Skip to main content
Article Open Access

Decreased BIRC5-206 promotes epithelial–mesenchymal transition in nasopharyngeal carcinoma through sponging miR-145-5p

  • , , , , , EMAIL logo and EMAIL logo
Published/Copyright: September 17, 2024

Abstract

Metastasis significantly contributes to the poor prognosis of advanced nasopharyngeal carcinoma (NPC). Our prior studies have demonstrated a decrease in BIRC5-206 expression in NPC, which promotes disease progression. However, the role of BIRC5-206 in the invasion and metastasis of NPC has not been fully elucidated. In this study, our objective was to explore the biological function and underlying mechanisms of BIRC5-206 in NPC. Additionally, we established an NPC mouse model of lung invasiveness using C666 cells to assess the impact of BIRC5-206 on NPC metastasis. Our results revealed that silencing BIRC5-206 inhibited apoptosis and enhanced the invasion of NPC cells, whereas its overexpression reversed these effects. Moreover, decreased BIRC5-206 expression significantly increased N-cadherin and Vimentin expression while reducing E-cadherin and occludin levels, both in vivo and in vitro. Additionally, silencing BIRC5-206 markedly augmented the formation of invasive foci in lung tissues. Rescue experiments further confirmed that decreased BIRC5-206 expression facilitates NPC metastasis via modulation of the miR-145-5p/CD40 signaling pathway. In summary, our study suggests that BIRC5-206 may serve as a potential prognostic biomarker and therapeutic target in the diagnosis and treatment of NPC.

1 Introduction

Nasopharyngeal carcinoma (NPC) is a prevalently malignant tumor in otolaryngology and head and neck surgery [1]. In 2020, of the estimated 133,354 newly diagnosed cases of NPC and 80,008 associated deaths, the majority are expected to occur in South-East Asia [2]. Notably, China accounts for approximately 80% of global NPC cases, with around 80% of these concentrated in six provinces of South China [3]. The incidence of NPC in these regions is alarmingly high, with annual rates reaching 30–50 cases per 100,000 individuals [4]. Moreover, an increasing trend in the incidence of NPC is anticipated annually in this region. Metastasis remains the leading cause of mortality in patients diagnosed with NPC [5], with the liver and lungs being the most common metastasis sites in NPC cases [4]. Consequently, investigating the molecular mechanisms underlying NPC metastasis and developing new biomarkers for predicting the development of primary nasopharyngeal cancer are of critical importance. Such advancements could significantly enhance the prevention and treatment strategies for NPC.

Research indicates that epithelial–mesenchymal transition (EMT) plays a pivotal role in enhancing the migratory and invasive capabilities of cancer cells [6]. EMT involves the transformation of epithelial cells into a mesenchymal phenotype, marked by the loss of cell–cell junctions and apical–basal polarity, and the acquisition of migratory and invasive characteristics [7]. Molecular markers indicative of EMT include the downregulation of epithelial markers like E-cadherin and occludin and the upregulation of mesenchymal markers like N-cadherin, vimentin, and fibronectin [810]. Moreover, EMT is associated with various cancer-related features, including resistance to apoptosis, the acquisition of stem cell-like traits, and resistance to chemotherapy [1113].

BIRC5, prominently overexpressed in virtually all human malignancies, is strongly associated with a spectrum of aggressive tumor characteristics [14,15]. Elevated expression of Survivin (encoded by the BIRC5 gene) correlates with increased tumor aggressiveness, poor therapeutic response, unfavorable prognosis, heightened risk of relapse, and diminished survival rates [1518]. Notably, in stage IV lung cancer patients, BIRC5 levels were found to be significantly higher compared to those in patients without distant metastases, with concentrations escalating in correlation to the number of affected metastatic organ sites [19]. In breast carcinoma, a marked increase in BIRC5 mRNA levels was observed, and its overexpression was linked to a deterioration in both overall and relapse-free survival rates [20]. Furthermore, BIRC5 expression in gastric cancer demonstrated significant associations with gross morphology, depth of invasion, presence of distant metastases, tumor necrosis, metastatic stage, and vascular invasion [21].

Survivin, encoded by the BIRC5 gene, belongs to the inhibitor of apoptosis protein (IAP) family [22]. Unlike other IAP proteins, Survivin is typically expressed during embryonic and fetal development but remains undetectable in normal adult tissues [20]. Survivin gene spans four exons and three introns, encompassing 14,796 nucleotides, and is located on chromosome 17 (17q25) [22]. BIRC5 encodes the wild-type Survivin (WT) isoform, comprising four exons and 142 amino acids (NM_001168.3). Additionally, four known splicing variants of Survivin have been identified: ΔEx3 (Survivin with an exon 3 deletion, 137 amino acids, NM_001012270.2), 2B (Survivin with additional exons, 165 amino acids, NM_001012271.2), 3B (comprising five exons, 120 amino acids, XR_243654.5), and 2α (consisting of two exons, 74 amino acids, XR_934452.3) [20]. The functional attributes of each Survivin variant are influenced by their specific structural characteristics, including the presence or absence of particular domains, which dictate their role in apoptotic or tumorigenic pathway [20].

Survivin proteins are notably overexpressed in NPC and are associated with adverse outcomes, including poor overall survival, lymph node metastasis, local recurrence, distant metastasis, and higher clinical stages [23,24]. In our prior research, we identified a significant downregulation of BIRC5-206 (ENST00000589892.1), a non-coding splice variant of Survivin, which spans 747 base pairs and functions as a non-coding RNA. This downregulation was found to contribute to NPC progression by promoting the transformation of NPC cells into cancer stem cells [25]. However, the specific role and function of BIRC5-206 in NPC metastasis have not been fully determined. Therefore, the primary aim of our current study is to delve into the specific role and molecular mechanisms underlying BIRC5-206 in the invasion and metastasis of NPC. This research is intended to enhance our understanding of NPC pathogenesis and potentially inform the development of more effective therapeutic approaches.

2 Methods

2.1 Cell culture and vector construction and lentiviral infection

The human NPC cell lines C666 and HNE3 were kindly provided by the Nasopharyngeal Cancer Research Laboratory at Guangxi Medical University. These cells were cultured in RPMI 1640 medium (cat. no. 11875119) supplemented with 10% fetal bovine serum (FBS, cat. no. 16140071) and 1% penicillin/streptomycin (cat. no. 15140122) from Gibco (Thermo Fisher Scientific, Inc.). The culture conditions were atmospheric oxygen tension (∼21%) and 5% CO2 at 37°C.

Human BIRC5-206 sequences from the Ensembl databases (www.ensembl.org, Ensembl gene: ENST00000589892.1), synthesized by GeneChem Co., Ltd (Shanghai, China), were subcloned into a GV358 vector (Component Order: Ubi-MCS-3FLAG-SV40-EGFP-IRES-puromycin) to generate BIRC5-206-overexpressing plasmids. 293T human embryonic kidney cells (Chinese Academy of Medical Science, Beijing, China) were transfected with a mixture of plasmids, including viral packaging plasmids psPAX2 (7.5 µg), envelope plasmid pMD2.G (2.5 µg), and the BIRC5-206 expression plasmid (GV358- BIRC5-206, 25 µg) or the control plasmid (GV358, 25 µg) via Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) based on the manufacturer’s protocol. Lentivirus supernatant was collected and filtered through a 0.45 μM filter 48 h post-transfection.

C666 and HNE3 cells were seeded in six-well plates at a density of 1  ×  105 cells/well and cultured at 5% CO2 and 37°C. The cells were transfected the next day at approximately 70% confluency. Transfection was conducted using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at MOI  =  10 for negative control and MOI  =  20 for lentivirus-BIRC5-206. Post-transfection, C666 and HNE3 cells were incubated at 37°C for 8 h, after which the medium was replaced with fresh complete medium. Puromycin (2 μg/mL) was used to select for puromycin-positive cells 48 h after transfection. The expression of BIRC5-206 was subsequently assessed using quantitative PCR.

A lentivirus carrying BIRC5-206 shRNA was constructed by Genechem Co., Ltd (Shanghai, China) for transfection into C666 and HNE3 cells. The shRNA sequences used were as follows: control shRNA sequence (NC), 5′-TTCTCCGAACGTGTCACGT-3′; BIRC5-206 shRNA-1, 5′-AAGTATGTTCACTATGAAA-3′ (KD1); BIRC5-206 shRNA-2, 5′-CAAGGAACAATCCATTGTT-3′ (KD2). These sequences were cloned into the lentiviral GV493 vectors (Component Order: hU6-MCS-CBh-gcGFPIRES-puromycin). The LV-BIRC5-206-shRNA was transfected into C666 and HNE3 cells upon reaching 60% confluence. Puromycin (2 μg/mL) was used for selection and was removed after 72 h.

2.2 Apoptosis analysis

Apoptosis in C666 and HNE3 cells was assessed using Annexin V and propidium iodide (PI) staining (cat. no. V13241; Thermo Fisher Scientific). The cells were rinsed twice with PBS, centrifuged at 1,000 rpm for 5 min, and then resuspended in 195 μL of Annexin V-FITC/PI binding buffer. To this suspension, Annexin V-FITC (5 μL) and PI (10 μL) were added. Then, the cells were incubated in the dark at room temperature for 40 min. Apoptosis was analyzed using a BD LSR II flow cytometer. For each sample, a total of ten thousand events were collected, and the data were analyzed using CXP analysis software (Beckman-Coulter, Fullerton, CA, USA).

2.3 Cell invasion assay

To evaluate the invasive potential of C666 and HNE3 cells post-transfection with BIRC5-206 lentivirus, a Transwell assay was conducted. Transwell chambers (cat. no. 3402, Corning Life Sciences) were pre-coated with Matrigel (cat. no. 356234; Corning Life Sciences) for 6 h at 37°C. The C666 and HNE3 cells were seeded in the upper compartment of the Transwell at a density of 6 × 103 cells/well. In the lower chamber, 150 μL of serum-free medium was added, while the upper chamber received 600 μL of RPMI 1640 medium (cat. no. 11875119, Gibco). Following 48 h of incubation at 37°C, cells on the basolateral side of the chamber were washed twice with PBS and stained with 1% crystal violet for 30 min at room temperature. After two additional washes with PBS, the stained C666 and HNE3 cells were examined and imaged using a light microscope at 200× magnification (Olympus cX2; Olympus Corporation).

