Home Medicine EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway
Article Open Access

EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway

  • Xun Li , Bide Liu , Shuheng Wang , Qiang Dong and Jiuzhi Li EMAIL logo
Published/Copyright: January 4, 2024
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 19 Issue 1

Abstract

Prostate cancer (PCa) represents a substantial global health concern and a prominent contributor to male cancer-related mortality. The aim of this study is to explore the role of B-type endothelin receptor (EDNRB) in PCa and evaluate its therapeutic potential. The investigation employed predictive methodologies encompassing data acquisition from the GEO and TCGA databases, gene screening, enrichment analysis, in vitro experiments involving PCR, Western blotting, wound healing, and Transwell assays, as well as animal experiments. Analysis revealed a significant downregulation of EDNRB expression in PCa cells. Overexpression of EDNRB demonstrated inhibitory effects on tumor cell growth, migration, and invasion, likely mediated through activation of the cGMP-Protein Kinase G pathway. In vivo experiments further confirmed the tumor-suppressive properties of EDNRB overexpression. These findings underscore the prospect of EDNRB as a therapeutic target for PCa, offering novel avenues for PCa treatment strategies.

Keywords: prostate cancer; B-type endothelin receptor; cGMP-PKG; GEO; cancer

1 Introduction

Prostate cancer (PCa) is a significant global health concern and a leading cause of cancer-related mortality. Despite extensive research efforts, the prognosis for advanced PCa remains worrisome due to limited sensitive biomarkers for early detection and effective treatment. Therefore, there is an urgent need to explore the molecular mechanisms underlying PCa and identify novel biomarkers for early diagnosis and treatment [1,2].

Protein Kinase G (PKG) serves as a major cGMP second messenger receptor, modulating intracellular signaling pathways involved in cell differentiation, platelet activation, memory formation, and vasodilation. PKG1 exhibits tumor suppressor properties, while cGMP-dependent PKG2 has been reported to inhibit the proliferation of certain cancer cells, including glioma cells, and promote apoptosis in breast cancer cells. Activation of the cGMP-PKG pathway has demonstrated inhibitory effects on proliferation, migration, and invasion of PCa cells [3,4].

Additionally, our research focuses on B-type endothelin receptor (EDNRB). The EDNRB gene, located on chromosome 13 q22 with GenBank ID 1910, spans approximately 24 kb and comprises 7 exons and 6 introns. Its promoter region contains a CpG island that may undergo hypermethylation-induced inactivation. EDNRB is a member of the G protein-coupled receptor family, transmitting extracellular signals through binding to the ligand endothelin. During embryonic development, EDNRB plays a crucial role in the migration and differentiation of neural crest cells, which is relevant to Hirschsprung’s disease. Studies have revealed associations between hypermethylation of the EDNRB gene promoter and various tumors, often accompanied by decreased EDNRB gene expression. Notably, EDNRB has been found to inhibit proliferation and migration in lung cancer cell line H1299, exhibit lower expression levels in hepatocellular carcinoma compared to adjacent tissues, and its hypermethylation reduces expression in oral squamous cell carcinoma lesions. Conversely, re-expression of EDNRB can alleviate cancer-induced pain [5,6,7].

Despite these findings, the role of EDNRB in PCa and its underlying mechanisms require further elucidation. The advancements in chip technology and high-throughput sequencing have significantly contributed to cancer research, enabling the identification of biomarkers for cancer diagnosis, treatment, and prognosis. Integrating bioinformatics methods [8], coupled with data mining across multiple databases, offers a robust and accurate analysis by leveraging a larger pool of clinical samples. These innovative bioinformatics techniques hold substantial potential for advancing cancer biomarker research [9]. Thus, our study aims to leverage these approaches, combining bioinformatics analysis and in vitro experimental verification, to unravel the role of EDNRB in PCa and provide new insights for diagnosis and treatment strategies.

2 Methods

2.1 Data acquisition and differential gene screening

The expression profile of PCa-related data was retrieved from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). The study included the microarray dataset (GSE69223), consisting of 15 PCa patients and 30 matched malignant and non-malignant prostate tissue samples. Differential mRNA expression was analyzed using the R packages Limma and ggord, with adjusted P values (<0.05) and log2 fold change thresholds (>1 or <−1) applied. Expression heatmaps were generated using the R package pheatmap, and Venn diagrams were created using ggVennDiagram. The differentially expressed genes obtained were compared with those identified in the TCGA database for PCa.

2.2 KEGG enrichment analysis of DEGs

Enrichr, a comprehensive tool for genome enrichment analysis (available at http://amp.pharm.mssm.edu/Enrichr/), was utilized to conduct biological pathway analysis on differentially expressed genes using the KEGG pathway database. The top ten pathways with significant enrichment were visualized and downloaded directly from the online platform.

2.3 Gene expression analysis

The Gene Expression Profiling Interactive Analysis (GEPIA) database, available at http://gepia.cancer-pku.cn/detail.php, encompasses RNA-sequencing data from 8,587 normal samples and 9,736 tumor samples obtained from the Genotype-Tissue Expression Dataset Project and TCGA Expression data. In this study, we utilized the GEPIA database to examine the expression of the EDNRB gene in PCa samples compared to normal controls.

2.4 Cell culture

The human PCa cell lines PC3, DU145, LNCaP, and 22Rv2, as well as the normal prostate epithelial cell line RWPE-1, were procured from the Cell Resource Center, Peking Union Medical College. The specified cell culture mediums for each cell line were as follows: PC3 and DU145 were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% fetal bovine serum (FBS); 22RV2 and LNCap cells were cultured in Roswell Park Memorial Institute (RPMI) medium with 10% FBS. The normal RWPE cell lines were grown in keratinocyte-free serum medium supplemented with bovine pituitary extract and recombinant epidermal growth factor. All cells were maintained in a humidified incubator at 37°C with 5% CO2. Experiments were conducted within the first five passages after culture initiation. Cells were cultured in T-175 flasks with 30 ml of their respective media until reaching 70% confluency for subsequent harvesting or passaging.

For the analysis of EDNRB mRNA and protein expression, the cells were grouped as RWPE-1, LNCap, 22RV2, DU145, and PC-3. When studying the effect of EDNRB, DU145 and PC-3 cells were utilized, and the groups consisted of a control group, a transfection vector group, and an EDNRB overexpression group. For investigating the effect of EDNRB on signaling pathways, the groups were divided into a control group, an EDNRB overexpression group, and an EDNRB overexpression combined with (D)-DT-2 (PKG inhibitor) group. Finally, the animal experiments included a vector transfection group and an EDNRB overexpression group.

2.5 Animals

The animal experiments conducted in this study were granted ethical approval by the ethics committee of People’s Hospital of Xinjiang Uygur Autonomous Region. A total of 40 male BALB/c nude mice, aged 4–6 weeks and weighing 20–25 g, were used in the study. The mice were housed in a specific pathogen-free environment that included individually ventilated cages and an isolator module. To initiate the study, the treated PCa cells (1 × 106) were injected into the axilla of the mice. Subsequently, PC-3 cells, PC-3 cells transfected with a vector, or PC-3 cells overexpressing EDNRB were subcutaneously injected into the BALB/c nude mice. The BALB/c nude mice injected with PC-3 cells served as negative controls. Tumor volumes were regularly monitored and measured for up to 24 days, while tumor weights were assessed upon euthanizing the mice.

2.6 Cell transfection

Plasmid vectors were constructed by Hanbio (Shanghai, China), and the pcDNA3.1 vector was used to insert the human EDNRB cDNA. Transfection was carried out using Lipofectamine 2,000 (Invitrogen, USA) following the manufacturer’s protocol. Prior to transduction, MSCs were seeded at a density of 1 × 105 cells per well in 12-well plates. The medium (500 μl/well) was then replaced with fresh serum-free DMEM medium. For each transduction, a viral vector (approximately 2.5 μl) was pre-mixed with 20 μl of HiTransGP transfection reagent (Genechem) and added to each well to achieve a multiplicity of infection of 50. After 12 h of transfection, the medium was replaced with DMEM containing 10% FBS. Following a 48 h incubation period, cells were observed under a fluorescent microscope to identify GFP + cells. Successfully transfected cells were selected using puromycin.

2.7 Polymerase chain reaction

Total RNA was extracted from cells using an Agbio RNA extraction kit (Hunan, China). Subsequently, cDNA synthesis was performed using a kit from Agbio (Hunan, China) with 1 μg of total RNA as the template. Quantitative PCR was conducted on a 7,500 ABI system using 1× SYBR reagent (Applied Biosystems) to measure the transcript level of EDNRB. The primer sequences used were as follows: EDNRB (forward: GGCTCCTACTATCCTGGTTCTG, reverse: CAAGGCAAGCATAACACCAGTGC) and β-actin (forward: GGCTCCTACTATCCTGGTTCTG, reverse: CAAGGCAAGCATAACACCAGTGC).

2.8 Western blot (WB)

The protein expression of EDNRB was evaluated using WB analysis. Briefly, 30 μg of total protein was loaded onto SDS-polyacrylamide gels (4–15%; Bio-Rad) and subsequently transferred to PVDF membranes (Bio-Rad). The membranes were then incubated overnight at 4°C with a 5% blocking solution (2.5 g nonfat dry milk in Tris buffer containing 0.1% Tween, TBST). Following this, the membranes were probed with rabbit polyclonal antibodies against EDNRB (Proteintech, Cat No. 20964-1-AP, 1:1,000), PKG1 (Proteintech, Cat No. 21646-1-AP, 1:500), PKG2 (Proteintech, Cat No. 55138-1-AP, 1:500), and β-actin (Proteintech, Cat No. 81115-1-RR, 1:500) for 1 h at room temperature. Subsequently, the membranes were washed six times with TBST (three 15 min washes followed by three 5 min washes) and then incubated with a goat anti-rabbit secondary antibody conjugated to alkaline phosphatase (Proteintech, Cat No. SA00001-2, 1:3,000) or a goat anti-mouse secondary antibody conjugated to alkaline phosphatase (Proteintech, Cat No. SA00001-1, 1:3,000) for 1 h at room temperature. After washing with TBST, the proteins were visualized using an ECL detection reagent (Lablead, Beijing, China). The expression of β-actin served as an internal control.

2.9 Cell counting kit (CCK)-8 assay

The number of viable cells was determined using the CCK-8 assay (Solarbio, Beijing, China). A cell suspension was inoculated into a 96-well plate at a density of 2 × 103 cells per well and pre-incubated for 24 h after transfection. Treated and untreated cells were cultured accordingly. Subsequently, 10 µl of CCK-8 solution was added to each well, and the cells were incubated at 37°C for 2 h. The absorbance at 450 nm was measured using a TECAN Infinite M200 multimode microplate reader (Tecan, Mechelen, Belgium).

