMD mutations in pediatric patients with phenotypes of Duchenne/Becker muscular dystrophy
  149. Combination of C-reactive protein and fibrinogen-to-albumin ratio as a novel predictor of all-cause mortality in heart failure patients
  150. Significant role and the underly mechanism of cullin-1 in chronic obstructive pulmonary disease
  151. Ferroptosis-related prognostic model of mantle cell lymphoma
  152. Observation of choking reaction and other related indexes in elderly painless fiberoptic bronchoscopy with transnasal high-flow humidification oxygen therapy
  153. A bibliometric analysis of Prader-Willi syndrome from 2002 to 2022
  154. The causal effects of childhood sunburn occasions on melanoma: A univariable and multivariable Mendelian randomization study
  155. Oxidative stress regulates glycogen synthase kinase-3 in lymphocytes of diabetes mellitus patients complicated with cerebral infarction
  156. Role of COX6C and NDUFB3 in septic shock and stroke
  157. Trends in disease burden of type 2 diabetes, stroke, and hypertensive heart disease attributable to high BMI in China: 1990–2019
  158. Purinergic P2X7 receptor mediates hyperoxia-induced injury in pulmonary microvascular endothelial cells via NLRP3-mediated pyroptotic pathway
  159. Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation
  160. Analgesic effect of external oblique intercostal block in laparoscopic cholecystectomy: A retrospective study
  161. Elevated serum miR-142-5p correlates with ischemic lesions and both NSE and S100β in ischemic stroke patients
  162. Correlation between the mechanism of arteriopathy in IgA nephropathy and blood stasis syndrome: A cohort study
  163. Risk factors for progressive kyphosis after percutaneous kyphoplasty in osteoporotic vertebral compression fracture
  164. Predictive role of neuron-specific enolase and S100-β in early neurological deterioration and unfavorable prognosis in patients with ischemic stroke
  165. The potential risk factors of postoperative cognitive dysfunction for endovascular therapy in acute ischemic stroke with general anesthesia
  166. Fluoxetine inhibited RANKL-induced osteoclastic differentiation in vitro
  167. Detection of serum FOXM1 and IGF2 in patients with ARDS and their correlation with disease and prognosis
  168. Rhein promotes skin wound healing by activating the PI3K/AKT signaling pathway
  169. Differences in mortality risk by levels of physical activity among persons with disabilities in South Korea
  170. Review Articles
  171. Cutaneous signs of selected cardiovascular disorders: A narrative review
  172. XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis
  173. A narrative review on adverse drug reactions of COVID-19 treatments on the kidney
  174. Emerging role and function of SPDL1 in human health and diseases
  175. Adverse reactions of piperacillin: A literature review of case reports
  176. Molecular mechanism and intervention measures of microvascular complications in diabetes
  177. Regulation of mesenchymal stem cell differentiation by autophagy
  178. Molecular landscape of borderline ovarian tumours: A systematic review
  179. Advances in synthetic lethality modalities for glioblastoma multiforme
  180. Investigating hormesis, aging, and neurodegeneration: From bench to clinics
  181. Frankincense: A neuronutrient to approach Parkinson’s disease treatment
  182. Sox9: A potential regulator of cancer stem cells in osteosarcoma
  183. Early detection of cardiovascular risk markers through non-invasive ultrasound methodologies in periodontitis patients
  184. Advanced neuroimaging and criminal interrogation in lie detection
  185. Maternal factors for neural tube defects in offspring: An umbrella review
  186. The chemoprotective hormetic effects of rosmarinic acid
  187. CBD’s potential impact on Parkinson’s disease: An updated overview
  188. Progress in cytokine research for ARDS: A comprehensive review
  189. Utilizing reactive oxygen species-scavenging nanoparticles for targeting oxidative stress in the treatment of ischemic stroke: A review
  190. NRXN1-related disorders, attempt to better define clinical assessment
  191. Lidocaine infusion for the treatment of complex regional pain syndrome: Case series and literature review
  192. Trends and future directions of autophagy in osteosarcoma: A bibliometric analysis
  193. Iron in ventricular remodeling and aneurysms post-myocardial infarction
  194. Case Reports
  195. Sirolimus potentiated angioedema: A case report and review of the literature
  196. Identification of mixed anaerobic infections after inguinal hernia repair based on metagenomic next-generation sequencing: A case report
  197. Successful treatment with bortezomib in combination with dexamethasone in a middle-aged male with idiopathic multicentric Castleman’s disease: A case report
  198. Complete heart block associated with hepatitis A infection in a female child with fatal outcome
  199. Elevation of D-dimer in eosinophilic gastrointestinal diseases in the absence of venous thrombosis: A case series and literature review
  200. Four years of natural progressive course: A rare case report of juvenile Xp11.2 translocations renal cell carcinoma with TFE3 gene fusion
  201. Advancing prenatal diagnosis: Echocardiographic detection of Scimitar syndrome in China – A case series
  202. Outcomes and complications of hemodialysis in patients with renal cancer following bilateral nephrectomy
  203. Anti-HMGCR myopathy mimicking facioscapulohumeral muscular dystrophy
  204. Recurrent opportunistic infections in a HIV-negative patient with combined C6 and NFKB1 mutations: A case report, pedigree analysis, and literature review
  205. Letter to the Editor
  206. Letter to the Editor: Total parenteral nutrition-induced Wernicke’s encephalopathy after oncologic gastrointestinal surgery
  207. Erratum
  208. Erratum to “Bladder-embedded ectopic intrauterine device with calculus”
  209. Retraction
  210. Retraction of “XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis”
  211. Corrigendum
  212. Corrigendum to “Investigating hormesis, aging, and neurodegeneration: From bench to clinics”
  213. Corrigendum to “Frankincense: A neuronutrient to approach Parkinson’s disease treatment”
  214. Special Issue The evolving saga of RNAs from bench to bedside - Part II
  215. Machine-learning-based prediction of a diagnostic model using autophagy-related genes based on RNA sequencing for patients with papillary thyroid carcinoma
  216. Unlocking the future of hepatocellular carcinoma treatment: A comprehensive analysis of disulfidptosis-related lncRNAs for prognosis and drug screening
  217. Elevated mRNA level indicates FSIP1 promotes EMT and gastric cancer progression by regulating fibroblasts in tumor microenvironment
  218. Special Issue Advancements in oncology: bridging clinical and experimental research - Part I
  219. Ultrasound-guided transperineal vs transrectal prostate biopsy: A meta-analysis of diagnostic accuracy and complication rates
  220. Assessment of diagnostic value of unilateral systematic biopsy combined with targeted biopsy in detecting clinically significant prostate cancer
  221. SENP7 inhibits glioblastoma metastasis and invasion by dissociating SUMO2/3 binding to specific target proteins
  222. MARK1 suppress malignant progression of hepatocellular carcinoma and improves sorafenib resistance through negatively regulating POTEE
  223. Analysis of postoperative complications in bladder cancer patients
  224. Carboplatin combined with arsenic trioxide versus carboplatin combined with docetaxel treatment for LACC: A randomized, open-label, phase II clinical study
  225. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part I
  226. Comprehensive pan-cancer investigation of carnosine dipeptidase 1 and its prospective prognostic significance in hepatocellular carcinoma
  227. Identification of signatures associated with microsatellite instability and immune characteristics to predict the prognostic risk of colon cancer
  228. Single-cell analysis identified key macrophage subpopulations associated with atherosclerosis
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 5.11.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2024-0898/html?lang=de
Button zum nach oben scrollen