2.4 Western blot

Proteins were extracted from C666 and HNE3 cells using RIPA lysis buffer (cat. no. HY-K1001; MedChemExpress), which contains 1% protease/phosphatase inhibitor cocktail (cat. no. 5872, Cell Signaling). The concentration of the extracted protein was determined using the BCA Protein Assay kit (cat. no. 23225; Thermo Fisher Scientific, Inc.). Isolated proteins (5 μg) were then mixed with 5× SDS-PAGE protein loading sample buffer (cat. no. 20315ES05, Yeasen Biotechnology Co., Ltd, China) and then loaded onto 12% SDS-acrylamide gels for separation by electrophoresis. Post-separation, the proteins were then transferred onto PVDF membranes and blocked with 5% non-fat milk. The membranes were incubated overnight at 4°C with primary antibodies, including anti-CD40 (1:1,000; cat. no. ab252557; Abcam), anti-N-cadherin (1:1,000; cat. no. ab76011; Abcam), anti-Vimentin (1:1,000; cat. no. ab92547; Abcam), anti-E-cadherin (1:1,000; cat. no. ab40772; Abcam), anti-occludin (1:1,000; cat. no. ab216327; Abcam), and anti-GAPDH (1:10,000; cat. no. ab181602; Abcam). Following the primary antibody incubation, the membranes were washed and then incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody (1:10,000; cat. no. ab6721; Abcam) for 1 h at room temperature. The protein bands were visualized using ECL western blot detection reagents (Thermo Fisher Scientific, Inc.), and their intensities were quantified using ImageJ software (Version 1.5.3, NIH ImageJ system).

2.5 Lung invasiveness assay in a nude mouse model

BALB/c mice, 6 weeks of age, were acquired from Beijing HFK Bioscience Co., Ltd. The mice were housed in a specific pathogen-free facility under controlled environmental conditions, with the temperature maintained at 23 ± 2℃. The mice had free access to food and water and were subjected to a 12-h light/dark cycle for 1 week to acclimatize. In the experiment, the mice received an intravenous injection via the lateral tail vein with a suspension of either NC (negative control) or BIRC5-206 knockdown C666 cells (4 × 105 cells/mouse) in 0.1 mL of PBS. After 6 weeks, the mice were euthanized, and their lungs were extracted and photographed with a ruler for size measurement. All animal procedures were performed in accordance with the guidelines for experimental animal care and use.

2.6 Hematoxylin and eosin (HE) staining and immunohistochemistry (IHC)

For histological examination, mouse lung tissues were fixed with 4% paraformaldehyde at room temperature for 24 h and subsequently washed with 70% alcohol. The tissues were then embedded in paraffin and sectioned at a thickness of 5 µm. The sections were stained using a Hematoxylin and Eosin Staining Kit (cat. no. C0105M; Beyotime) following the manufacturer’s instructions. Digital images were captured at a magnification of ×20 using a DP71 digital microscope camera attached to an Olympus microscope.

For IHC staining, the dewaxed, rehydrated tissue sections underwent antigen retrieval and blocking of endogenous peroxidase activity as per the manufacturer’s protocols. Antibodies against N-cadherin (1:200; cat. no. ab76011; Abcam), Vimentin (1:200; cat. no. ab92547; Abcam), E-cadherin (1:200; cat. no. ab40772; Abcam), and occludin (1:200; cat. no. ab216327; Abcam) were applied to the sections and incubated overnight at 4°C. This was followed by incubation with a biotinylated secondary goat anti-rabbit antibody at room temperature for 30 min. 3,3′-Diaminobenzidine was used as the chromogen, with hematoxylin as the counterstain. The stained slides were digitized using the Aperio ScanScope CS Slide Scanner (Aperio Technologies). Three randomly selected fields of view per section were analyzed to calculate the mean and standard error of the mean of cells exhibiting positive staining.

2.7 RNA fluorescence in situ hybridization (FISH)

An RNA FISH assay was performed using the Ribo lncRNA FISH Probe Kit (cat. no. C10920, Ribo, China) following the manufacturer’s instructions. Briefly, C666 and HNE3 cells were cultured and fixed with 4% paraformaldehyde at room temperature. Following thorough washing, the cells were incubated overnight with hybridization solutions containing the digoxin-labeled BIRC5-206 probe (GAGGCTGCAGTGAGTTGTGACCGCACCGCTGCACTCCAGC). Subsequently, the cell nuclei were stained with DAPI for 15 min. The cells were then visualized and images were captured using a fluorescence microscope (Olympus, Japan).

2.8 Target gene prediction

The Bibiserv database (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/) is used to predict the target miRNAs of BIRC5-206. The target gene prediction database Targetscan (version 6.2; http://www.targetscan.org) was used to identify potential targets of miR-145-5p.

2.9 Luciferase activity assay and RNA immunoprecipitation (RIP)

The 3′-UTR of BIRC5-206 or CD40 was amplified and subcloned into the pMIR luciferase reporter vector. Similarly, mutant fragments of BIRC5-206 and CD40 were inserted into the pMIR luciferase reporter vector. The luciferase report vector (carrying BIRC5-206-WT/MUT or CD40-WT/MUT) was transfected into 293T cells with either miR-145-5p or miR-NC. The relative luciferase activity in each group was determined at 48 h post-transfection using a luciferase assay kit (Pharmingen, San Diego, CA, USA).

A RIP assay was conducted using the RIP Kit (cat. no. Bes5101, BersinBio, China). C666 cells were washed with pre-chilled PBS and lysed in RIP buffer at 4°C for 30 min. Magnetic beads conjugated with human anti-Ago2 antibodies (cat. no. APREST91863, PrEST Antigen) or normal mouse immunoglobulin G (IgG; cat. no. 2729; Cell Signaling Technology, USA) were employed to capture the RNAs. RNA was then extracted from the precipitates using TRIzol reagent (cat. no. 9108, Takara Biotechnology, China). The expression levels of BIRC5-206 and miR-145-5p were quantified using RT-PCR. The primers for the target genes are as follows: miR-145-5p RT: 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAT-3′; miR-145-5p forward 5′-GCCGAGGTCCAGTTTTCCCAGGA-3′ and reverse 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG-3′; BIRC5-206 forward 5′-ATGTGGGGGGAGATGTCCAC-3′ and reverse 5′-GCAGTCCACTCCCCACGG-3′.

2.10 miR-145-5p mimic and inhibitor transfections

The miR-145-5p mimic (5′-GUCCAGUUUUCCCAGGAAUCCCU-3′), mimic negative control (Mimic-NC, 5′-CGCGAGUUAACGGACCAUACGGU-3′), miR-145-5p inhibitor (5′-AGGGAUUCCUGGGAAAACUGGAC-3′), and inhibitor negative control (Inhibitor-NC, 5′-CAGUACUUUUGUGUAGUACAA-3′) were synthesized by Shanghai GenePharma Company. The miR-145-5p mimic, mimic NC, miR-145-5p inhibitor, and inhibitor NC were delivered into C666 cells using Oligofectamine™ according to the manufacturer’s instructions.

2.11 Quantitative real-time polymerase chain reaction (qPCR)

Total RNA was extracted from C666 and HNE3 cells using TRIzol reagent (cat. no. 9108, Takara Biotechnology, China). The concentration of RNA was measured using an ND-2000 Spectrophotometer (Thermo Fisher Scientific, USA). qPCR was performed using a 7300 Real-Time PCR System (Applied Biosystems). The PCR amplification protocol included an initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 5 s and annealing/extension at 61°C for 30 s. The qPCR results were analyzed using the 2−ΔΔCt method [26]. The expression levels of CD40 and BIRC5-206/miR-145-5p were normalized to the reference genes GAPDH and U6, respectively. The primers for the target genes were as follows: BIRC5-206 forward 5′-GAGGCTGGCTTCATCCACTG-3′ and reverse 5′-TGGTTTCCTTTGCATGGGGT-3′; miR-145-5p forward: 5′-ACACTCCAGCTGGGGTCCAGTTTTCCCAGGA-3′, reverse: 5′-GTCCAGTTTTCCCAGGAATCCCTAGGGATTC-3′; U6 forward: 5′-CTCGCTTCGGCAGCACA-3′, reverse: 5′-AACGCTTCACGAATTTGCGT-3′. CD40 forward 5′-CTGATGTTGTCTGTGGTCCCC-3′ and reverse 5′-TGGCCACCTTTTTGATAAAGACC-3′; and GAPDH forward 5′-CACCATCTTCCAGGAGCGAG-3′ and reverse 5′-AAATGAGCCCCAGCCTTCTC-3′.

2.12 Statistical analysis

Statistical analysis was carried out using GraphPad Prism software (version 8.0; California, USA). Each experiment was repeated three times, and the data are presented as mean ± standard deviation. Comparisons between two groups were made using Student’s t-test, while one-way analysis of variance test was employed for multiple comparisons, followed by Duncan’s post hoc test. A p-value of less than 0.05 was considered to indicate statistical significance.

  1. Ethical approval: The experimental protocol was approved by the Ethics Committee of Hainan General Hospital (ethical approval number: YYFY-LL-2023-121).

3 Results

3.1 Decreased BIRC5-206 contributed to the invasion of NPC cells

To explore the potential role of BIRC5-206 in NPC, we performed experiments involving the knockdown and overexpression of BIRC5-206 in NPC cell lines C666 and HNE3. We observed a significant decrease in the mRNA levels of BIRC5-206 in the knockdown groups, confirming the successful downregulation of BIRC5-206 in C666 and HNE3 cells (p < 0.001, Figure 1a). Flow cytometry analysis revealed a marked reduction in the apoptosis rate of these cells following BIRC5-206 knockdown (p < 0.001, Figure 1b and c). Additionally, BIRC5-206 knockdown significantly enhanced the invasion ability of both C666 and HNE3 cells (p < 0.001, Figure 1d). In contrast, overexpressing BIRC5-206 produced opposite effects. The mRNA levels of BIRC5-206 were significantly increased in the overexpression groups, indicating successful upregulation of BIRC5-206 in C666 and HNE3 cells (p < 0.001, Figure 2a). Flow cytometry analysis showed a significant increase in the apoptosis rate of these cells following BIRC5-206 overexpression (p < 0.001, Figure 2b and c). Notably, heightened levels of BIRC5-206 resulted in the upregulation of the pro-apoptotic gene Bax and cleaved caspase-3, while concurrently suppressing the expression of the anti-apoptotic gene BCL-2 in C666 and HNE3 cells (Figure 2d). Furthermore, overexpression of BIRC5-206 substantially reduced the invasion ability of C666 and HNE3 cells (p < 0.05, p < 0.001, Figure 2e and f).