2.10 Cell migration and invasion assays

The constructed vector and EDNRB vector group cells were seeded at a density of 1 × 105 cells per well in 24-well culture plates and incubated at 37°C with 5% CO2 for 24 h. After removing the media, the cell surface was gently scratched using a 10 μl pipette tip. The cells were washed twice with PBS and then 1 ml of RPMI 1640 medium was added. Scratch images were captured at 0 and 24 h. The experiment was performed in triplicate and repeated three times. The distance of cell migration into the wound area during this period was measured.

Cell invasiveness was assessed using Transwell chambers with an 8 µm pore size (Corning, USA). Cells (5–7 × 104 cells per chamber) were seeded into the upper chamber in 200 µl of serum-free medium. The lower chamber was filled with 600 μl of DMEM or RPMI 1640 supplemented with 10% FBS. Matrigel (Corning, USA) was added to the upper chamber as in the cell invasion assay. After 48 h of culture, cells were fixed with 4% paraformaldehyde for 30 min, followed by staining with 0.1% crystal violet (Beyotime, Shanghai, China) for another 30 min. Non-invaded cells on the upper surface of the membrane were removed using a damp cotton swab. Stained cells that migrated or invaded the membrane were photographed under an inverted microscope at 10× magnification, and counts were performed in five randomly selected areas.

2.11 Colony formation assay

Cells were seeded at a density of 5 × 10² cells per well in triplicate on six-well plates. The cells were cultured for 12 days with medium changes performed every 4 days. At the end of the 12 days period, colonies were fixed using ice-cold 100% methanol for 20 min, followed by staining with 0.1% crystal violet at room temperature for 20 min. Subsequently, the plates were washed for 10 min in a room temperature water bath and air dried overnight. Quantification of colony formation was performed by calculating the percentage of area covered per well.

2.12 Ki-67 staining

The mouse tumor tissue sections were subjected to deparaffinization and rehydration using an ethanol gradient. Subsequently, these sections were treated with an anti-Ki-67 antibody (Proteintech, Cat No: 27309-1-AP, 1:3,000). Following PBS washes, the paraffin sections were exposed to a secondary antibody, specifically goat anti-rabbit. Hematoxylin was employed as a counterstain, and the expression of Ki-67 was examined under an optical microscope. For analysis, ten fields per section were captured.

2.13 Statistical analysis

All experiments were conducted in triplicate, and the results are presented as the mean value and standard deviation. Prior to employing GraphPad Prism 8 (GraphPad, La Jolla, CA) for data analysis and graphical representation, we initially conducted normality and variance homogeneity tests to ascertain whether the data distribution and variance fulfilled the assumptions necessary for one-way analysis of variance (ANOVA) and the t-test hypothesis. Subsequently, ANOVA or t-test was conducted to determine if there existed a significant disparity in the mean values among the groups. In cases where a significant difference was observed, Tukey’s post hoc test was subsequently utilized to accurately identify the specific groups between which the differences occurred. For all tests, a significance level of P < 0.05 was employed, and any result with a P value lower than 0.05 was considered statistically significant.

  1. Ethics approval: Ethical approval was obtained from the Ethics Committee of People’s Hospital of Xinjiang Uygur Autonomous Region.

3 Results

3.1 Differentially expressed gene profile in PCa

From the GSE69223 profile from GEO, 1,041 differential genes were identified (Figure 1a), and the volcano map and heat map were created using R language (Figure 1b). After comparing these genes with differentially expressed genes of PCa in the TCGA database, 414 intersection genes were found (Figure 1c). KEGG pathway enrichment analysis revealed cGMP-PKG and Wnt as the primarily enriched pathway (Figure 2a–c). Given cGMP-PKG pathway’s reported role in inhibiting PCa cells’ proliferation, migration, and invasion, it was chosen for further study. The gene expression enriched in this signaling pathway is listed in Table 1. Prognostic impacts of the gene expressions in this pathway were examined using the GEPIA database, revealing the EDNRB gene’s correlation with prostate patient survival (Figure 3a–i).

Figure 1 The differential gene results of GSE69223 expression profile mining and the intersection results with TCGA. (a) Volcano map of differential genes. (b) Heat map. (c) The result of the intersection of the differential genes of the two databases is displayed in a Venn diagram.
Figure 1

The differential gene results of GSE69223 expression profile mining and the intersection results with TCGA. (a) Volcano map of differential genes. (b) Heat map. (c) The result of the intersection of the differential genes of the two databases is displayed in a Venn diagram.

Figure 2 The result of enriching differential genes through Enrichr’s KEGG. (a) Enrichr results, showing the top ten enriched pathways. (b) KEGG enriched pathway status bar graph. (c) Bubble graph.
Figure 2

The result of enriching differential genes through Enrichr’s KEGG. (a) Enrichr results, showing the top ten enriched pathways. (b) KEGG enriched pathway status bar graph. (c) Bubble graph.

Table 1

Genes enriched in the cGMP-PKG signaling pathway

Pathway Gene Annotation
cGMP–PKG ADRA1A Adrenoceptor alpha 1A, involved in smooth muscle contraction and cell proliferation regulation
SLC8A1 Solute carrier family 8 member A1, crucial for calcium transport and cellular homeostasis
EDNRB Endothelin Receptor Type-B, plays a role in vasoconstriction and cell proliferation, a focus in PCa
ATP1A2 ATPase Na+/K+ transporting subunit alpha 2, maintains electrochemical gradients for muscle and nerve function
KCNJ8 Potassium channel involved in regulating vascular tone and potassium ion transport
CREB3L4 Transcription factor influencing cell growth and survival
PRKG1 Protein kinase cGMP-dependent 1, phosphorylates proteins, involved in smooth muscle relaxation
PDE5A Phosphodiesterase 5A, regulates cGMP breakdown and signaling intensity
MYH6 Myosin Heavy Chain 6, part of the cardiac muscle contractile apparatus
PLN Phospholamban, regulates the cardiac muscle cell calcium pump
NPPC Natriuretic Peptide C, involved in blood pressure reduction and may influence PCa progression

Note: cGMP-PKG, cGMP-dependent protein kinase (PKG) signaling pathway; ADRA1A, adrenoceptor alpha 1A; SLC8A1, solute carrier family 8 member A1; EDNRB, Endothelin Receptor Type B; ATP1A2, ATPase Na+/K+ transporting subunit alpha 2; KCNJ8, Potassium inwardly rectifying channel subfamily J member 8; CREB3L4, Cyclic AMP-responsive element-binding protein 3-like protein 4; PRKG1, PRKG1 protein kinase cGMP-dependent 1; PDE5A, Phosphodiesterase 5A; MYH6, Myosin Heavy Chain 6; PLN, Phospholamban; NPPC, Natriuretic Peptide C.

Figure 3 Survival analysis results of genes in the cGMP-PKG pathway and PCa prognosis: (a) ADRA1A. (b) SLC8A1. (c) EDNRB1. (d) ATP1A2. (e) KCNJ8. (f) CREB3L4. (g) PRKG1. (h) PDE5A. (i) MYH6. (j) PLN. (k) NPPC.
Figure 3

Survival analysis results of genes in the cGMP-PKG pathway and PCa prognosis: (a) ADRA1A. (b) SLC8A1. (c) EDNRB1. (d) ATP1A2. (e) KCNJ8. (f) CREB3L4. (g) PRKG1. (h) PDE5A. (i) MYH6. (j) PLN. (k) NPPC.

3.2 Expression analysis of EDNRB gene in PCa

To validate the findings from the previous analysis, the role of the EDNRB gene in PCa was investigated using PCR and WB techniques. The results of PCR and WB experiments demonstrated consistent findings, indicating that the mRNA and protein expression levels of the EDNRB gene were significantly reduced in LNCap, DU145, PC-3, and 22RV2 cells compared to RWPE-1 cells (Figure 4a and b). These preliminary results suggest that the EDNRB gene is expressed at lower levels in PCa cells.

Figure 4 EDNRB1 expression in RWPE-1 human normal prostate epithelial cells, PCa cell lines LNCap, DU145, PC-3, and 22RV2. (a) PCR result and (b) WB result. N = 3, ***p < 0.001 vs the RWPE-1 cell group.
Figure 4

EDNRB1 expression in RWPE-1 human normal prostate epithelial cells, PCa cell lines LNCap, DU145, PC-3, and 22RV2. (a) PCR result and (b) WB result. N = 3, ***p < 0.001 vs the RWPE-1 cell group.

3.3 EDNRB gene inhibits PCa cell growth

The DU145 and PC-3 cells were selected to evaluate the impact of the EDNRB gene on the growth of PCa cells. EDNRB overexpression significantly increased EDNRB protein levels which suggests a high efficiency of overexpression, whereas vector transfection did not alter the expression level of EDNRB (Figure 5a). Cell viability was notably lower in the EDNRB overexpression group, with no such difference between the control and vector groups (Figure 5b). Colony formation experiments showed fewer colonies in the EDNRB overexpression group (Figure 5c). These results suggest that high EDNRB expression inhibits PCa cell growth.

Figure 5 Effects of EDNRB1 overexpression on cell viability and colony formation ability of DU145 and PC-3 cells. (a) EDNRB1 protein expression level. (b) Cell viability changes at 24, 48, 72, and 96 h. (c) Cell clone proliferation. N = 3, **p < 0.01 and ***p < 0.001 vs the vector group.
Figure 5

Effects of EDNRB1 overexpression on cell viability and colony formation ability of DU145 and PC-3 cells. (a) EDNRB1 protein expression level. (b) Cell viability changes at 24, 48, 72, and 96 h. (c) Cell clone proliferation. N = 3, **p < 0.01 and ***p < 0.001 vs the vector group.

3.4 EDNRB inhibits PCa cell migration and invasion

To evaluate the migration ability, we performed a scratch test on PCa cells. The results indicated that there was no noteworthy difference in the ratio of migrating cells between the vector group and the control group. However, when comparing the EDNRB overexpression group to the vector group, a significant decrease in the ratio of migrating cells was observed (Figure 6a). Similarly, the Transwell assay results consistently demonstrated that the overexpression of EDNRB significantly diminished the invasion ability of the cells (Figure 6b). These findings collectively suggest that the high expression of the EDNRB gene hampers both the migration and invasion capabilities of PCa cells.

Figure 6 Effects of overexpression of EDNRB1 on the migration and invasion of DU145 and PC-3 cells. (a) The results of cell migration detected by wound healing assay within 24 h. (b) The situation of cell invasion detected by Transwell assay. N = 3, **p < 0.01 and ***p < 0.001 vs the vector group.
Figure 6

Effects of overexpression of EDNRB1 on the migration and invasion of DU145 and PC-3 cells. (a) The results of cell migration detected by wound healing assay within 24 h. (b) The situation of cell invasion detected by Transwell assay. N = 3, **p < 0.01 and ***p < 0.001 vs the vector group.

3.5 EDNRB inhibits the growth of PCa cells by activating the cGMP-PKG pathway

The effect of EDNRB on cGMP/PKG pathway was examined using WB. The results demonstrated no difference in PKG1 and PKG2 protein levels between the control and vector groups, but a significant increase was observed in the EDNRB overexpression group. This increase was suppressed by the PKG inhibitor (D)-DT-2, validating its effectiveness. EDNRB overexpression decreased PCa cell viability, but it increased with the introduction of inhibitors (Figure 7b).

Figure 7 Regulatory effect of EDNRB1 overexpression on cGMP-PKG pathway. (a) Protein expression of PKG1 and PKG2. (b) Protein expression of PKG1 and PKG2 after introducing PKG inhibitor. (c) Cell viability after introducing PKG inhibitor changes over time. (d) The migration of cells within 24 h after the introduction of PKG inhibitors. (e) The invasion of cells after the introduction of PKG inhibitors. N = 3, **p < 0.01 and ***p < 0.001 vs the vector group; ## p < 0.01 and ### p < 0.001 vs the EDNRB1 group.
Figure 7

Regulatory effect of EDNRB1 overexpression on cGMP-PKG pathway. (a) Protein expression of PKG1 and PKG2. (b) Protein expression of PKG1 and PKG2 after introducing PKG inhibitor. (c) Cell viability after introducing PKG inhibitor changes over time. (d) The migration of cells within 24 h after the introduction of PKG inhibitors. (e) The invasion of cells after the introduction of PKG inhibitors. N = 3, **p < 0.01 and ***p < 0.001 vs the vector group; ## p < 0.01 and ### p < 0.001 vs the EDNRB1 group.

Subsequently, we assessed the impact on the growth and colony formation ability of PCa cells. The results showed that, relative to the vector group, EDNRB overexpression decreased cell viability (Figure 7c) and colony formation (Figure 7d and e) but were restored by the inhibitors. These results suggested that EDNRB may inhibit PCa cell growth by activating the cGMP-PKG pathway.

3.6 EDNRB inhibits tumor growth in vivo

A PCa model was established in Balb/c nude mice. and EDNRB overexpression resulted in significant differences in tumor size, volume, and mass compared to the control group (Figure 8a). WB analysis showed increased EDNRB, PKG1, and PKG2 protein levels in the EDNRB overexpression group (Figure 8b). Immunohistochemistry results displayed reduced ki-67 staining in this group, indicating less tumor growth (Figure 8c). These results validate the inhibitory effect of EDNRB on tumor growth in vivo.

Figure 8 After constructing Balb/c nude mice, the effect of overexpression of EDNRB1 on PCa was detected. (a) Measurement of tumor size, volume, and mass every 4 days. (b) Protein expression of EDNRB1, PKG1, and PKG2 after overexpression of EDNRB1. (c) Ki-67 staining results of tumor sections shown by immunohistochemistry. N = 6, ***p < 0.001 vs the vector group.
Figure 8

After constructing Balb/c nude mice, the effect of overexpression of EDNRB1 on PCa was detected. (a) Measurement of tumor size, volume, and mass every 4 days. (b) Protein expression of EDNRB1, PKG1, and PKG2 after overexpression of EDNRB1. (c) Ki-67 staining results of tumor sections shown by immunohistochemistry. N = 6, ***p < 0.001 vs the vector group.

4 Discussion

PCa is a highly prevalent malignant tumor in men, ranking second only to lung cancer in terms of incidence [10]. It poses a significant threat to men’s health, characterized by inconspicuous symptoms and often detected in advanced stages, thereby complicating disease management and control [11]. Despite the relatively high survival rate associated with early detection and treatment of PCa, many patients receive diagnoses only when they have already reached an advanced stage due to the subtle nature of early symptoms. Furthermore, PCa exhibits rapid progression upon relapse [12]. While several treatment options, such as new endocrine therapies, immunotherapy, and chemotherapy, are available for advanced PCa, none of these approaches offer long-term effectiveness in altering the disease’s ultimate outcome – death. Hence, it is of utmost importance to conduct comprehensive research and exploration in the field of PCa. This entails the identification of differentially expressed genes serving as biomarkers, the development of new therapeutic strategies and drug targets, and the enhancement of early diagnosis, disease prognosis, and patients’ quality of life.

Through an extensive analysis of public databases, our study successfully identified 414 differentially expressed genes associated with PCa, which potentially play crucial roles in its occurrence, development, and metastasis. Notably, we observed a significant downregulation of the EDNRB gene in PCa, suggesting its potential involvement in the initiation and progression of the disease. EDNRB encodes endothelin receptor B, a protein that exerts significant influence on various physiological processes like vasodilation and cardiomyocyte proliferation [13]. Altered expression of EDNRB in cancer profoundly impacts tumor cell proliferation, migration, and invasion. Inactivation of EDNRB has been identified as a pivotal factor in the development of certain cancer types, including melanoma and gastric cancer [6]. Numerous studies have established a close association between aberrant expression of the EDNRB gene and cancer occurrence, development, and prognosis, underscoring its importance in cancer biology. Previous research has elucidated the crucial inhibitory role of EDNRB in other cancer types [14]. Existing literature suggests an association between EDNRB downregulation and DNA methylation. For example, disruption of the endothelial axis in endometrial cancer was found by Nikola et al. The observed silencing of EDN3 activity may be primarily due to DNA methylation [15]. Aberrant epigenetic methylation alterations of EDNRB expression play an important role in the pathogenesis of hepatocellular carcinoma [16] and gastric cancer [17]. These studies have explored this relationship in different cancer types. We believe that future studies would benefit from a more comprehensive analysis that includes DNA methylation status. However, its specific function and molecular mechanisms in PCa remain elusive, necessitating further investigation.

Our study revealed that EDNRB may regulate the behavior of PCa cells by modulating the cGMP-PKG signaling pathway. This pathway plays a vital role in diverse physiological and pathological processes, encompassing cell proliferation, migration, and invasion. Its significance has been established in various cancer types [18]. For instance, studies have demonstrated that the activated cGMP-PKG pathway synergistically regulates the proliferation, migration, and invasion of PCa cells. In Helicobacter pylori infection, activation of the cGMP/PKG signaling pathway leads to the occurrence and development of gastric cancer, while blocking the PRTG/cGMP/PKG axis holds potential for gastric cancer treatment [19]. However, the specific function and regulatory mechanisms of the cGMP-PKG pathway in PCa remain unclear. Our study identified that high expression of the EDNRB gene inhibits the proliferation, migration, and invasion of PCa cells, offering valuable insights into the role of the cGMP-PKG pathway in PCa and the development of novel treatment strategies.

Undoubtedly, the novel finding of EDNRB’s low expression in PCa and its functional role in the cGMP-PKG pathway warrants further investigation. First, our observations regarding the low expression of EDNRB in PCa tissues and cell lines require validation in larger patient sample cohorts. Moreover, variations in gene expression levels may exist due to differences in sample sources, potentially impacting our results. Second, although our study revealed that high expression of the EDNRB gene activates the cGMP-PKG pathway, the intricate molecular mechanisms underlying the precise regulation of this pathway by EDNRB remain unclear. Further research is necessary to delve deeper into these mechanisms, including exploring potential intermediary molecules involved in the regulation of the cGMP-PKG pathway by EDNRB [20]. Our current study did not assess the DNA methylation status of the EDNRB gene, which may be a significant factor in its downregulation in PCa. The potential role of epigenetic modifications in EDNRB expression represents an important aspect of gene regulation that warrants further exploration. Future research efforts will be directed to include an analysis of the DNA methylation status of EDNRB to provide a more comprehensive understanding of its involvement in PCa. Third, while our study provides valuable insights into the role of EDNRB overexpression in PCa, we recognize the absence of knockdown or knockout controls as a limitation. The importance of such experiments cannot be overstated as they would offer a more complete understanding of EDNRB’s role by observing the effects of its reduced expression or complete absence. Future studies will aim to include these control experiments to validate the findings presented herein. Our study used (D)-DT-2 to inhibit the PKG pathway; however, the broad specificity of (D)-DT-2 might affect other molecular pathways. Direct genetic knockout of key genes within the PKG pathway would provide stronger evidence for the specificity of the pathway’s role in the observed effects of EDNRB on PCa cells. We aim to undertake these more targeted genetic manipulation experiments in future research to solidify our conclusions. Additionally, while our in vitro experiments demonstrated the inhibitory effects of high EDNRB expression on the growth and migration of PCa cells, it is crucial to acknowledge the substantial disparities between the in vitro and in vivo environments [21]. The in vivo setting is more complex, involving numerous interactions and signaling pathways. Therefore, although we validated the inhibitory effect of EDNRB in a nude mouse model, further verification using additional animal models and clinical samples is imperative for a comprehensive understanding of EDNRB’s function and role in vivo. Additionally, our research did not encompass the impact of EDNRB on the prognosis of PCa patients, which constitutes an important avenue for future investigation.

In summary, our study sheds light on the significant role of EDNRB in PCa. Nonetheless, certain limitations exist, necessitating further research and exploration. This includes elucidating the detailed mechanism of action of EDNRB in PCa, verifying its tumor suppressor effect in larger clinical sample sizes and diverse animal models, as well as investigating its impact on the prognosis of PCa. We anticipate that through more extensive research, a comprehensive understanding of EDNRB’s role in PCa can be achieved, ultimately translating these findings into clinical applications and providing novel strategies for the treatment of this disease.

5 Conclusion

Our study demonstrates the significant involvement of EDNRB in PCa, wherein it exerts inhibitory effects on tumor cell growth, migration, and invasion through the activation of the cGMP–PKG pathway. These findings not only enhance our comprehension of the underlying mechanisms driving PCa pathogenesis, but also identify potential targets for the development of novel treatment strategies, thus offering promising prospects and opportunities.

tel: +86-13150319797

Acknowledgements

Not applicable.

  1. Funding information: Not applicable.

  2. Author contributions: Conceptualization, methodology, and writing – original draft were performed by Xun Li; formal analysis, resources, and investigation were performed by Bide Liu; formal analysis, visualization, and data curation were performed by Shuheng Wang; project administration, supervision, and validation were performed by Qiang Dong; validation, supervision, and writing – review and editing were performed by Jiuzhi Li. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors state that there are no conflicts of interest to disclose.