Figure 1 
                  Decreased BIRC5-206 enhances the invasion of NPC cells. Human NPC cell lines C666 and HNE3 were transfected with BIRC5-206 shRNA. (a) The mRNA level of BIRC5-206 in C666 and HNE3 cells was detected by qPCR. (b) and (c) The apoptosis rate of C666 and HNE3 cells was evaluated using PI staining detected by Flow cytometry. (d) The invasion ability of C666 and HNE3 cells following BIRC5-206 silencing was assessed using a Transwell invasion assay. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001). Abbreviation: NC-KD, negative control group; KD1, BIRC5-206 knockdown by shRNA-1; KD2, BIRC5-206 knockdown by shRNA-2.
Figure 1

Decreased BIRC5-206 enhances the invasion of NPC cells. Human NPC cell lines C666 and HNE3 were transfected with BIRC5-206 shRNA. (a) The mRNA level of BIRC5-206 in C666 and HNE3 cells was detected by qPCR. (b) and (c) The apoptosis rate of C666 and HNE3 cells was evaluated using PI staining detected by Flow cytometry. (d) The invasion ability of C666 and HNE3 cells following BIRC5-206 silencing was assessed using a Transwell invasion assay. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001). Abbreviation: NC-KD, negative control group; KD1, BIRC5-206 knockdown by shRNA-1; KD2, BIRC5-206 knockdown by shRNA-2.

Figure 2 
                  Overexpression of BIRC5-206 inhibits invasion of NPC cells. C666 and HNE3 cells were transfected with BIRC5-206 overexpression lentivirus. (a) The mRNA level of BIRC5-206 in C666 and HNE3 cells was detected by qPCR. (b) and (c) The apoptosis rate of C666 and HNE3 cells was detected by Flow cytometry. (d) The protein level of Bax, cleav-caspase-3 and BCL-2 in C666 and HNE3 cells was detected by Western blot. (e) and (f) The invasion ability of C666 and HNE3 cells following BIRC5-206 overexpression was assessed using a Transwell invasion assay. Results are expressed as means ± standard deviation (n = 3, *p < 0.05, ***p < 0.001).
Figure 2

Overexpression of BIRC5-206 inhibits invasion of NPC cells. C666 and HNE3 cells were transfected with BIRC5-206 overexpression lentivirus. (a) The mRNA level of BIRC5-206 in C666 and HNE3 cells was detected by qPCR. (b) and (c) The apoptosis rate of C666 and HNE3 cells was detected by Flow cytometry. (d) The protein level of Bax, cleav-caspase-3 and BCL-2 in C666 and HNE3 cells was detected by Western blot. (e) and (f) The invasion ability of C666 and HNE3 cells following BIRC5-206 overexpression was assessed using a Transwell invasion assay. Results are expressed as means ± standard deviation (n = 3, *p < 0.05, ***p < 0.001).

3.2 BIRC5-206 knockdown promoted EMT in vitro

In this study, we explored the effects of BIRC5-206 knockdown on EMT in both in vitro and in vivo settings. Our results show that BIRC5-206 knockdown significantly increased the protein levels of N-cadherin and Vimentin, while simultaneously decreasing the protein levels of E-cadherin and occludin in C666 and HNE3 cells (p < 0.001, Figure 3a). These results indicate that BIRC5-206 knockdown facilitates molecular alterations associated with EMT progression. Conversely, overexpression of BIRC5-206 led to decreased expression of N-cadherin and Vimentin, and increased expression of E-cadherin and occludin (p < 0.001, Figure 3b), indicating that BIRC5-206 is involved in the regulation of EMT in NPC cells. Overall, our results demonstrate that BIRC5-206 knockdown promotes EMT progression in C666 and HNE3 cells, as evidenced by changes in the expression of key EMT markers.

Figure 3 
                  Decreased BIRC5-206 promotes EMT progression in NPC cells. (a) The protein levels of N-cadherin, Vimentin, E-cadherin, and occludin in BIRC5-206 knockdown C666 and HNE3 cells were detected by Western blot. (b) The protein levels of N-cadherin, Vimentin, E-cadherin, and occludin in BIRC5-206 overexpression C666 and HNE3 cells were detected by Western blot. Grayscale analysis of the Western blot results was performed using ImageJ software. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001).
Figure 3

Decreased BIRC5-206 promotes EMT progression in NPC cells. (a) The protein levels of N-cadherin, Vimentin, E-cadherin, and occludin in BIRC5-206 knockdown C666 and HNE3 cells were detected by Western blot. (b) The protein levels of N-cadherin, Vimentin, E-cadherin, and occludin in BIRC5-206 overexpression C666 and HNE3 cells were detected by Western blot. Grayscale analysis of the Western blot results was performed using ImageJ software. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001).

3.3 BIRC5-206 knockdown promoted EMT in vivo

We established a mouse model of lung invasiveness in NPC by intravenously injecting C666 cells with stable luciferase expression and BIRC5-206 knockdown. The tumor sizes in the BIRC5-206 knockdown group were notably larger than those in the control group, as demonstrated by in vivo bioluminescence imaging (Figure 4a and b). HE staining revealed that the lung tissue in the control group maintained normal and well-structured architecture, whereas the lung tissue in the BIRC5-206 knockdown group exhibited disrupted structures due to tumor cell infiltration (Figure 4c). Furthermore, there was a significant increase in the number of invasive foci in the lung tissues of the BIRC5-206 knockdown group compared to the control group (Figure 4d). Notably, IHC demonstrated a significant upregulation of N-cadherin and Vimentin expression levels, along with a notable downregulation of E-cadherin and occludin expression levels in the BIRC5-206 knockdown group (Figure 4e). These findings provide compelling evidence that silencing BIRC5-206 enhances the EMT process in NPC in vivo.

Figure 4 
                  BIRC5-206 knockdown promotes EMT in vivo. 6-Week-old BALB/c mice were used to establish a mouse model of lung metastasis in NPC by intravenously injecting C666 cells with stable luciferase expression and BIRC5-206 knockdown. (a) and (b) In vivo tumor fluorescence images were acquired (n = 6). (c) Histological structure of lung tissues from each group was examined (HE staining, ×200). (d) After 6 weeks, lungs were harvested, and invasiveness foci were counted. Arrows indicate the metastatic foci in the lungs. (e) Immunohistochemistry for N-cadherin, Vimentin, E-cadherin, and occludin in lung tissues. Quantification of positive immunohistochemical staining.
Figure 4

BIRC5-206 knockdown promotes EMT in vivo. 6-Week-old BALB/c mice were used to establish a mouse model of lung metastasis in NPC by intravenously injecting C666 cells with stable luciferase expression and BIRC5-206 knockdown. (a) and (b) In vivo tumor fluorescence images were acquired (n = 6). (c) Histological structure of lung tissues from each group was examined (HE staining, ×200). (d) After 6 weeks, lungs were harvested, and invasiveness foci were counted. Arrows indicate the metastatic foci in the lungs. (e) Immunohistochemistry for N-cadherin, Vimentin, E-cadherin, and occludin in lung tissues. Quantification of positive immunohistochemical staining.

3.4 BIRC5-206 acted as a ceRNA for miR-145-5p in NPC

To elucidate the molecular mechanisms underpinning BIRC5-206’s function in NPC cells, we first analyzed its cellular localization. We found that BIRC5-206 is in both the cytoplasm and nucleus, predominantly in the cytoplasm (Figure 5a). This indicates that BIRC5-206 may function as a competing endogenous RNA (ceRNA) in the cytoplasm, inhibiting EMT in NPC cells. By utilizing the Bibiserv database, we identified miR-145-5p as a potential target miRNA for BIRC5-206 (Figure 5b). To investigate the interaction between BIRC5-206 and miR-145-5p, we performed a dual-luciferase reporter assay. The results revealed that miR-145-5p significantly reduced the luciferase activity of the pmirGLO-BIRC5-206-WT construct, whereas it had no effect on the pmirGLO-BIRC5-206-MUT construct (Figure 5c). Moreover, the expression of miR-145-5p was significantly upregulated in C666 and HNE3 cells following BIRC5-206 knockdown, in comparison to the control group (Figure 5d). Furthermore, RIP analysis confirmed the binding of BIRC5-206 and miR-145-5p mRNAs to the Ago2 protein, further substantiating their interaction (Figure 5e). These findings have led us to identify miR-145-5p as a downstream target of BIRC5-206, and we intend to further explore its role in the molecular mechanisms of NPC.

Figure 5 
                  BIRC5-206 acted as a ceRNA for miR-145-5p in NPC. (a) Subcellular localization of BIRC5-206 in C666 and HNE3 cells was detected by FISH (scale bars: 20 μm). (b) The sequence of miR-145-5p binding sites in the 3′-UTR of BIRC5-206. The wild type (WT) and mutated (MUT) reporter constructs of the BIRC5-206 3′-UTR sequence are depicted in the schematic diagram in Figure 5b. (c) Luciferase reporter assay was performed to detect the relative luciferase activities of WT and MUT BIRC5-206 reporters. Luciferase activities were determined using the dual-luciferase reporter assay system. (d) miR-145-5p expression in BIRC5-206 knockdown C666 and HNE3 cells was detected by qPCR. (e) Ago2 RIP assay was conducted to detect the binding of BIRC5-206 and miR-145-5p in C666 cells. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001).
Figure 5

BIRC5-206 acted as a ceRNA for miR-145-5p in NPC. (a) Subcellular localization of BIRC5-206 in C666 and HNE3 cells was detected by FISH (scale bars: 20 μm). (b) The sequence of miR-145-5p binding sites in the 3′-UTR of BIRC5-206. The wild type (WT) and mutated (MUT) reporter constructs of the BIRC5-206 3′-UTR sequence are depicted in the schematic diagram in Figure 5b. (c) Luciferase reporter assay was performed to detect the relative luciferase activities of WT and MUT BIRC5-206 reporters. Luciferase activities were determined using the dual-luciferase reporter assay system. (d) miR-145-5p expression in BIRC5-206 knockdown C666 and HNE3 cells was detected by qPCR. (e) Ago2 RIP assay was conducted to detect the binding of BIRC5-206 and miR-145-5p in C666 cells. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001).