  4. Data availability statement: All data generated or analyzed during this study are included in this published article. The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

References

[1] Peng N, Zhang Z, Wang Y, Yang M, Fan J, Wang Q, et al. Down-regulated LINC00115 inhibits prostate cancer cell proliferation and invasion via targeting miR-212-5p/FZD5/Wnt/β-catenin axis. J Cell Mol Med. 2021;25(22):10627–37. 10.1111/jcmm.17000.Search in Google Scholar PubMed PubMed Central

[2] Qar J, Al-Trad B, Zoubi MSA, Fayyad D, Aljabali AAA, Omari S, et al. Crocin treatment improves testosterone induced benign prostatic hyperplasia in rats. J Men’s Health. 2022;18(2):1–6. 10.31083/jomh.2021.124.Search in Google Scholar

[3] Li W, Yin X, Yan Y, Liu C, Li G. STEAP4 knockdown inhibits the proliferation of prostate cancer cells by activating the cGMP-PKG pathway under lipopolysaccharide-induced inflammatory microenvironment. Int Immunopharmacol. 2021;101(Pt B):108311. 10.1016/j.intimp.2021.108311.Search in Google Scholar PubMed

[4] Wang Z, Zhang C, Chang J, Tian X, Zhu C, Xu W. LncRNA EMX2OS, Regulated by TCF12, Interacts with FUS to Regulate the Proliferation, Migration and Invasion of Prostate Cancer Cells Through the cGMP-PKG Signaling Pathway. Onco Targets Ther. 2020;13:7045–56. 10.2147/ott.S243552.Search in Google Scholar PubMed PubMed Central

[5] Viet CT, Ye Y, Dang D, Lam DK, Achdjian S, Zhang J, et al. Re-expression of the methylated EDNRB gene in oral squamous cell carcinoma attenuates cancer-induced pain. Pain. 2011;152(10):2323–32. 10.1016/j.pain.2011.06.025.Search in Google Scholar PubMed PubMed Central

[6] Wei F, Ge Y, Li W, Wang X, Chen B. Role of endothelin receptor type B (EDNRB) in lung adenocarcinoma. Thorac Cancer. 2020;11(7):1885–90. 10.1111/1759-7714.13474.Search in Google Scholar PubMed PubMed Central

[7] Zhang L, Luo B, Dang YW, He RQ, Chen G, Peng ZG, et al. The clinical significance of endothelin receptor type B in hepatocellular carcinoma and its potential molecular mechanism. Exp Mol Pathol. 2019;107:141–57. 10.1016/j.yexmp.2019.02.002.Search in Google Scholar PubMed

[8] Yan S, Liu D, Yang X, Wang G. Tumour mutational burden and immune-cell infiltration in cervical squamous cell carcinoma. Eur J Gynaecol Oncol. 2022;43(3):118–26. 10.22514/ejgo.2022.016.Search in Google Scholar

[9] Liu S, Wang W, Zhao Y, Liang K, Huang Y. Identification of Potential Key Genes for Pathogenesis and Prognosis in Prostate Cancer by Integrated Analysis of Gene Expression Profiles and the Cancer Genome Atlas. Front Oncol. 2020;10:809. 10.3389/fonc.2020.00809.Search in Google Scholar PubMed PubMed Central

[10] Teixeira EC, das Neves BM, Castilho T, Silva Ramos T, Flaviana A, Carelli J, et al. Evidence of Association between MTRR and TNF-α Gene Polymorphisms and Oral Health-Related Quality of Life in Children with Anterior Open Bite. J Clin Pediatric Dent. 2022;46(3):249–58. 10.17796/1053-4625-46.3.12.Search in Google Scholar PubMed

[11] Rawla P. Epidemiology of Prostate Cancer. World J Oncol. 2019;10(2):63–89. 10.14740/wjon1191.Search in Google Scholar PubMed PubMed Central

[12] Litwin MS, Tan HJ. The Diagnosis and Treatment of Prostate Cancer: A Review. Jama. 2017;317(24):2532–42. 10.1001/jama.2017.7248.Search in Google Scholar PubMed

[13] Yuan JY, Tong ZY, Dong YC, Zhao JY, Shang Y. Research progress on icariin, a traditional Chinese medicine extract, in the treatment of asthma. Allergol Immunopathol (Madr). 2022;50(1):9–16. 10.15586/aei.v50i1.490.Search in Google Scholar PubMed

[14] Gu X, Han S, Cui M, Xue J, Ai L, Sun L, et al. Knockdown of endothelin receptor B inhibits the progression of triple-negative breast cancer. Ann N Y Acad Sci. 2019;1448(1):5–18. 10.1111/nyas.14039.Search in Google Scholar PubMed

[15] Villalba-Benito L, López-López D, Torroglosa A, Casimiro-Soriguer CS, Luzón-Toro B, Fernández RM, et al. Genome-wide analysis of DNA methylation in Hirschsprung enteric precursor cells: unraveling the epigenetic landscape of enteric nervous system development. Clin Epigenetics. 2021;13(1):51. 10.1186/s13148-021-01040-6.Search in Google Scholar PubMed PubMed Central

[16] Hsu LS, Lee HC, Chau GY, Yin PH, Chi CW, Lui WY. Aberrant methylation of EDNRB and p16 genes in hepatocellular carcinoma (HCC) in Taiwan. Oncol Rep. 2006;15(2):507–11.10.3892/or.15.2.507Search in Google Scholar

[17] Tao K, Wu C, Wu K, Li W, Han G, Shuai X, et al. Quantitative analysis of promoter methylation of the EDNRB gene in gastric cancer. Med Oncol. 2012;29(1):107–12. 10.1007/s12032-010-9805-8.Search in Google Scholar PubMed

[18] Hongsuphan N, Faikongngeon S, Wongtanasarasin W. Cardiac tamponade as an unusual initial presentation of squamous cell carcinoma of the esophagus. Signa Vitae. 2022;18(6):110–3. 10.22514/sv.2021.120.Search in Google Scholar

[19] Xiang T, Yuan C, Guo X, Wang H, Cai Q, Xiang Y, et al. The novel ZEB1-upregulated protein PRTG induced by Helicobacter pylori infection promotes gastric carcinogenesis through the cGMP/PKG signaling pathway. Cell Death Dis. 2021;12(2):150. 10.1038/s41419-021-03440-1.Search in Google Scholar PubMed PubMed Central

[20] Zhang L, Luo B, Dang Y-W, He R-Q, Chen G, Peng Z-G, et al. The clinical significance of endothelin receptor type B in hepatocellular carcinoma and its potential molecular mechanism. Exp Mol Pathol. 2019;107:141–57. 10.1016/j.yexmp.2019.02.002.Search in Google Scholar PubMed

[21] An HS, Masuda K. Relevance of in vitro and in vivo models for intervertebral disc degeneration. J Bone Jt Surg Am. 2006;88(Suppl 2):88–94. 10.2106/jbjs.E.01272.Search in Google Scholar
Received: 2023-07-10
Revised: 2023-11-21
Accepted: 2023-11-21
Published Online: 2024-01-04

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway
  3. STK11 (LKB1) mutation suppresses ferroptosis in lung adenocarcinoma by facilitating monounsaturated fatty acid synthesis
  4. Association of SOX6 gene polymorphisms with Kashin-Beck disease risk in the Chinese Han population
  5. The pyroptosis-related signature predicts prognosis and influences the tumor immune microenvironment in dedifferentiated liposarcoma
  6. METTL3 attenuates ferroptosis sensitivity in lung cancer via modulating TFRC
  7. Identification and validation of molecular subtypes and prognostic signature for stage I and stage II gastric cancer based on neutrophil extracellular traps
  8. Novel lumbar plexus block versus femoral nerve block for analgesia and motor recovery after total knee arthroplasty
  9. Correlation between ABCB1 and OLIG2 polymorphisms and the severity and prognosis of patients with cerebral infarction
  10. Study on the radiotherapy effect and serum neutral granulocyte lymphocyte ratio and inflammatory factor expression of nasopharyngeal carcinoma
  11. Transcriptome analysis of effects of Tecrl deficiency on cardiometabolic and calcium regulation in cardiac tissue
  12. Aflatoxin B1 induces infertility, fetal deformities, and potential therapies
  13. Serum levels of HMW adiponectin and its receptors are associated with cytokine levels and clinical characteristics in chronic obstructive pulmonary disease
  14. METTL3-mediated methylation of CYP2C19 mRNA may aggravate clopidogrel resistance in ischemic stroke patients
  15. Understand how machine learning impact lung cancer research from 2010 to 2021: A bibliometric analysis
  16. Pressure ulcers in German hospitals: Analysis of reimbursement and length of stay
  17. Metformin plus L-carnitine enhances brown/beige adipose tissue activity via Nrf2/HO-1 signaling to reduce lipid accumulation and inflammation in murine obesity
  18. Downregulation of carbonic anhydrase IX expression in mouse xenograft nasopharyngeal carcinoma model via doxorubicin nanobubble combined with ultrasound
  19. Feasibility of 3-dimensional printed models in simulated training and teaching of transcatheter aortic valve replacement
  20. miR-335-3p improves type II diabetes mellitus by IGF-1 regulating macrophage polarization
  21. The analyses of human MCPH1 DNA repair machinery and genetic variations
  22. Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy
  23. Comprehensive analysis based on the disulfidptosis-related genes identifies hub genes and immune infiltration for pancreatic adenocarcinoma
  24. Changes of serum CA125 and PGE2 before and after high-intensity focused ultrasound combined with GnRH-a in treatment of patients with adenomyosis
  25. The clinical value of the hepatic venous pressure gradient in patients undergoing hepatic resection for hepatocellular carcinoma with or without liver cirrhosis
  26. Development and validation of a novel model to predict pulmonary embolism in cardiology suspected patients: A 10-year retrospective analysis
  27. Downregulation of lncRNA XLOC_032768 in diabetic patients predicts the occurrence of diabetic nephropathy
  28. Circ_0051428 targeting miR-885-3p/MMP2 axis enhances the malignancy of cervical cancer
  29. Effectiveness of ginkgo diterpene lactone meglumine on cognitive function in patients with acute ischemic stroke
  30. The construction of a novel prognostic prediction model for glioma based on GWAS-identified prognostic-related risk loci
  31. Evaluating the impact of childhood BMI on the risk of coronavirus disease 2019: A Mendelian randomization study
  32. Lactate dehydrogenase to albumin ratio is associated with in-hospital mortality in patients with acute heart failure: Data from the MIMIC-III database
  33. CD36-mediated podocyte lipotoxicity promotes foot process effacement
  34. Efficacy of etonogestrel subcutaneous implants versus the levonorgestrel-releasing intrauterine system in the conservative treatment of adenomyosis
  35. FLRT2 mediates chondrogenesis of nasal septal cartilage and mandibular condyle cartilage
  36. Challenges in treating primary immune thrombocytopenia patients undergoing COVID-19 vaccination: A retrospective study
  37. Let-7 family regulates HaCaT cell proliferation and apoptosis via the ΔNp63/PI3K/AKT pathway
  38. Phospholipid transfer protein ameliorates sepsis-induced cardiac dysfunction through NLRP3 inflammasome inhibition
  39. Postoperative cognitive dysfunction in elderly patients with colorectal cancer: A randomized controlled study comparing goal-directed and conventional fluid therapy
  40. Long-pulsed ultrasound-mediated microbubble thrombolysis in a rat model of microvascular obstruction
  41. High SEC61A1 expression predicts poor outcome of acute myeloid leukemia
  42. Comparison of polymerase chain reaction and next-generation sequencing with conventional urine culture for the diagnosis of urinary tract infections: A meta-analysis
  43. Secreted frizzled-related protein 5 protects against renal fibrosis by inhibiting Wnt/β-catenin pathway
  44. Pan-cancer and single-cell analysis of actin cytoskeleton genes related to disulfidptosis
  45. Overexpression of miR-532-5p restrains oxidative stress response of chondrocytes in nontraumatic osteonecrosis of the femoral head by inhibiting ABL1
  46. Autologous liver transplantation for unresectable hepatobiliary malignancies in enhanced recovery after surgery model
  47. Clinical analysis of incomplete rupture of the uterus secondary to previous cesarean section
  48. Abnormal sleep duration is associated with sarcopenia in older Chinese people: A large retrospective cross-sectional study
  49. No genetic causality between obesity and benign paroxysmal vertigo: A two-sample Mendelian randomization study
  50. Identification and validation of autophagy-related genes in SSc
  51. Long non-coding RNA SRA1 suppresses radiotherapy resistance in esophageal squamous cell carcinoma by modulating glycolytic reprogramming
  52. Evaluation of quality of life in patients with schizophrenia: An inpatient social welfare institution-based cross-sectional study
  53. The possible role of oxidative stress marker glutathione in the assessment of cognitive impairment in multiple sclerosis
  54. Compilation of a self-management assessment scale for postoperative patients with aortic dissection
  55. Left atrial appendage closure in conjunction with radiofrequency ablation: Effects on left atrial functioning in patients with paroxysmal atrial fibrillation
  56. Effect of anterior femoral cortical notch grade on postoperative function and complications during TKA surgery: A multicenter, retrospective study
  57. Clinical characteristics and assessment of risk factors in patients with influenza A-induced severe pneumonia after the prevalence of SARS-CoV-2
  58. Analgesia nociception index is an indicator of laparoscopic trocar insertion-induced transient nociceptive stimuli
  59. High STAT4 expression correlates with poor prognosis in acute myeloid leukemia and facilitates disease progression by upregulating VEGFA expression
  60. Factors influencing cardiovascular system-related post-COVID-19 sequelae: A single-center cohort study
  61. HOXD10 regulates intestinal permeability and inhibits inflammation of dextran sulfate sodium-induced ulcerative colitis through the inactivation of the Rho/ROCK/MMPs axis
  62. Mesenchymal stem cell-derived exosomal miR-26a induces ferroptosis, suppresses hepatic stellate cell activation, and ameliorates liver fibrosis by modulating SLC7A11
  63. Endovascular thrombectomy versus intravenous thrombolysis for primary distal, medium vessel occlusion in acute ischemic stroke
  64. ANO6 (TMEM16F) inhibits gastrointestinal stromal tumor growth and induces ferroptosis
  65. Prognostic value of EIF5A2 in solid tumors: A meta-analysis and bioinformatics analysis
  66. The role of enhanced expression of Cx43 in patients with ulcerative colitis
  67. Choosing a COVID-19 vaccination site might be driven by anxiety and body vigilance
  68. Role of ICAM-1 in triple-negative breast cancer
  69. Cost-effectiveness of ambroxol in the treatment of Gaucher disease type 2
  70. HLA-DRB5 promotes immune thrombocytopenia via activating CD8+ T cells
  71. Efficacy and factors of myofascial release therapy combined with electrical and magnetic stimulation in the treatment of chronic pelvic pain syndrome
  72. Efficacy of tacrolimus monotherapy in primary membranous nephropathy
  73. Mechanisms of Tripterygium wilfordii Hook F on treating rheumatoid arthritis explored by network pharmacology analysis and molecular docking
  74. FBXO45 levels regulated ferroptosis renal tubular epithelial cells in a model of diabetic nephropathy by PLK1
  75. Optimizing anesthesia strategies to NSCLC patients in VATS procedures: Insights from drug requirements and patient recovery patterns
  76. Alpha-lipoic acid upregulates the PPARγ/NRF2/GPX4 signal pathway to inhibit ferroptosis in the pathogenesis of unexplained recurrent pregnancy loss
  77. Correlation between fat-soluble vitamin levels and inflammatory factors in paediatric community-acquired pneumonia: A prospective study
  78. CD1d affects the proliferation, migration, and apoptosis of human papillary thyroid carcinoma TPC-1 cells via regulating MAPK/NF-κB signaling pathway
  79. miR-let-7a inhibits sympathetic nerve remodeling after myocardial infarction by downregulating the expression of nerve growth factor
  80. Immune response analysis of solid organ transplantation recipients inoculated with inactivated COVID-19 vaccine: A retrospective analysis
  81. The H2Valdien derivatives regulate the epithelial–mesenchymal transition of hepatoma carcinoma cells through the Hedgehog signaling pathway
  82. Clinical efficacy of dexamethasone combined with isoniazid in the treatment of tuberculous meningitis and its effect on peripheral blood T cell subsets
  83. Comparison of short-segment and long-segment fixation in treatment of degenerative scoliosis and analysis of factors associated with adjacent spondylolisthesis
  84. Lycopene inhibits pyroptosis of endothelial progenitor cells induced by ox-LDL through the AMPK/mTOR/NLRP3 pathway
  85. Methylation regulation for FUNDC1 stability in childhood leukemia was up-regulated and facilitates metastasis and reduces ferroptosis of leukemia through mitochondrial damage by FBXL2
  86. Correlation of single-fiber electromyography studies and functional status in patients with amyotrophic lateral sclerosis
  87. Risk factors of postoperative airway obstruction complications in children with oral floor mass
  88. Expression levels and clinical significance of serum miR-19a/CCL20 in patients with acute cerebral infarction
  89. Physical activity and mental health trends in Korean adolescents: Analyzing the impact of the COVID-19 pandemic from 2018 to 2022
  90. Evaluating anemia in HIV-infected patients using chest CT
  91. Ponticulus posticus and skeletal malocclusion: A pilot study in a Southern Italian pre-orthodontic court
  92. Causal association of circulating immune cells and lymphoma: A Mendelian randomization study
  93. Assessment of the renal function and fibrosis indexes of conventional western medicine with Chinese medicine for dredging collaterals on treating renal fibrosis: A systematic review and meta-analysis
  94. Comprehensive landscape of integrator complex subunits and their association with prognosis and tumor microenvironment in gastric cancer
  95. New target-HMGCR inhibitors for the treatment of primary sclerosing cholangitis: A drug Mendelian randomization study
  96. Population pharmacokinetics of meropenem in critically ill patients
  97. Comparison of the ability of newly inflammatory markers to predict complicated appendicitis
  98. Comparative morphology of the cruciate ligaments: A radiological study
  99. Immune landscape of hepatocellular carcinoma: The central role of TP53-inducible glycolysis and apoptosis regulator
  100. Serum SIRT3 levels in epilepsy patients and its association with clinical outcomes and severity: A prospective observational study
  101. SHP-1 mediates cigarette smoke extract-induced epithelial–mesenchymal transformation and inflammation in 16HBE cells
  102. Acute hyper-hypoxia accelerates the development of depression in mice via the IL-6/PGC1α/MFN2 signaling pathway
  103. The GJB3 correlates with the prognosis, immune cell infiltration, and therapeutic responses in lung adenocarcinoma
  104. Physical fitness and blood parameters outcomes of breast cancer survivor in a low-intensity circuit resistance exercise program
  105. Exploring anesthetic-induced gene expression changes and immune cell dynamics in atrial tissue post-coronary artery bypass graft surgery
  106. Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism
  107. Analysis of the risk factors of the radiation-induced encephalopathy in nasopharyngeal carcinoma: A retrospective cohort study
  108. Reproductive outcomes in women with BRCA 1/2 germline mutations: A retrospective observational study and literature review