3.5 BIRC5-206 downregulated the expression of CD40 through sponging miR-145-5p

To elucidate the impact of miR-145-5p on the mechanisms and functions of BIRC5-206, we utilized TargetScan to identify potential direct target genes for miR-145-5p. CD40 was identified as a notable candidate (Figure 6a). We then performed luciferase reporter assays to confirm the interaction between miR-145-5p and CD40. The results showed that miR-145-5p repressed the luciferase activity of the WT CD40 3′-UTR reporter plasmid, whereas this repression was not significant with the mutant (MUT) CD40 3′-UTR reporter plasmid (Figure 6b). Furthermore, qPCR analysis verified the effective modulation of miR-145-5p expression in C666 cells. Overexpression of miR-145-5p using a miR-145-5p mimic led to a significant reduction in BIRC5-206 expression, while inhibition of miR-145-5p resulted in a notable increase in BIRC5-206 expression (Figure 6c and d). Additionally, the miR-145-5p mimic group exhibited a significant decrease in both mRNA and protein expression of CD40, whereas the miR-145-5p inhibitor group exhibited a significant increase in these levels (Figure 6e and f). Furthermore, knockdown of BIRC5-206 in both C666 and HNE3 cells significantly inhibited CD40 mRNA and protein expression (Figure 7a and b). In the lung tissues of mice in a lung metastasis model, a marked increase in miR-145-5p expression (Figure 7c) and a substantial decrease in CD40 expression were observed following BIRC5-206 knockdown (Figure 7d).

Figure 6 
                  BIRC5-206 downregulates CD40 expression by sponging miR-145-5p. (a) The sequence of miR-145-5p binding sites in the 3′-UTR of CD40. The wild type (WT) and mutated (MUT) reporter constructs of the CD40 3′-UTR sequence are depicted in the schematic diagram in Figure 6a. (b) A luciferase reporter assay was performed to assess the relative luciferase activities of WT and MUT CD40 reporters. Luciferase activities were determined using the dual-luciferase reporter assay system. Expression of miR-145-5p (c), BIRC5-206 (d) and CD40 (e) in C666 cells following treatment with miR-145-5p mimic and inhibitor was detected by qPCR. (f) The protein level of CD40 in C666 cells post miR-145-5p mimic and inhibitor treatment was assessed by Western blot. Grayscale analysis of Western blot results was performed using ImageJ software. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001).
Figure 6

BIRC5-206 downregulates CD40 expression by sponging miR-145-5p. (a) The sequence of miR-145-5p binding sites in the 3′-UTR of CD40. The wild type (WT) and mutated (MUT) reporter constructs of the CD40 3′-UTR sequence are depicted in the schematic diagram in Figure 6a. (b) A luciferase reporter assay was performed to assess the relative luciferase activities of WT and MUT CD40 reporters. Luciferase activities were determined using the dual-luciferase reporter assay system. Expression of miR-145-5p (c), BIRC5-206 (d) and CD40 (e) in C666 cells following treatment with miR-145-5p mimic and inhibitor was detected by qPCR. (f) The protein level of CD40 in C666 cells post miR-145-5p mimic and inhibitor treatment was assessed by Western blot. Grayscale analysis of Western blot results was performed using ImageJ software. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001).

Figure 7 
                  BIRC5-206 downregulates CD40 expression by sponging miR-145-5p. (a) CD40 mRNA expression in BIRC5-206 knockdown C666 and HNE3 cells was detected by qPCR. (b) CD40 protein expression in BIRC5-206 knockdown C666 and HNE3 cells was detected by Western blot. (c) miR-145-5p expression in lung tissues of a mouse model of lung metastasis in NPC was detected by qPCR. (d) CD40 protein level in lung tissues of the mouse model was detected by Western blot. Grayscale analysis of Western blot results was performed using ImageJ software. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001).
Figure 7

BIRC5-206 downregulates CD40 expression by sponging miR-145-5p. (a) CD40 mRNA expression in BIRC5-206 knockdown C666 and HNE3 cells was detected by qPCR. (b) CD40 protein expression in BIRC5-206 knockdown C666 and HNE3 cells was detected by Western blot. (c) miR-145-5p expression in lung tissues of a mouse model of lung metastasis in NPC was detected by qPCR. (d) CD40 protein level in lung tissues of the mouse model was detected by Western blot. Grayscale analysis of Western blot results was performed using ImageJ software. Results are expressed as means ± standard deviation (n = 3, ***p < 0.001).

To further investigate the effects of BIRC5-206 and miR-145-5p in NPC cells, we treated C666 cells, which exhibit high BIRC5-206 expression, withmiR-145-5p mimic and inhibitor. The results indicated that compared to the control group, elevated BIRC5-206 expression significantly induced apoptosis in C666 cells, while miR-145-5p mimic markedly inhibited apoptosis (Figure 8a). Additionally, the miR-145-5p mimic partially counteracted the pro-apoptotic effect of high BIRC5-206 expression, whereas the miR-145-5p inhibitor substantially increased the proportion of apoptotic cells (Figure 8a). Moreover, high BIRC5-206 expression significantly reduced the invasion ability of C666 cells, whereas the miR-145-5p mimic markedly enhanced cell invasion (Figure 8b). The miR-145-5p mimic partially offset the inhibitory effect of high BIRC5-206 expression on cell invasion, while the miR-145-5p inhibitor further diminished the invasion capability of C666 cells (Figure 8b). These findings suggest that silencing of BIRC5-206 may facilitate the EMT process in NPC by sponging miR-145-5p, thereby leading to the downregulation of CD40.

Figure 8 
                  miR-145-5p partially mitigates the effect of BIRC5-206 overexpression on the apoptosis and invasion of C666 cells. BIRC5-206 overexpressing C666 cells were transfected with miR-145-5p mimic, mimic negative control (Mimic-NC), miR-145-5p inhibitor, and inhibitor negative control (Inhibitor-NC). (a) The apoptosis rate of C666 cells overexpressing BIRC5-206 and treated with miR-145-5p mimic/inhibitor was evaluated using Flow cytometry. (b) A Transwell invasion assay was conducted to assess the invasion ability of cells treated as described. Results are expressed as means ± standard deviation (n = 3, *p < 0.05, ***p < 0.001).
Figure 8

miR-145-5p partially mitigates the effect of BIRC5-206 overexpression on the apoptosis and invasion of C666 cells. BIRC5-206 overexpressing C666 cells were transfected with miR-145-5p mimic, mimic negative control (Mimic-NC), miR-145-5p inhibitor, and inhibitor negative control (Inhibitor-NC). (a) The apoptosis rate of C666 cells overexpressing BIRC5-206 and treated with miR-145-5p mimic/inhibitor was evaluated using Flow cytometry. (b) A Transwell invasion assay was conducted to assess the invasion ability of cells treated as described. Results are expressed as means ± standard deviation (n = 3, *p < 0.05, ***p < 0.001).

4 Discussion

Tumor metastasis, characterized by the spread of malignant cells from the primary tumor to distant sites within the body, is a complex biological process [27]. It is one of the most severe aspects of cancer, significantly contributing to the reduced survival rates of cancer patients [28]. The 10-year survival rates for stage III and IV NPC cases are reported to be 74–79 and 46–56%, respectively, with stage IV cases exhibiting particularly poor prognosis [29]. Metastasis plays a crucial role in the unfavorable prognosis of advanced NPC, during which NPC cells can spread to nearby lymph nodes or distant organs. This spread poses challenges in completely eradicating the cancer cells and increases the risk of cancer recurrence [30]. However, the molecular mechanisms driving NPC metastasis remain incompletely understood. In our study, we have demonstrated that the downregulation of BIRC5-206 promotes NPC metastasis by targeting the miR-145-5p/CD40 axis.

As the smallest member of the IAP family, Survivin is upregulated in various human cancers and is positively associated with poor prognosis and drug resistance, establishing it as a significant tumor marker [31,32]. Due to its influential role in cancer cell proliferation and apoptosis, therapies targeting Survivin have been developed [14]. Different variants of Survivin, such as WT, 2B, and ΔEx3, are known to have distinct roles in cancer prognosis [33]. Elevated levels of Survivin ΔEx3 correlate with unfavorable clinical outcomes and prognosis in breast cancer [34]. In endometrial carcinomas, Survivin ΔEx3 has been linked to apoptosis, whereas Survivin WT is associated with cell proliferation [35]. The clinical and pathological significance of the Survivin 2B variant remains controversial; some studies associate it with disease progression, poor prognosis, and decreased survival, while others suggest it plays a role in disease remission [3638].

Survivin proteins are highly expressed in NPC and are associated with poor overall survival, lymph node metastasis, local recurrence, distant metastasis, and a higher clinical stage of the disease [23,24]. Our previous research indicated that the noncoding splice variant of Survivin, BIRC5-206 (ENST00000589892.1), is expressed at low levels in NPC cells and promotes tumor progression in NPC, which is distinct from the expression patterns and roles of other known splicing variants of Survivin [25]. However, the specific role of BIRC5-206 in the tumorigenesis of NPC remains not fully understood. To delve deeper into the function of BIRC5-206 in NPC, we investigated its impact on apoptosis and invasion in NPC cell lines C666 and HNE3. Previous studies have shown that reduced Survivin expression suppresses proliferation and induces apoptosis in CNE-2 cells [24,39], while BIRC5-206 silencing decreases apoptosis and enhances invasion in both HONE1 and CNE-2 cells [25]. In this study, we confirmed that BIRC5-206 knockdown reduces apoptosis and increases invasion in C666 and HNE3 cells, aligning with its effects in HONE1 and CNE-2 cells. This observation contrasts with the roles of other Survivin splice variants in NPC progression [2325]. Furthermore, we found that overexpressing BIRC5-206 elevates apoptosis and suppresses invasion in C666 and HNE3 cells. Additionally, in an NPC mouse model of lung invasiveness, the BIRC5-206 knockdown group exhibited a significant increase in invasive foci compared to the control group. These findings, both from in vitro and in vivo studies, indicate that reduced BIRC5-206 expression significantly contributes to NPC metastasis.