  109. Evaluation of upper airway ultrasonographic measurements in predicting difficult intubation: A cross-section of the Turkish population
  110. Prognostic and diagnostic value of circulating IGFBP2 in pancreatic cancer
  111. Postural stability after operative reconstruction of the AFTL in chronic ankle instability comparing three different surgical techniques
  112. Research trends related to emergence agitation in the post-anaesthesia care unit from 2001 to 2023: A bibliometric analysis
  113. Frequency and clinicopathological correlation of gastrointestinal polyps: A six-year single center experience
  114. ACSL4 mediates inflammatory bowel disease and contributes to LPS-induced intestinal epithelial cell dysfunction by activating ferroptosis and inflammation
  115. Affibody-based molecular probe 99mTc-(HE)3ZHER2:V2 for non-invasive HER2 detection in ovarian and breast cancer xenografts
  116. Effectiveness of nutritional support for clinical outcomes in gastric cancer patients: A meta-analysis of randomized controlled trials
  117. The relationship between IFN-γ, IL-10, IL-6 cytokines, and severity of the condition with serum zinc and Fe in children infected with Mycoplasma pneumoniae
  118. Paraquat disrupts the blood–brain barrier by increasing IL-6 expression and oxidative stress through the activation of PI3K/AKT signaling pathway
  119. Sleep quality associate with the increased prevalence of cognitive impairment in coronary artery disease patients: A retrospective case–control study
  120. Dioscin protects against chronic prostatitis through the TLR4/NF-κB pathway
  121. Association of polymorphisms in FBN1, MYH11, and TGF-β signaling-related genes with susceptibility of sporadic thoracic aortic aneurysm and dissection in the Zhejiang Han population
  122. Application value of multi-parameter magnetic resonance image-transrectal ultrasound cognitive fusion in prostate biopsy
  123. Laboratory variables‐based artificial neural network models for predicting fatty liver disease: A retrospective study
  124. Decreased BIRC5-206 promotes epithelial–mesenchymal transition in nasopharyngeal carcinoma through sponging miR-145-5p
  125. Sepsis induces the cardiomyocyte apoptosis and cardiac dysfunction through activation of YAP1/Serpine1/caspase-3 pathway
  126. Assessment of iron metabolism and iron deficiency in incident patients on incident continuous ambulatory peritoneal dialysis
  127. Tibial periosteum flap combined with autologous bone grafting in the treatment of Gustilo-IIIB/IIIC open tibial fractures
  128. The application of intravenous general anesthesia under nasopharyngeal airway assisted ventilation undergoing ureteroscopic holmium laser lithotripsy: A prospective, single-center, controlled trial
  129. Long intergenic noncoding RNA for IGF2BP2 stability suppresses gastric cancer cell apoptosis by inhibiting the maturation of microRNA-34a
  130. Role of FOXM1 and AURKB in regulating keratinocyte function in psoriasis
  131. Parental control attitudes over their pre-school children’s diet
  132. The role of auto-HSCT in extranodal natural killer/T cell lymphoma
  133. Significance of negative cervical cytology and positive HPV in the diagnosis of cervical lesions by colposcopy
  134. Echinacoside inhibits PASMCs calcium overload to prevent hypoxic pulmonary artery remodeling by regulating TRPC1/4/6 and calmodulin
  135. ADAR1 plays a protective role in proximal tubular cells under high glucose conditions by attenuating the PI3K/AKT/mTOR signaling pathway
  136. The risk of cancer among insulin glargine users in Lithuania: A retrospective population-based study
  137. The unusual location of primary hydatid cyst: A case series study
  138. Intraoperative changes in electrophysiological monitoring can be used to predict clinical outcomes in patients with spinal cavernous malformation
  139. Obesity and risk of placenta accreta spectrum: A meta-analysis
  140. Shikonin alleviates asthma phenotypes in mice via an airway epithelial STAT3-dependent mechanism
  141. NSUN6 and HTR7 disturbed the stability of carotid atherosclerotic plaques by regulating the immune responses of macrophages
  142. The effect of COVID-19 lockdown on admission rates in Maternity Hospital
  143. Temporal muscle thickness is not a prognostic predictor in patients with high-grade glioma, an experience at two centers in China
  144. Luteolin alleviates cerebral ischemia/reperfusion injury by regulating cell pyroptosis
  145. Therapeutic role of respiratory exercise in patients with tuberculous pleurisy
  146. Effects of CFTR-ENaC on spinal cord edema after spinal cord injury
  147. Irisin-regulated lncRNAs and their potential regulatory functions in chondrogenic differentiation of human mesenchymal stem cells
  148. DMD mutations in pediatric patients with phenotypes of Duchenne/Becker muscular dystrophy
  149. Combination of C-reactive protein and fibrinogen-to-albumin ratio as a novel predictor of all-cause mortality in heart failure patients
  150. Significant role and the underly mechanism of cullin-1 in chronic obstructive pulmonary disease
  151. Ferroptosis-related prognostic model of mantle cell lymphoma
  152. Observation of choking reaction and other related indexes in elderly painless fiberoptic bronchoscopy with transnasal high-flow humidification oxygen therapy
  153. A bibliometric analysis of Prader-Willi syndrome from 2002 to 2022
  154. The causal effects of childhood sunburn occasions on melanoma: A univariable and multivariable Mendelian randomization study
  155. Oxidative stress regulates glycogen synthase kinase-3 in lymphocytes of diabetes mellitus patients complicated with cerebral infarction
  156. Role of COX6C and NDUFB3 in septic shock and stroke
  157. Trends in disease burden of type 2 diabetes, stroke, and hypertensive heart disease attributable to high BMI in China: 1990–2019
  158. Purinergic P2X7 receptor mediates hyperoxia-induced injury in pulmonary microvascular endothelial cells via NLRP3-mediated pyroptotic pathway
  159. Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation
  160. Analgesic effect of external oblique intercostal block in laparoscopic cholecystectomy: A retrospective study
  161. Elevated serum miR-142-5p correlates with ischemic lesions and both NSE and S100β in ischemic stroke patients
  162. Correlation between the mechanism of arteriopathy in IgA nephropathy and blood stasis syndrome: A cohort study
  163. Risk factors for progressive kyphosis after percutaneous kyphoplasty in osteoporotic vertebral compression fracture
  164. Predictive role of neuron-specific enolase and S100-β in early neurological deterioration and unfavorable prognosis in patients with ischemic stroke
  165. The potential risk factors of postoperative cognitive dysfunction for endovascular therapy in acute ischemic stroke with general anesthesia
  166. Fluoxetine inhibited RANKL-induced osteoclastic differentiation in vitro
  167. Detection of serum FOXM1 and IGF2 in patients with ARDS and their correlation with disease and prognosis
  168. Rhein promotes skin wound healing by activating the PI3K/AKT signaling pathway
  169. Differences in mortality risk by levels of physical activity among persons with disabilities in South Korea
  170. Review Articles
  171. Cutaneous signs of selected cardiovascular disorders: A narrative review
  172. XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis
  173. A narrative review on adverse drug reactions of COVID-19 treatments on the kidney
  174. Emerging role and function of SPDL1 in human health and diseases
  175. Adverse reactions of piperacillin: A literature review of case reports
  176. Molecular mechanism and intervention measures of microvascular complications in diabetes
  177. Regulation of mesenchymal stem cell differentiation by autophagy
  178. Molecular landscape of borderline ovarian tumours: A systematic review
  179. Advances in synthetic lethality modalities for glioblastoma multiforme
  180. Investigating hormesis, aging, and neurodegeneration: From bench to clinics
  181. Frankincense: A neuronutrient to approach Parkinson’s disease treatment
  182. Sox9: A potential regulator of cancer stem cells in osteosarcoma
  183. Early detection of cardiovascular risk markers through non-invasive ultrasound methodologies in periodontitis patients
  184. Advanced neuroimaging and criminal interrogation in lie detection
  185. Maternal factors for neural tube defects in offspring: An umbrella review
  186. The chemoprotective hormetic effects of rosmarinic acid
  187. CBD’s potential impact on Parkinson’s disease: An updated overview
  188. Progress in cytokine research for ARDS: A comprehensive review
  189. Utilizing reactive oxygen species-scavenging nanoparticles for targeting oxidative stress in the treatment of ischemic stroke: A review
  190. NRXN1-related disorders, attempt to better define clinical assessment
  191. Lidocaine infusion for the treatment of complex regional pain syndrome: Case series and literature review
  192. Trends and future directions of autophagy in osteosarcoma: A bibliometric analysis
  193. Iron in ventricular remodeling and aneurysms post-myocardial infarction
  194. Case Reports
  195. Sirolimus potentiated angioedema: A case report and review of the literature
  196. Identification of mixed anaerobic infections after inguinal hernia repair based on metagenomic next-generation sequencing: A case report
  197. Successful treatment with bortezomib in combination with dexamethasone in a middle-aged male with idiopathic multicentric Castleman’s disease: A case report
  198. Complete heart block associated with hepatitis A infection in a female child with fatal outcome
  199. Elevation of D-dimer in eosinophilic gastrointestinal diseases in the absence of venous thrombosis: A case series and literature review
  200. Four years of natural progressive course: A rare case report of juvenile Xp11.2 translocations renal cell carcinoma with TFE3 gene fusion
  201. Advancing prenatal diagnosis: Echocardiographic detection of Scimitar syndrome in China – A case series
  202. Outcomes and complications of hemodialysis in patients with renal cancer following bilateral nephrectomy
  203. Anti-HMGCR myopathy mimicking facioscapulohumeral muscular dystrophy
  204. Recurrent opportunistic infections in a HIV-negative patient with combined C6 and NFKB1 mutations: A case report, pedigree analysis, and literature review
  205. Letter to the Editor
  206. Letter to the Editor: Total parenteral nutrition-induced Wernicke’s encephalopathy after oncologic gastrointestinal surgery
  207. Erratum
  208. Erratum to “Bladder-embedded ectopic intrauterine device with calculus”
  209. Retraction
  210. Retraction of “XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis”
  211. Corrigendum
  212. Corrigendum to “Investigating hormesis, aging, and neurodegeneration: From bench to clinics”
  213. Corrigendum to “Frankincense: A neuronutrient to approach Parkinson’s disease treatment”
  214. Special Issue The evolving saga of RNAs from bench to bedside - Part II
  215. Machine-learning-based prediction of a diagnostic model using autophagy-related genes based on RNA sequencing for patients with papillary thyroid carcinoma
  216. Unlocking the future of hepatocellular carcinoma treatment: A comprehensive analysis of disulfidptosis-related lncRNAs for prognosis and drug screening
  217. Elevated mRNA level indicates FSIP1 promotes EMT and gastric cancer progression by regulating fibroblasts in tumor microenvironment
  218. Special Issue Advancements in oncology: bridging clinical and experimental research - Part I
  219. Ultrasound-guided transperineal vs transrectal prostate biopsy: A meta-analysis of diagnostic accuracy and complication rates
  220. Assessment of diagnostic value of unilateral systematic biopsy combined with targeted biopsy in detecting clinically significant prostate cancer
  221. SENP7 inhibits glioblastoma metastasis and invasion by dissociating SUMO2/3 binding to specific target proteins
  222. MARK1 suppress malignant progression of hepatocellular carcinoma and improves sorafenib resistance through negatively regulating POTEE
  223. Analysis of postoperative complications in bladder cancer patients
  224. Carboplatin combined with arsenic trioxide versus carboplatin combined with docetaxel treatment for LACC: A randomized, open-label, phase II clinical study
  225. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part I
  226. Comprehensive pan-cancer investigation of carnosine dipeptidase 1 and its prospective prognostic significance in hepatocellular carcinoma
  227. Identification of signatures associated with microsatellite instability and immune characteristics to predict the prognostic risk of colon cancer
  228. Single-cell analysis identified key macrophage subpopulations associated with atherosclerosis
https://doi.org/10.1515/med-2023-0875
Keywords for this article
prostate cancer; B-type endothelin receptor; cGMP-PKG; GEO; cancer