EMT, a process where cells transition from an epithelial to a mesenchymal state, is critical in promoting tumor metastasis [40]. This transition endows cancer cells with enhanced migratory and invasive capabilities, enabling them to detach from the primary tumor and migrate through the bloodstream or lymphatic system to establish metastases [40]. EMT involves molecular alterations in epithelial cells, characterized by the loss of cell–cell adhesion and the acquisition of mesenchymal traits [7]. These alterations include the downregulating epithelial markers like E-cadherin and the upregulating mesenchymal markers such as N-cadherin and Vimentin [810]. In our study, we found that knocking down BIRC5-206 significantly increased N-cadherin and Vimentin protein levels, while reducing the expression of E-cadherin and occludin in both C666 and HNE3 cells. In contrast, overexpressing BIRC5-206 produced the opposite effect. Additionally, in the NPC mouse model of lung invasiveness, significant upregulation of N-cadherin and Vimentin, along with downregulation of E-cadherin and occludin, was observed in the lung tissues of the BIRC5-206 knockdown group. These results provide compelling evidence that silencing BIRC5-206 promotes EMT in NPC, both in vitro and in vivo, which may contribute to the enhanced metastatic potential of NPC following BIRC5-206 knockdown.

Long noncoding RNA (lncRNA) is a class of transcripts typically exceeding 200 nucleotides in length, without the capacity to encode proteins [41]. lncRNAs demonstrate a broader structural and functional diversity compared to protein-coding mRNAs. They regulate gene expression through diverse mechanisms, including chromatin modification, transcriptional control, and post-transcriptional regulation [42]. In tumors, dysregulated lncRNAs are intimately linked with tumorigenesis and tumor progression [43]. They can function as tumor suppressors or oncogenes, influencing various biological processes such as cell proliferation, apoptosis, invasion, metastasis, and angiogenesis [43,44]. Several lncRNAs, including LINC00460 [45], NEAT1 [46], LINC00930 [47], and DIAPH1-AS1 [48], have been identified as key players in NPC. One regulatory mechanism of lncRNAs is their role as ceRNAs, where they bind to miRNAs, reducing the miRNA-mediated regulation of target genes [49]. For example, the NEAT1/let-7a-5p axis regulates cisplatin resistance in NPC [46], LINC00460 upregulates IL6 by sequestering miR-149-5p to promote NPC development [45], and lncRNA SNHG1 acts as a ceRNA to mitigate the downregulation of NUAK1 by miR-145a-5p in NPC cells [50]. In this study, bioinformatics analysis predicted miR-145-5p as a direct target of BIRC5-206, a finding further substantiated by luciferase reporter and RIP assays. We also noted a negative correlation between the expression levels of BIRC5-206 and miR-145-5p both in vitro and in vivo. Functional experiments with miR-145-5p mimic and inhibitor partially counteracted and enhanced, respectively, the effects of high BIRC5-206 expression on cell apoptosis and invasion. Thus, we propose that BIRC5-206 downregulation leads to miR-145-5p upregulation, thereby facilitating the progression of EMT in NPC cells.

miR-145 is highly expressed in various malignancies and plays a significant role in cancer initiation and therapeutic resistance [51]. It functions in cancer by regulating downstream molecules or by being regulated by upstream lncRNA and circRNA, which act as ceRNA. For instance, the lncRNA ROR/miR-145-5p axis promotes osteoblast proliferation in osteoporosis [52], and silencing of lncRNA MALAT1 enhances erastin-induced ferroptosis in endometriosis via the miR-145-5p/MUC1 signaling pathway [53]. Furthermore, hsa_circ_0001955/miR-145-5p augments the proliferation and invasion of HCC cells by targeting NRAS [54]. In our study, we identified CD40 as a crucial effector of miR-145-5p. CD40, a member of the tumor necrosis factor receptor superfamily, is present on the surface of T cells [55]. The interaction between CD40 and CD154 can activate T cells, eliciting an immune response against tumors [56]. Decreased CD40 expression has been linked to poor responses to immune checkpoint blockade therapy and unfavorable clinical outcomes [57]. Through bioinformatics analysis, we predicted CD40 as a direct target of miR-145-5p, a finding that was confirmed by luciferase reporter assays. The overexpression of the miR-145-5p mimic inhibited CD40 protein levels while inhibiting miR-145-5p significantly increased CD40 protein levels. We also demonstrated that silencing BIRC5-206 led to decreased CD40 protein levels both in vivo and in vitro. CD40 has been identified as a novel partial EMT-specific marker [58]. It has been observed that CD40 expression is upregulated in cells undergoing partial EMT but decreased in fully transitioned EMT cells. Additionally, the interactions between CD40 and CD40L play a crucial role during EMT and aortic remodeling [59]. Based on these results, we hypothesize that BIRC5-206 downregulation decreases CD40 expression through direct interaction with miR-145-5p, thereby facilitating NPC metastasis by promoting EMT progression. Our findings indicate that BIRC5-206 is closely associated with NPC progression, suggesting its potential as a biomarker with significant prognostic and therapeutic value.

5 Conclusion

The downregulation of BIRC5-206 facilitates the EMT process in NPC by functioning as a sponge for miR-145-5p, which consequently leads to the downregulation of CD40. These significant findings highlight BIRC5-206 as a promising novel prognostic biomarker and potential therapeutic target for the diagnosis and treatment of NPC.


# These authors contributed equally to this research.


Acknowledgments

We thank the Guangxi Medical University Nasopharyngeal Cancer Research Laboratory for providing the nasopharyngeal cell lines.

  1. Funding information: This work was supported by the National Natural Science Foundation of China (81960389) and Key R&D Plan Projects of Hainan Province (ZDYF2021SHFZ085) and the Academician Innovation Platform of Hainan Province.

  2. Author contributions: WX, JH, and XC conceived and designed this study. WX, JH, ZM, and SF performed experiments. WF and WG performed the analyses and also participated in the study design. SF wrote the manuscript. WX and XC confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Bossi P, Chan AT, Licitra L, Trama A, Orlandi E, Hui EP, et al. Nasopharyngeal carcinoma: ESMO-EURACAN clinical practice guidelines for diagnosis, treatment and follow-up(dagger). Ann Oncol. 2021;32(4):452–65.Search in Google Scholar

[2] Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209–49.Search in Google Scholar

[3] Lee HM, Okuda KS, Gonzalez FE, Patel V. Current perspectives on nasopharyngeal carcinoma. Adv Exp Med Biol. 2019;1164:11–34.Search in Google Scholar

[4] Chen YP, Chan ATC, Le QT, Blanchard P, Sun Y, Ma J. Nasopharyngeal carcinoma. Lancet. 2019;394(10192):64–80.Search in Google Scholar

[5] Chen YP, Lv JW, Mao YP, Li XM, Li JY, Wang YQ, et al. Unraveling tumour microenvironment heterogeneity in nasopharyngeal carcinoma identifies biologically distinct immune subtypes predicting prognosis and immunotherapy responses. Mol Cancer. 2021;20(1):14.Search in Google Scholar

[6] Mittal V. Epithelial mesenchymal transition in tumor metastasis. Annu Rev Pathol. 2018;13:395–412.Search in Google Scholar

[7] Manfioletti G, Fedele M. Epithelial-mesenchymal transition (EMT). Int J Mol Sci. 2022;23(10):5848.Search in Google Scholar

[8] Wei J, Wu L, Yang S, Zhang C, Feng L, Wang M, et al. E-cadherin to N-cadherin switching in the TGF-beta1 mediated retinal pigment epithelial to mesenchymal transition. Exp Eye Res. 2022;220:109085.Search in Google Scholar

[9] Grasset EM, Dunworth M, Sharma G, Loth M, Tandurella J, Cimino-Mathews A, et al. Triple-negative breast cancer metastasis involves complex epithelial-mesenchymal transition dynamics and requires vimentin. Sci Transl Med. 2022;14(656):eabn7571.Search in Google Scholar

[10] Wu J, He Z, Yang XM, Li KL, Wang DL, Sun FL. RCCD1 depletion attenuates TGF-beta-induced EMT and cell migration by stabilizing cytoskeletal microtubules in NSCLC cells. Cancer Lett. 2017;400:18–29.Search in Google Scholar

[11] Jinesh GG, Brohl AS. Classical epithelial-mesenchymal transition (EMT) and alternative cell death process-driven blebbishield metastatic-witch (BMW) pathways to cancer metastasis. Signal Transduct Target Ther. 2022;7(1):296.Search in Google Scholar

[12] Dai ZT, Xiang Y, Duan YY, Wang J, Li JP, Zhang HM, et al. MiR-17-5p and MKL-1 modulate stem cell characteristics of gastric cancer cells. Int J Biol Sci. 2021;17(9):2278–93.Search in Google Scholar

[13] Debaugnies M, Rodriguez-Acebes S, Blondeau J, Parent MA, Zocco M, Song Y, et al. RHOJ controls EMT-associated resistance to chemotherapy. Nature. 2023;616(7955):168–75.Search in Google Scholar

[14] Li F, Aljahdali I, Ling X. Cancer therapeutics using survivin BIRC5 as a target: what can we do after over two decades of study? J Exp Clin Cancer Res. 2019;38(1):368.Search in Google Scholar

[15] Faldt Beding A, Larsson P, Helou K, Einbeigi Z, Parris TZ. Pan-cancer analysis identifies BIRC5 as a prognostic biomarker. BMC Cancer. 2022;22(1):322.Search in Google Scholar

[16] Fukuda S, Pelus LM. Survivin, a cancer target with an emerging role in normal adult tissues. Mol Cancer Ther. 2006;5(5):1087–98.Search in Google Scholar

[17] Frazzi R. BIRC3 and BIRC5: multi-faceted inhibitors in cancer. Cell Biosci. 2021;11(1):8.Search in Google Scholar

[18] Li D, Hu C, Li H. Survivin as a novel target protein for reducing the proliferation of cancer cells. Biomed Rep. 2018;8(5):399–406.Search in Google Scholar

[19] Puskas R, Bikov A, Horvath P, Lazar Z, Kunos L, Nagy R, et al. Circulating survivin protein levels in lung cancer patients treated with platinum-based chemotherapy. Pathol Oncol Res. 2021;27:631969.Search in Google Scholar