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway
  3. STK11 (LKB1) mutation suppresses ferroptosis in lung adenocarcinoma by facilitating monounsaturated fatty acid synthesis
  4. Association of SOX6 gene polymorphisms with Kashin-Beck disease risk in the Chinese Han population
  5. The pyroptosis-related signature predicts prognosis and influences the tumor immune microenvironment in dedifferentiated liposarcoma
  6. METTL3 attenuates ferroptosis sensitivity in lung cancer via modulating TFRC
  7. Identification and validation of molecular subtypes and prognostic signature for stage I and stage II gastric cancer based on neutrophil extracellular traps
  8. Novel lumbar plexus block versus femoral nerve block for analgesia and motor recovery after total knee arthroplasty
  9. Correlation between ABCB1 and OLIG2 polymorphisms and the severity and prognosis of patients with cerebral infarction
  10. Study on the radiotherapy effect and serum neutral granulocyte lymphocyte ratio and inflammatory factor expression of nasopharyngeal carcinoma
  11. Transcriptome analysis of effects of Tecrl deficiency on cardiometabolic and calcium regulation in cardiac tissue
  12. Aflatoxin B1 induces infertility, fetal deformities, and potential therapies
  13. Serum levels of HMW adiponectin and its receptors are associated with cytokine levels and clinical characteristics in chronic obstructive pulmonary disease
  14. METTL3-mediated methylation of CYP2C19 mRNA may aggravate clopidogrel resistance in ischemic stroke patients
  15. Understand how machine learning impact lung cancer research from 2010 to 2021: A bibliometric analysis
  16. Pressure ulcers in German hospitals: Analysis of reimbursement and length of stay
  17. Metformin plus L-carnitine enhances brown/beige adipose tissue activity via Nrf2/HO-1 signaling to reduce lipid accumulation and inflammation in murine obesity
  18. Downregulation of carbonic anhydrase IX expression in mouse xenograft nasopharyngeal carcinoma model via doxorubicin nanobubble combined with ultrasound
  19. Feasibility of 3-dimensional printed models in simulated training and teaching of transcatheter aortic valve replacement
  20. miR-335-3p improves type II diabetes mellitus by IGF-1 regulating macrophage polarization
  21. The analyses of human MCPH1 DNA repair machinery and genetic variations
  22. Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy
  23. Comprehensive analysis based on the disulfidptosis-related genes identifies hub genes and immune infiltration for pancreatic adenocarcinoma
  24. Changes of serum CA125 and PGE2 before and after high-intensity focused ultrasound combined with GnRH-a in treatment of patients with adenomyosis
  25. The clinical value of the hepatic venous pressure gradient in patients undergoing hepatic resection for hepatocellular carcinoma with or without liver cirrhosis
  26. Development and validation of a novel model to predict pulmonary embolism in cardiology suspected patients: A 10-year retrospective analysis
  27. Downregulation of lncRNA XLOC_032768 in diabetic patients predicts the occurrence of diabetic nephropathy
  28. Circ_0051428 targeting miR-885-3p/MMP2 axis enhances the malignancy of cervical cancer
  29. Effectiveness of ginkgo diterpene lactone meglumine on cognitive function in patients with acute ischemic stroke
  30. The construction of a novel prognostic prediction model for glioma based on GWAS-identified prognostic-related risk loci
  31. Evaluating the impact of childhood BMI on the risk of coronavirus disease 2019: A Mendelian randomization study
  32. Lactate dehydrogenase to albumin ratio is associated with in-hospital mortality in patients with acute heart failure: Data from the MIMIC-III database
  33. CD36-mediated podocyte lipotoxicity promotes foot process effacement
  34. Efficacy of etonogestrel subcutaneous implants versus the levonorgestrel-releasing intrauterine system in the conservative treatment of adenomyosis
  35. FLRT2 mediates chondrogenesis of nasal septal cartilage and mandibular condyle cartilage
  36. Challenges in treating primary immune thrombocytopenia patients undergoing COVID-19 vaccination: A retrospective study
  37. Let-7 family regulates HaCaT cell proliferation and apoptosis via the ΔNp63/PI3K/AKT pathway
  38. Phospholipid transfer protein ameliorates sepsis-induced cardiac dysfunction through NLRP3 inflammasome inhibition
  39. Postoperative cognitive dysfunction in elderly patients with colorectal cancer: A randomized controlled study comparing goal-directed and conventional fluid therapy
  40. Long-pulsed ultrasound-mediated microbubble thrombolysis in a rat model of microvascular obstruction
  41. High SEC61A1 expression predicts poor outcome of acute myeloid leukemia
  42. Comparison of polymerase chain reaction and next-generation sequencing with conventional urine culture for the diagnosis of urinary tract infections: A meta-analysis
  43. Secreted frizzled-related protein 5 protects against renal fibrosis by inhibiting Wnt/β-catenin pathway
  44. Pan-cancer and single-cell analysis of actin cytoskeleton genes related to disulfidptosis
  45. Overexpression of miR-532-5p restrains oxidative stress response of chondrocytes in nontraumatic osteonecrosis of the femoral head by inhibiting ABL1
  46. Autologous liver transplantation for unresectable hepatobiliary malignancies in enhanced recovery after surgery model
  47. Clinical analysis of incomplete rupture of the uterus secondary to previous cesarean section
  48. Abnormal sleep duration is associated with sarcopenia in older Chinese people: A large retrospective cross-sectional study
  49. No genetic causality between obesity and benign paroxysmal vertigo: A two-sample Mendelian randomization study
  50. Identification and validation of autophagy-related genes in SSc
  51. Long non-coding RNA SRA1 suppresses radiotherapy resistance in esophageal squamous cell carcinoma by modulating glycolytic reprogramming
  52. Evaluation of quality of life in patients with schizophrenia: An inpatient social welfare institution-based cross-sectional study
  53. The possible role of oxidative stress marker glutathione in the assessment of cognitive impairment in multiple sclerosis
  54. Compilation of a self-management assessment scale for postoperative patients with aortic dissection
  55. Left atrial appendage closure in conjunction with radiofrequency ablation: Effects on left atrial functioning in patients with paroxysmal atrial fibrillation
  56. Effect of anterior femoral cortical notch grade on postoperative function and complications during TKA surgery: A multicenter, retrospective study
  57. Clinical characteristics and assessment of risk factors in patients with influenza A-induced severe pneumonia after the prevalence of SARS-CoV-2
  58. Analgesia nociception index is an indicator of laparoscopic trocar insertion-induced transient nociceptive stimuli
  59. High STAT4 expression correlates with poor prognosis in acute myeloid leukemia and facilitates disease progression by upregulating VEGFA expression
  60. Factors influencing cardiovascular system-related post-COVID-19 sequelae: A single-center cohort study
  61. HOXD10 regulates intestinal permeability and inhibits inflammation of dextran sulfate sodium-induced ulcerative colitis through the inactivation of the Rho/ROCK/MMPs axis
  62. Mesenchymal stem cell-derived exosomal miR-26a induces ferroptosis, suppresses hepatic stellate cell activation, and ameliorates liver fibrosis by modulating SLC7A11
  63. Endovascular thrombectomy versus intravenous thrombolysis for primary distal, medium vessel occlusion in acute ischemic stroke
  64. ANO6 (TMEM16F) inhibits gastrointestinal stromal tumor growth and induces ferroptosis
  65. Prognostic value of EIF5A2 in solid tumors: A meta-analysis and bioinformatics analysis
  66. The role of enhanced expression of Cx43 in patients with ulcerative colitis
  67. Choosing a COVID-19 vaccination site might be driven by anxiety and body vigilance
  68. Role of ICAM-1 in triple-negative breast cancer
  69. Cost-effectiveness of ambroxol in the treatment of Gaucher disease type 2
  70. HLA-DRB5 promotes immune thrombocytopenia via activating CD8+ T cells
  71. Efficacy and factors of myofascial release therapy combined with electrical and magnetic stimulation in the treatment of chronic pelvic pain syndrome
  72. Efficacy of tacrolimus monotherapy in primary membranous nephropathy
  73. Mechanisms of Tripterygium wilfordii Hook F on treating rheumatoid arthritis explored by network pharmacology analysis and molecular docking
  74. FBXO45 levels regulated ferroptosis renal tubular epithelial cells in a model of diabetic nephropathy by PLK1
  75. Optimizing anesthesia strategies to NSCLC patients in VATS procedures: Insights from drug requirements and patient recovery patterns
  76. Alpha-lipoic acid upregulates the PPARγ/NRF2/GPX4 signal pathway to inhibit ferroptosis in the pathogenesis of unexplained recurrent pregnancy loss
  77. Correlation between fat-soluble vitamin levels and inflammatory factors in paediatric community-acquired pneumonia: A prospective study
  78. CD1d affects the proliferation, migration, and apoptosis of human papillary thyroid carcinoma TPC-1 cells via regulating MAPK/NF-κB signaling pathway
  79. miR-let-7a inhibits sympathetic nerve remodeling after myocardial infarction by downregulating the expression of nerve growth factor
  80. Immune response analysis of solid organ transplantation recipients inoculated with inactivated COVID-19 vaccine: A retrospective analysis
  81. The H2Valdien derivatives regulate the epithelial–mesenchymal transition of hepatoma carcinoma cells through the Hedgehog signaling pathway
  82. Clinical efficacy of dexamethasone combined with isoniazid in the treatment of tuberculous meningitis and its effect on peripheral blood T cell subsets
  83. Comparison of short-segment and long-segment fixation in treatment of degenerative scoliosis and analysis of factors associated with adjacent spondylolisthesis
  84. Lycopene inhibits pyroptosis of endothelial progenitor cells induced by ox-LDL through the AMPK/mTOR/NLRP3 pathway
  85. Methylation regulation for FUNDC1 stability in childhood leukemia was up-regulated and facilitates metastasis and reduces ferroptosis of leukemia through mitochondrial damage by FBXL2
  86. Correlation of single-fiber electromyography studies and functional status in patients with amyotrophic lateral sclerosis
  87. Risk factors of postoperative airway obstruction complications in children with oral floor mass
  88. Expression levels and clinical significance of serum miR-19a/CCL20 in patients with acute cerebral infarction
  89. Physical activity and mental health trends in Korean adolescents: Analyzing the impact of the COVID-19 pandemic from 2018 to 2022
  90. Evaluating anemia in HIV-infected patients using chest CT
  91. Ponticulus posticus and skeletal malocclusion: A pilot study in a Southern Italian pre-orthodontic court
  92. Causal association of circulating immune cells and lymphoma: A Mendelian randomization study
  93. Assessment of the renal function and fibrosis indexes of conventional western medicine with Chinese medicine for dredging collaterals on treating renal fibrosis: A systematic review and meta-analysis
  94. Comprehensive landscape of integrator complex subunits and their association with prognosis and tumor microenvironment in gastric cancer
  95. New target-HMGCR inhibitors for the treatment of primary sclerosing cholangitis: A drug Mendelian randomization study
  96. Population pharmacokinetics of meropenem in critically ill patients
  97. Comparison of the ability of newly inflammatory markers to predict complicated appendicitis
  98. Comparative morphology of the cruciate ligaments: A radiological study
  99. Immune landscape of hepatocellular carcinoma: The central role of TP53-inducible glycolysis and apoptosis regulator
  100. Serum SIRT3 levels in epilepsy patients and its association with clinical outcomes and severity: A prospective observational study
  101. SHP-1 mediates cigarette smoke extract-induced epithelial–mesenchymal transformation and inflammation in 16HBE cells
  102. Acute hyper-hypoxia accelerates the development of depression in mice via the IL-6/PGC1α/MFN2 signaling pathway
  103. The GJB3 correlates with the prognosis, immune cell infiltration, and therapeutic responses in lung adenocarcinoma
  104. Physical fitness and blood parameters outcomes of breast cancer survivor in a low-intensity circuit resistance exercise program
  105. Exploring anesthetic-induced gene expression changes and immune cell dynamics in atrial tissue post-coronary artery bypass graft surgery
  106. Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism
  107. Analysis of the risk factors of the radiation-induced encephalopathy in nasopharyngeal carcinoma: A retrospective cohort study
  108. Reproductive outcomes in women with BRCA 1/2 germline mutations: A retrospective observational study and literature review