[20] Martinez-Sifuentes MA, Bassol-Mayagoitia S, Nava-Hernandez MP, Ruiz-Flores P, Ramos-Trevino J, Haro-Santa Cruz J, et al. Survivin in breast cancer: A review. Genet Test Mol Biomarkers. 2022;26(9):411–21.Search in Google Scholar

[21] Yusufu A, Tuerdi R, Redati D, Rehemutula A, Zhao ZL, Wang HJ. Expression and clinical correlation of Survivin and PTEN in gastric cancer patients. Oncol Lett. 2020;20(6):297.Search in Google Scholar

[22] Ambrosini G, Adida C, Altieri DC. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med. 1997;3(8):917–21.Search in Google Scholar

[23] Xie W, Yan O, Liu F, Han Y, Wang H. Prognostic value of survivin in nasopharyngeal carcinoma: a systematic review and meta-analysis. J Cancer. 2021;12(14):4399–407.Search in Google Scholar

[24] Jin PY, Zheng ZH, Lu HJ, Yan J, Zheng GH, Zheng YL, et al. Roles of beta-catenin, TCF-4, and survivin in nasopharyngeal carcinoma: correlation with clinicopathological features and prognostic significance. Cancer Cell Int. 2019;19:48.Search in Google Scholar

[25] Chen X, Xu W, Ma Z, Shen L, Xie Y, Zhu X, et al. Low expression of BIRC5-206 promotes cancer progression in nasopharyngeal carcinoma via enhancing expression of stem cell markers. Ann Clin Lab Sci. 2023;53(3):380–8.Search in Google Scholar

[26] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.Search in Google Scholar

[27] Han Y, Wang D, Peng L, Huang T, He X, Wang J, et al. Single-cell sequencing: a promising approach for uncovering the mechanisms of tumor metastasis. J Hematol Oncol. 2022;15(1):59.Search in Google Scholar

[28] Fares J, Fares MY, Khachfe HH, Salhab HA, Fares Y. Molecular principles of metastasis: a hallmark of cancer revisited. Signal Transduct Target Ther. 2020;5(1):28.Search in Google Scholar

[29] Wang L, Wu Z, Cheng W, Xie D, Lin F, Xia L, et al. Efficacy of concurrent chemoradiotherapy in subgroups of stage III nasopharyngeal carcinoma: an analysis based on 10-year follow-up. Radiat Oncol. 2021;16(1):215.Search in Google Scholar

[30] Jiromaru R, Nakagawa T, Yasumatsu R. Advanced nasopharyngeal carcinoma: current and emerging treatment options. Cancer Manag Res. 2022;14:2681–9.Search in Google Scholar

[31] Fung S, Knoefel WT, Krieg A. Clinicopathological and prognostic significance of inhibitor of apoptosis protein (IAP) family members in lung cancer: a meta-analysis. Cancers (Basel). 2021;13(16):4098.Search in Google Scholar

[32] Tong X, Yang P, Wang K, Liu Y, Liu X, Shan X, et al. Survivin is a prognostic indicator in glioblastoma and may be a target of microRNA-218. Oncol Lett. 2019;18(1):359–67.Search in Google Scholar

[33] Mishra R, Palve V, Kannan S, Pawar S, Teni T. High expression of survivin and its splice variants survivin DeltaEx3 and survivin 2 B in oral cancers. Oral Surg Oral Med Oral Pathol Oral Radiol. 2015;120(4):497–507.Search in Google Scholar

[34] Khan S, Bennit HF, Turay D, Perez M, Mirshahidi S, Yuan Y, et al. Early diagnostic value of survivin and its alternative splice variants in breast cancer. BMC Cancer. 2014;14:176.Search in Google Scholar

[35] Tazo Y, Hara A, Onda T, Saegusa M. Bifunctional roles of survivin-DeltaEx3 and survivin-2B for susceptibility to apoptosis in endometrial carcinomas. J Cancer Res Clin Oncol. 2014;140:2027–37.Search in Google Scholar

[36] Miliaraki M, Briassoulis P, Ilia S, Polonifi A, Mantzourani M, Briassouli E, et al. Survivin and caspases serum protein levels and survivin variants mRNA expression in sepsis. Sci Rep. 2021;11(1):1049.Search in Google Scholar

[37] Shi K, An J, Shan L, Jiang Q, Li F, Ci Y, et al. Survivin-2B promotes autophagy by accumulating IKK alpha in the nucleus of selenite-treated NB4 cells. Cell Death Dis. 2014;5(2):e1071.Search in Google Scholar

[38] Vivas-Mejia PE, Rodriguez-Aguayo C, Han HD, Shahzad MM, Valiyeva F, Shibayama M, et al. Silencing survivin splice variant 2B leads to antitumor activity in taxane--resistant ovarian cancer. Clin Cancer Res. 2011;17(11):3716–26.Search in Google Scholar

[39] Fu SM, Tu ZH, Deng LQ, Cai JH, Liang Z, Lin ZQ, et al. Induction function of siRNA-mediated survivin gene silencing on nasopharyngeal carcinoma cell apoptosis. Genet Mol Res. 2015;14(1):2537–45.Search in Google Scholar

[40] Bakir B, Chiarella AM, Pitarresi JR, Rustgi AK. EMT, MET, plasticity, and tumor metastasis. Trends Cell Biol. 2020;30(10):764–76.Search in Google Scholar

[41] Herman AB, Tsitsipatis D, Gorospe M. Integrated lncRNA function upon genomic and epigenomic regulation. Mol Cell. 2022;82(12):2252–66.Search in Google Scholar

[42] Tan YT, Lin JF, Li T, Li JJ, Xu RH, Ju HQ. LncRNA-mediated posttranslational modifications and reprogramming of energy metabolism in cancer. Cancer Commun (Lond). 2021;41(2):109–20.Search in Google Scholar

[43] McCabe EM, Rasmussen TP. lncRNA involvement in cancer stem cell function and epithelial-mesenchymal transitions. Semin Cancer Biol. 2021;75:38–48.Search in Google Scholar

[44] Bhan A, Soleimani M, Mandal SS. Long Noncoding RNA and Cancer: A New Paradigm. Cancer Res. 2017;77(15):3965–81.Search in Google Scholar

[45] Kong YG, Cui M, Chen SM, Xu Y, Xu Y, Tao ZZ. LncRNA-LINC00460 facilitates nasopharyngeal carcinoma tumorigenesis through sponging miR-149-5p to up-regulate IL6. Gene. 2018;639:77–84.Search in Google Scholar

[46] Liu F, Tai Y, Ma J. LncRNA NEAT1/let-7a-5p axis regulates the cisplatin resistance in nasopharyngeal carcinoma by targeting Rsf-1 and modulating the Ras-MAPK pathway. Cancer Biol Ther. 2018;19(6):534–42.Search in Google Scholar

[47] He B, Pan H, Zheng F, Chen S, Bie Q, Cao J, et al. Long noncoding RNA LINC00930 promotes PFKFB3-mediated tumor glycolysis and cell proliferation in nasopharyngeal carcinoma. J Exp Clin Cancer Res. 2022;41(1):77.Search in Google Scholar

[48] Li ZX, Zheng ZQ, Yang PY, Lin L, Zhou GQ, Lv JW, et al. WTAP-mediated m(6)A modification of lncRNA DIAPH1-AS1 enhances its stability to facilitate nasopharyngeal carcinoma growth and metastasis. Cell Death Differ. 2022;29(6):1137–51.Search in Google Scholar

[49] Guo K, Qian K, Shi Y, Sun T, Wang Z. LncRNA-MIAT promotes thyroid cancer progression and function as ceRNA to target EZH2 by sponging miR-150-5p. Cell Death Dis. 2021;12(12):1097.Search in Google Scholar

[50] Lan X, Liu X. LncRNA SNHG1 functions as a ceRNA to antagonize the effect of miR-145a-5p on the down-regulation of NUAK1 in nasopharyngeal carcinoma cell. J Cell Mol Med. 2019;23(4):2351–61.Search in Google Scholar

[51] Xu W, Hua Y, Deng F, Wang D, Wu Y, Zhang W, et al. MiR-145 in cancer therapy resistance and sensitivity: A comprehensive review. Cancer Sci. 2020;111(9):3122–31.Search in Google Scholar

[52] Fu Y, Hu X, Gao Y, Li K, Fu Q, Liu Q, et al. LncRNA ROR/miR-145-5p axis modulates the osteoblasts proliferation and apoptosis in osteoporosis. Bioengineered. 2021;12(1):7714–23.Search in Google Scholar

[53] Liang Z, Wu Q, Wang H, Tan J, Wang H, Gou Y, et al. Silencing of lncRNA MALAT1 facilitates erastin-induced ferroptosis in endometriosis through miR-145-5p/MUC1 signaling. Cell Death Discov. 2022;8(1):190.Search in Google Scholar

[54] Ding B, Fan W, Lou W. hsa_circ_0001955 Enhances In Vitro Proliferation, Migration, and Invasion of HCC Cells through miR-145-5p/NRAS Axis. Mol Ther Nucleic Acids. 2020;22:445–55.Search in Google Scholar

[55] Vonderheide RH. CD40 agonist antibodies in cancer immunotherapy. Annu Rev Med. 2020;71:47–58.Search in Google Scholar

[56] Kuhn NF, Purdon TJ, van Leeuwen DG, Lopez AV, Curran KJ, Daniyan AF, et al. CD40 Ligand-modified chimeric antigen receptor T cells enhance antitumor function by eliciting an endogenous antitumor response. Cancer Cell. 2019;35(3):473–88.e6.Search in Google Scholar

[57] Yan C, Richmond A. Hiding in the dark: pan-cancer characterization of expression and clinical relevance of CD40 to immune checkpoint blockade therapy. Mol Cancer. 2021;20(1):146.Search in Google Scholar

[58] Takahashi K, Kobayashi M, Katsumata H, Tokizaki S, Anzai T, Ikeda Y, et al. CD40 is expressed in the subsets of endothelial cells undergoing partial endothelial-mesenchymal transition in tumor microenvironment. Cancer Sci. 2024;115(2):490–506.Search in Google Scholar

[59] Arciniegas E, Becerra A, De Sanctis JB, Graterol A, Ramirez R. CD40 and CD40L expression in the chicken embryo aorta: possible role in the endothelial-mesenchymal transdifferentiation process. Anat Rec A Discovery Mol Cell Evol Biol. 2003;274(2):942–51.Search in Google Scholar

Received: 2024-02-08
Revised: 2024-06-23
Accepted: 2024-07-01
Published Online: 2024-09-17

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway
  3. STK11 (LKB1) mutation suppresses ferroptosis in lung adenocarcinoma by facilitating monounsaturated fatty acid synthesis
  4. Association of SOX6 gene polymorphisms with Kashin-Beck disease risk in the Chinese Han population
  5. The pyroptosis-related signature predicts prognosis and influences the tumor immune microenvironment in dedifferentiated liposarcoma
  6. METTL3 attenuates ferroptosis sensitivity in lung cancer via modulating TFRC
  7. Identification and validation of molecular subtypes and prognostic signature for stage I and stage II gastric cancer based on neutrophil extracellular traps
  8. Novel lumbar plexus block versus femoral nerve block for analgesia and motor recovery after total knee arthroplasty
  9. Correlation between ABCB1 and OLIG2 polymorphisms and the severity and prognosis of patients with cerebral infarction
  10. Study on the radiotherapy effect and serum neutral granulocyte lymphocyte ratio and inflammatory factor expression of nasopharyngeal carcinoma
  11. Transcriptome analysis of effects of Tecrl deficiency on cardiometabolic and calcium regulation in cardiac tissue
  12. Aflatoxin B1 induces infertility, fetal deformities, and potential therapies
  13. Serum levels of HMW adiponectin and its receptors are associated with cytokine levels and clinical characteristics in chronic obstructive pulmonary disease
  14. METTL3-mediated methylation of CYP2C19 mRNA may aggravate clopidogrel resistance in ischemic stroke patients
  15. Understand how machine learning impact lung cancer research from 2010 to 2021: A bibliometric analysis
  16. Pressure ulcers in German hospitals: Analysis of reimbursement and length of stay
  17. Metformin plus L-carnitine enhances brown/beige adipose tissue activity via Nrf2/HO-1 signaling to reduce lipid accumulation and inflammation in murine obesity
  18. Downregulation of carbonic anhydrase IX expression in mouse xenograft nasopharyngeal carcinoma model via doxorubicin nanobubble combined with ultrasound
  19. Feasibility of 3-dimensional printed models in simulated training and teaching of transcatheter aortic valve replacement
  20. miR-335-3p improves type II diabetes mellitus by IGF-1 regulating macrophage polarization
  21. The analyses of human MCPH1 DNA repair machinery and genetic variations
  22. Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy
  23. Comprehensive analysis based on the disulfidptosis-related genes identifies hub genes and immune infiltration for pancreatic adenocarcinoma
  24. Changes of serum CA125 and PGE2 before and after high-intensity focused ultrasound combined with GnRH-a in treatment of patients with adenomyosis
  25. The clinical value of the hepatic venous pressure gradient in patients undergoing hepatic resection for hepatocellular carcinoma with or without liver cirrhosis
  26. Development and validation of a novel model to predict pulmonary embolism in cardiology suspected patients: A 10-year retrospective analysis
  27. Downregulation of lncRNA XLOC_032768 in diabetic patients predicts the occurrence of diabetic nephropathy
  28. Circ_0051428 targeting miR-885-3p/MMP2 axis enhances the malignancy of cervical cancer
  29. Effectiveness of ginkgo diterpene lactone meglumine on cognitive function in patients with acute ischemic stroke
  30. The construction of a novel prognostic prediction model for glioma based on GWAS-identified prognostic-related risk loci
  31. Evaluating the impact of childhood BMI on the risk of coronavirus disease 2019: A Mendelian randomization study
  32. Lactate dehydrogenase to albumin ratio is associated with in-hospital mortality in patients with acute heart failure: Data from the MIMIC-III database
  33. CD36-mediated podocyte lipotoxicity promotes foot process effacement
  34. Efficacy of etonogestrel subcutaneous implants versus the levonorgestrel-releasing intrauterine system in the conservative treatment of adenomyosis
  35. FLRT2 mediates chondrogenesis of nasal septal cartilage and mandibular condyle cartilage
  36. Challenges in treating primary immune thrombocytopenia patients undergoing COVID-19 vaccination: A retrospective study
  37. Let-7 family regulates HaCaT cell proliferation and apoptosis via the ΔNp63/PI3K/AKT pathway
  38. Phospholipid transfer protein ameliorates sepsis-induced cardiac dysfunction through NLRP3 inflammasome inhibition
  39. Postoperative cognitive dysfunction in elderly patients with colorectal cancer: A randomized controlled study comparing goal-directed and conventional fluid therapy
  40. Long-pulsed ultrasound-mediated microbubble thrombolysis in a rat model of microvascular obstruction
  41. High SEC61A1 expression predicts poor outcome of acute myeloid leukemia
  42. Comparison of polymerase chain reaction and next-generation sequencing with conventional urine culture for the diagnosis of urinary tract infections: A meta-analysis
  43. Secreted frizzled-related protein 5 protects against renal fibrosis by inhibiting Wnt/β-catenin pathway
  44. Pan-cancer and single-cell analysis of actin cytoskeleton genes related to disulfidptosis
  45. Overexpression of miR-532-5p restrains oxidative stress response of chondrocytes in nontraumatic osteonecrosis of the femoral head by inhibiting ABL1
  46. Autologous liver transplantation for unresectable hepatobiliary malignancies in enhanced recovery after surgery model
  47. Clinical analysis of incomplete rupture of the uterus secondary to previous cesarean section
  48. Abnormal sleep duration is associated with sarcopenia in older Chinese people: A large retrospective cross-sectional study
  49. No genetic causality between obesity and benign paroxysmal vertigo: A two-sample Mendelian randomization study
  50. Identification and validation of autophagy-related genes in SSc
  51. Long non-coding RNA SRA1 suppresses radiotherapy resistance in esophageal squamous cell carcinoma by modulating glycolytic reprogramming
  52. Evaluation of quality of life in patients with schizophrenia: An inpatient social welfare institution-based cross-sectional study
  53. The possible role of oxidative stress marker glutathione in the assessment of cognitive impairment in multiple sclerosis
  54. Compilation of a self-management assessment scale for postoperative patients with aortic dissection
  55. Left atrial appendage closure in conjunction with radiofrequency ablation: Effects on left atrial functioning in patients with paroxysmal atrial fibrillation
  56. Effect of anterior femoral cortical notch grade on postoperative function and complications during TKA surgery: A multicenter, retrospective study
  57. Clinical characteristics and assessment of risk factors in patients with influenza A-induced severe pneumonia after the prevalence of SARS-CoV-2
  58. Analgesia nociception index is an indicator of laparoscopic trocar insertion-induced transient nociceptive stimuli
  59. High STAT4 expression correlates with poor prognosis in acute myeloid leukemia and facilitates disease progression by upregulating VEGFA expression
  60. Factors influencing cardiovascular system-related post-COVID-19 sequelae: A single-center cohort study
  61. HOXD10 regulates intestinal permeability and inhibits inflammation of dextran sulfate sodium-induced ulcerative colitis through the inactivation of the Rho/ROCK/MMPs axis
  62. Mesenchymal stem cell-derived exosomal miR-26a induces ferroptosis, suppresses hepatic stellate cell activation, and ameliorates liver fibrosis by modulating SLC7A11
  63. Endovascular thrombectomy versus intravenous thrombolysis for primary distal, medium vessel occlusion in acute ischemic stroke
  64. ANO6 (TMEM16F) inhibits gastrointestinal stromal tumor growth and induces ferroptosis
  65. Prognostic value of EIF5A2 in solid tumors: A meta-analysis and bioinformatics analysis
  66. The role of enhanced expression of Cx43 in patients with ulcerative colitis
  67. Choosing a COVID-19 vaccination site might be driven by anxiety and body vigilance
  68. Role of ICAM-1 in triple-negative breast cancer
  69. Cost-effectiveness of ambroxol in the treatment of Gaucher disease type 2
  70. HLA-DRB5 promotes immune thrombocytopenia via activating CD8+ T cells
  71. Efficacy and factors of myofascial release therapy combined with electrical and magnetic stimulation in the treatment of chronic pelvic pain syndrome
  72. Efficacy of tacrolimus monotherapy in primary membranous nephropathy
  73. Mechanisms of Tripterygium wilfordii Hook F on treating rheumatoid arthritis explored by network pharmacology analysis and molecular docking
  74. FBXO45 levels regulated ferroptosis renal tubular epithelial cells in a model of diabetic nephropathy by PLK1
  75. Optimizing anesthesia strategies to NSCLC patients in VATS procedures: Insights from drug requirements and patient recovery patterns
  76. Alpha-lipoic acid upregulates the PPARγ/NRF2/GPX4 signal pathway to inhibit ferroptosis in the pathogenesis of unexplained recurrent pregnancy loss
  77. Correlation between fat-soluble vitamin levels and inflammatory factors in paediatric community-acquired pneumonia: A prospective study
  78. CD1d affects the proliferation, migration, and apoptosis of human papillary thyroid carcinoma TPC-1 cells via regulating MAPK/NF-κB signaling pathway
  79. miR-let-7a inhibits sympathetic nerve remodeling after myocardial infarction by downregulating the expression of nerve growth factor
  80. Immune response analysis of solid organ transplantation recipients inoculated with inactivated COVID-19 vaccine: A retrospective analysis
  81. The H2Valdien derivatives regulate the epithelial–mesenchymal transition of hepatoma carcinoma cells through the Hedgehog signaling pathway
  82. Clinical efficacy of dexamethasone combined with isoniazid in the treatment of tuberculous meningitis and its effect on peripheral blood T cell subsets
  83. Comparison of short-segment and long-segment fixation in treatment of degenerative scoliosis and analysis of factors associated with adjacent spondylolisthesis
  84. Lycopene inhibits pyroptosis of endothelial progenitor cells induced by ox-LDL through the AMPK/mTOR/NLRP3 pathway
  85. Methylation regulation for FUNDC1 stability in childhood leukemia was up-regulated and facilitates metastasis and reduces ferroptosis of leukemia through mitochondrial damage by FBXL2
  86. Correlation of single-fiber electromyography studies and functional status in patients with amyotrophic lateral sclerosis
  87. Risk factors of postoperative airway obstruction complications in children with oral floor mass
  88. Expression levels and clinical significance of serum miR-19a/CCL20 in patients with acute cerebral infarction
  89. Physical activity and mental health trends in Korean adolescents: Analyzing the impact of the COVID-19 pandemic from 2018 to 2022