  109. Evaluation of upper airway ultrasonographic measurements in predicting difficult intubation: A cross-section of the Turkish population
  110. Prognostic and diagnostic value of circulating IGFBP2 in pancreatic cancer
  111. Postural stability after operative reconstruction of the AFTL in chronic ankle instability comparing three different surgical techniques
  112. Research trends related to emergence agitation in the post-anaesthesia care unit from 2001 to 2023: A bibliometric analysis
  113. Frequency and clinicopathological correlation of gastrointestinal polyps: A six-year single center experience
  114. ACSL4 mediates inflammatory bowel disease and contributes to LPS-induced intestinal epithelial cell dysfunction by activating ferroptosis and inflammation
  115. Affibody-based molecular probe 99mTc-(HE)3ZHER2:V2 for non-invasive HER2 detection in ovarian and breast cancer xenografts
  116. Effectiveness of nutritional support for clinical outcomes in gastric cancer patients: A meta-analysis of randomized controlled trials
  117. The relationship between IFN-γ, IL-10, IL-6 cytokines, and severity of the condition with serum zinc and Fe in children infected with Mycoplasma pneumoniae
  118. Paraquat disrupts the blood–brain barrier by increasing IL-6 expression and oxidative stress through the activation of PI3K/AKT signaling pathway
  119. Sleep quality associate with the increased prevalence of cognitive impairment in coronary artery disease patients: A retrospective case–control study
  120. Dioscin protects against chronic prostatitis through the TLR4/NF-κB pathway
  121. Association of polymorphisms in FBN1, MYH11, and TGF-β signaling-related genes with susceptibility of sporadic thoracic aortic aneurysm and dissection in the Zhejiang Han population
  122. Application value of multi-parameter magnetic resonance image-transrectal ultrasound cognitive fusion in prostate biopsy
  123. Laboratory variables‐based artificial neural network models for predicting fatty liver disease: A retrospective study
  124. Decreased BIRC5-206 promotes epithelial–mesenchymal transition in nasopharyngeal carcinoma through sponging miR-145-5p
  125. Sepsis induces the cardiomyocyte apoptosis and cardiac dysfunction through activation of YAP1/Serpine1/caspase-3 pathway
  126. Assessment of iron metabolism and iron deficiency in incident patients on incident continuous ambulatory peritoneal dialysis
  127. Tibial periosteum flap combined with autologous bone grafting in the treatment of Gustilo-IIIB/IIIC open tibial fractures
  128. The application of intravenous general anesthesia under nasopharyngeal airway assisted ventilation undergoing ureteroscopic holmium laser lithotripsy: A prospective, single-center, controlled trial
  129. Long intergenic noncoding RNA for IGF2BP2 stability suppresses gastric cancer cell apoptosis by inhibiting the maturation of microRNA-34a
  130. Role of FOXM1 and AURKB in regulating keratinocyte function in psoriasis
  131. Parental control attitudes over their pre-school children’s diet
  132. The role of auto-HSCT in extranodal natural killer/T cell lymphoma
  133. Significance of negative cervical cytology and positive HPV in the diagnosis of cervical lesions by colposcopy
  134. Echinacoside inhibits PASMCs calcium overload to prevent hypoxic pulmonary artery remodeling by regulating TRPC1/4/6 and calmodulin
  135. ADAR1 plays a protective role in proximal tubular cells under high glucose conditions by attenuating the PI3K/AKT/mTOR signaling pathway
  136. The risk of cancer among insulin glargine users in Lithuania: A retrospective population-based study
  137. The unusual location of primary hydatid cyst: A case series study
  138. Intraoperative changes in electrophysiological monitoring can be used to predict clinical outcomes in patients with spinal cavernous malformation
  139. Obesity and risk of placenta accreta spectrum: A meta-analysis
  140. Shikonin alleviates asthma phenotypes in mice via an airway epithelial STAT3-dependent mechanism
  141. NSUN6 and HTR7 disturbed the stability of carotid atherosclerotic plaques by regulating the immune responses of macrophages
  142. The effect of COVID-19 lockdown on admission rates in Maternity Hospital
  143. Temporal muscle thickness is not a prognostic predictor in patients with high-grade glioma, an experience at two centers in China
  144. Luteolin alleviates cerebral ischemia/reperfusion injury by regulating cell pyroptosis
  145. Therapeutic role of respiratory exercise in patients with tuberculous pleurisy
  146. Effects of CFTR-ENaC on spinal cord edema after spinal cord injury
  147. Irisin-regulated lncRNAs and their potential regulatory functions in chondrogenic differentiation of human mesenchymal stem cells
  148. DMD mutations in pediatric patients with phenotypes of Duchenne/Becker muscular dystrophy
  149. Combination of C-reactive protein and fibrinogen-to-albumin ratio as a novel predictor of all-cause mortality in heart failure patients
  150. Significant role and the underly mechanism of cullin-1 in chronic obstructive pulmonary disease
  151. Ferroptosis-related prognostic model of mantle cell lymphoma
  152. Observation of choking reaction and other related indexes in elderly painless fiberoptic bronchoscopy with transnasal high-flow humidification oxygen therapy
  153. A bibliometric analysis of Prader-Willi syndrome from 2002 to 2022
  154. The causal effects of childhood sunburn occasions on melanoma: A univariable and multivariable Mendelian randomization study
  155. Oxidative stress regulates glycogen synthase kinase-3 in lymphocytes of diabetes mellitus patients complicated with cerebral infarction
  156. Role of COX6C and NDUFB3 in septic shock and stroke
  157. Trends in disease burden of type 2 diabetes, stroke, and hypertensive heart disease attributable to high BMI in China: 1990–2019
  158. Purinergic P2X7 receptor mediates hyperoxia-induced injury in pulmonary microvascular endothelial cells via NLRP3-mediated pyroptotic pathway
  159. Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation
  160. Analgesic effect of external oblique intercostal block in laparoscopic cholecystectomy: A retrospective study
  161. Elevated serum miR-142-5p correlates with ischemic lesions and both NSE and S100β in ischemic stroke patients
  162. Correlation between the mechanism of arteriopathy in IgA nephropathy and blood stasis syndrome: A cohort study
  163. Risk factors for progressive kyphosis after percutaneous kyphoplasty in osteoporotic vertebral compression fracture
  164. Predictive role of neuron-specific enolase and S100-β in early neurological deterioration and unfavorable prognosis in patients with ischemic stroke
  165. The potential risk factors of postoperative cognitive dysfunction for endovascular therapy in acute ischemic stroke with general anesthesia
  166. Fluoxetine inhibited RANKL-induced osteoclastic differentiation in vitro
  167. Detection of serum FOXM1 and IGF2 in patients with ARDS and their correlation with disease and prognosis
  168. Rhein promotes skin wound healing by activating the PI3K/AKT signaling pathway
  169. Differences in mortality risk by levels of physical activity among persons with disabilities in South Korea
  170. Review Articles
  171. Cutaneous signs of selected cardiovascular disorders: A narrative review
  172. XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis
  173. A narrative review on adverse drug reactions of COVID-19 treatments on the kidney
  174. Emerging role and function of SPDL1 in human health and diseases
  175. Adverse reactions of piperacillin: A literature review of case reports
  176. Molecular mechanism and intervention measures of microvascular complications in diabetes
  177. Regulation of mesenchymal stem cell differentiation by autophagy
  178. Molecular landscape of borderline ovarian tumours: A systematic review
  179. Advances in synthetic lethality modalities for glioblastoma multiforme
  180. Investigating hormesis, aging, and neurodegeneration: From bench to clinics
  181. Frankincense: A neuronutrient to approach Parkinson’s disease treatment
  182. Sox9: A potential regulator of cancer stem cells in osteosarcoma
  183. Early detection of cardiovascular risk markers through non-invasive ultrasound methodologies in periodontitis patients
  184. Advanced neuroimaging and criminal interrogation in lie detection
  185. Maternal factors for neural tube defects in offspring: An umbrella review
  186. The chemoprotective hormetic effects of rosmarinic acid
  187. CBD’s potential impact on Parkinson’s disease: An updated overview
  188. Progress in cytokine research for ARDS: A comprehensive review
  189. Utilizing reactive oxygen species-scavenging nanoparticles for targeting oxidative stress in the treatment of ischemic stroke: A review
  190. NRXN1-related disorders, attempt to better define clinical assessment
  191. Lidocaine infusion for the treatment of complex regional pain syndrome: Case series and literature review
  192. Trends and future directions of autophagy in osteosarcoma: A bibliometric analysis
  193. Iron in ventricular remodeling and aneurysms post-myocardial infarction
  194. Case Reports
  195. Sirolimus potentiated angioedema: A case report and review of the literature
  196. Identification of mixed anaerobic infections after inguinal hernia repair based on metagenomic next-generation sequencing: A case report
  197. Successful treatment with bortezomib in combination with dexamethasone in a middle-aged male with idiopathic multicentric Castleman’s disease: A case report
  198. Complete heart block associated with hepatitis A infection in a female child with fatal outcome
  199. Elevation of D-dimer in eosinophilic gastrointestinal diseases in the absence of venous thrombosis: A case series and literature review
  200. Four years of natural progressive course: A rare case report of juvenile Xp11.2 translocations renal cell carcinoma with TFE3 gene fusion
  201. Advancing prenatal diagnosis: Echocardiographic detection of Scimitar syndrome in China – A case series
  202. Outcomes and complications of hemodialysis in patients with renal cancer following bilateral nephrectomy
  203. Anti-HMGCR myopathy mimicking facioscapulohumeral muscular dystrophy
  204. Recurrent opportunistic infections in a HIV-negative patient with combined C6 and NFKB1 mutations: A case report, pedigree analysis, and literature review
  205. Letter to the Editor
  206. Letter to the Editor: Total parenteral nutrition-induced Wernicke’s encephalopathy after oncologic gastrointestinal surgery
  207. Erratum
  208. Erratum to “Bladder-embedded ectopic intrauterine device with calculus”
  209. Retraction
  210. Retraction of “XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis”
  211. Corrigendum
  212. Corrigendum to “Investigating hormesis, aging, and neurodegeneration: From bench to clinics”
  213. Corrigendum to “Frankincense: A neuronutrient to approach Parkinson’s disease treatment”
  214. Special Issue The evolving saga of RNAs from bench to bedside - Part II
  215. Machine-learning-based prediction of a diagnostic model using autophagy-related genes based on RNA sequencing for patients with papillary thyroid carcinoma
  216. Unlocking the future of hepatocellular carcinoma treatment: A comprehensive analysis of disulfidptosis-related lncRNAs for prognosis and drug screening
  217. Elevated mRNA level indicates FSIP1 promotes EMT and gastric cancer progression by regulating fibroblasts in tumor microenvironment
  218. Special Issue Advancements in oncology: bridging clinical and experimental research - Part I
  219. Ultrasound-guided transperineal vs transrectal prostate biopsy: A meta-analysis of diagnostic accuracy and complication rates
  220. Assessment of diagnostic value of unilateral systematic biopsy combined with targeted biopsy in detecting clinically significant prostate cancer
  221. SENP7 inhibits glioblastoma metastasis and invasion by dissociating SUMO2/3 binding to specific target proteins
  222. MARK1 suppress malignant progression of hepatocellular carcinoma and improves sorafenib resistance through negatively regulating POTEE
  223. Analysis of postoperative complications in bladder cancer patients
  224. Carboplatin combined with arsenic trioxide versus carboplatin combined with docetaxel treatment for LACC: A randomized, open-label, phase II clinical study
  225. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part I
  226. Comprehensive pan-cancer investigation of carnosine dipeptidase 1 and its prospective prognostic significance in hepatocellular carcinoma
  227. Identification of signatures associated with microsatellite instability and immune characteristics to predict the prognostic risk of colon cancer
  228. Single-cell analysis identified key macrophage subpopulations associated with atherosclerosis
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 25.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0875/html
Scroll to top button