  90. Evaluating anemia in HIV-infected patients using chest CT
  91. Ponticulus posticus and skeletal malocclusion: A pilot study in a Southern Italian pre-orthodontic court
  92. Causal association of circulating immune cells and lymphoma: A Mendelian randomization study
  93. Assessment of the renal function and fibrosis indexes of conventional western medicine with Chinese medicine for dredging collaterals on treating renal fibrosis: A systematic review and meta-analysis
  94. Comprehensive landscape of integrator complex subunits and their association with prognosis and tumor microenvironment in gastric cancer
  95. New target-HMGCR inhibitors for the treatment of primary sclerosing cholangitis: A drug Mendelian randomization study
  96. Population pharmacokinetics of meropenem in critically ill patients
  97. Comparison of the ability of newly inflammatory markers to predict complicated appendicitis
  98. Comparative morphology of the cruciate ligaments: A radiological study
  99. Immune landscape of hepatocellular carcinoma: The central role of TP53-inducible glycolysis and apoptosis regulator
  100. Serum SIRT3 levels in epilepsy patients and its association with clinical outcomes and severity: A prospective observational study
  101. SHP-1 mediates cigarette smoke extract-induced epithelial–mesenchymal transformation and inflammation in 16HBE cells
  102. Acute hyper-hypoxia accelerates the development of depression in mice via the IL-6/PGC1α/MFN2 signaling pathway
  103. The GJB3 correlates with the prognosis, immune cell infiltration, and therapeutic responses in lung adenocarcinoma
  104. Physical fitness and blood parameters outcomes of breast cancer survivor in a low-intensity circuit resistance exercise program
  105. Exploring anesthetic-induced gene expression changes and immune cell dynamics in atrial tissue post-coronary artery bypass graft surgery
  106. Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism
  107. Analysis of the risk factors of the radiation-induced encephalopathy in nasopharyngeal carcinoma: A retrospective cohort study
  108. Reproductive outcomes in women with BRCA 1/2 germline mutations: A retrospective observational study and literature review
  109. Evaluation of upper airway ultrasonographic measurements in predicting difficult intubation: A cross-section of the Turkish population
  110. Prognostic and diagnostic value of circulating IGFBP2 in pancreatic cancer
  111. Postural stability after operative reconstruction of the AFTL in chronic ankle instability comparing three different surgical techniques
  112. Research trends related to emergence agitation in the post-anaesthesia care unit from 2001 to 2023: A bibliometric analysis
  113. Frequency and clinicopathological correlation of gastrointestinal polyps: A six-year single center experience
  114. ACSL4 mediates inflammatory bowel disease and contributes to LPS-induced intestinal epithelial cell dysfunction by activating ferroptosis and inflammation
  115. Affibody-based molecular probe 99mTc-(HE)3ZHER2:V2 for non-invasive HER2 detection in ovarian and breast cancer xenografts
  116. Effectiveness of nutritional support for clinical outcomes in gastric cancer patients: A meta-analysis of randomized controlled trials
  117. The relationship between IFN-γ, IL-10, IL-6 cytokines, and severity of the condition with serum zinc and Fe in children infected with Mycoplasma pneumoniae
  118. Paraquat disrupts the blood–brain barrier by increasing IL-6 expression and oxidative stress through the activation of PI3K/AKT signaling pathway
  119. Sleep quality associate with the increased prevalence of cognitive impairment in coronary artery disease patients: A retrospective case–control study
  120. Dioscin protects against chronic prostatitis through the TLR4/NF-κB pathway
  121. Association of polymorphisms in FBN1, MYH11, and TGF-β signaling-related genes with susceptibility of sporadic thoracic aortic aneurysm and dissection in the Zhejiang Han population
  122. Application value of multi-parameter magnetic resonance image-transrectal ultrasound cognitive fusion in prostate biopsy
  123. Laboratory variables‐based artificial neural network models for predicting fatty liver disease: A retrospective study
  124. Decreased BIRC5-206 promotes epithelial–mesenchymal transition in nasopharyngeal carcinoma through sponging miR-145-5p
  125. Sepsis induces the cardiomyocyte apoptosis and cardiac dysfunction through activation of YAP1/Serpine1/caspase-3 pathway
  126. Assessment of iron metabolism and iron deficiency in incident patients on incident continuous ambulatory peritoneal dialysis
  127. Tibial periosteum flap combined with autologous bone grafting in the treatment of Gustilo-IIIB/IIIC open tibial fractures
  128. The application of intravenous general anesthesia under nasopharyngeal airway assisted ventilation undergoing ureteroscopic holmium laser lithotripsy: A prospective, single-center, controlled trial
  129. Long intergenic noncoding RNA for IGF2BP2 stability suppresses gastric cancer cell apoptosis by inhibiting the maturation of microRNA-34a
  130. Role of FOXM1 and AURKB in regulating keratinocyte function in psoriasis
  131. Parental control attitudes over their pre-school children’s diet
  132. The role of auto-HSCT in extranodal natural killer/T cell lymphoma
  133. Significance of negative cervical cytology and positive HPV in the diagnosis of cervical lesions by colposcopy
  134. Echinacoside inhibits PASMCs calcium overload to prevent hypoxic pulmonary artery remodeling by regulating TRPC1/4/6 and calmodulin
  135. ADAR1 plays a protective role in proximal tubular cells under high glucose conditions by attenuating the PI3K/AKT/mTOR signaling pathway
  136. The risk of cancer among insulin glargine users in Lithuania: A retrospective population-based study
  137. The unusual location of primary hydatid cyst: A case series study
  138. Intraoperative changes in electrophysiological monitoring can be used to predict clinical outcomes in patients with spinal cavernous malformation
  139. Obesity and risk of placenta accreta spectrum: A meta-analysis
  140. Shikonin alleviates asthma phenotypes in mice via an airway epithelial STAT3-dependent mechanism
  141. NSUN6 and HTR7 disturbed the stability of carotid atherosclerotic plaques by regulating the immune responses of macrophages
  142. The effect of COVID-19 lockdown on admission rates in Maternity Hospital
  143. Temporal muscle thickness is not a prognostic predictor in patients with high-grade glioma, an experience at two centers in China
  144. Luteolin alleviates cerebral ischemia/reperfusion injury by regulating cell pyroptosis
  145. Therapeutic role of respiratory exercise in patients with tuberculous pleurisy
  146. Effects of CFTR-ENaC on spinal cord edema after spinal cord injury
  147. Irisin-regulated lncRNAs and their potential regulatory functions in chondrogenic differentiation of human mesenchymal stem cells
  148. DMD mutations in pediatric patients with phenotypes of Duchenne/Becker muscular dystrophy
  149. Combination of C-reactive protein and fibrinogen-to-albumin ratio as a novel predictor of all-cause mortality in heart failure patients
  150. Significant role and the underly mechanism of cullin-1 in chronic obstructive pulmonary disease
  151. Ferroptosis-related prognostic model of mantle cell lymphoma
  152. Observation of choking reaction and other related indexes in elderly painless fiberoptic bronchoscopy with transnasal high-flow humidification oxygen therapy
  153. A bibliometric analysis of Prader-Willi syndrome from 2002 to 2022
  154. The causal effects of childhood sunburn occasions on melanoma: A univariable and multivariable Mendelian randomization study
  155. Oxidative stress regulates glycogen synthase kinase-3 in lymphocytes of diabetes mellitus patients complicated with cerebral infarction
  156. Role of COX6C and NDUFB3 in septic shock and stroke
  157. Trends in disease burden of type 2 diabetes, stroke, and hypertensive heart disease attributable to high BMI in China: 1990–2019
  158. Purinergic P2X7 receptor mediates hyperoxia-induced injury in pulmonary microvascular endothelial cells via NLRP3-mediated pyroptotic pathway
  159. Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation
  160. Analgesic effect of external oblique intercostal block in laparoscopic cholecystectomy: A retrospective study
  161. Elevated serum miR-142-5p correlates with ischemic lesions and both NSE and S100β in ischemic stroke patients
  162. Correlation between the mechanism of arteriopathy in IgA nephropathy and blood stasis syndrome: A cohort study
  163. Risk factors for progressive kyphosis after percutaneous kyphoplasty in osteoporotic vertebral compression fracture
  164. Predictive role of neuron-specific enolase and S100-β in early neurological deterioration and unfavorable prognosis in patients with ischemic stroke
  165. The potential risk factors of postoperative cognitive dysfunction for endovascular therapy in acute ischemic stroke with general anesthesia
  166. Fluoxetine inhibited RANKL-induced osteoclastic differentiation in vitro
  167. Detection of serum FOXM1 and IGF2 in patients with ARDS and their correlation with disease and prognosis
  168. Rhein promotes skin wound healing by activating the PI3K/AKT signaling pathway
  169. Differences in mortality risk by levels of physical activity among persons with disabilities in South Korea
  170. Review Articles
  171. Cutaneous signs of selected cardiovascular disorders: A narrative review
  172. XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis
  173. A narrative review on adverse drug reactions of COVID-19 treatments on the kidney
  174. Emerging role and function of SPDL1 in human health and diseases
  175. Adverse reactions of piperacillin: A literature review of case reports
  176. Molecular mechanism and intervention measures of microvascular complications in diabetes
  177. Regulation of mesenchymal stem cell differentiation by autophagy
  178. Molecular landscape of borderline ovarian tumours: A systematic review
  179. Advances in synthetic lethality modalities for glioblastoma multiforme
  180. Investigating hormesis, aging, and neurodegeneration: From bench to clinics
  181. Frankincense: A neuronutrient to approach Parkinson’s disease treatment
  182. Sox9: A potential regulator of cancer stem cells in osteosarcoma
  183. Early detection of cardiovascular risk markers through non-invasive ultrasound methodologies in periodontitis patients
  184. Advanced neuroimaging and criminal interrogation in lie detection
  185. Maternal factors for neural tube defects in offspring: An umbrella review
  186. The chemoprotective hormetic effects of rosmarinic acid
  187. CBD’s potential impact on Parkinson’s disease: An updated overview
  188. Progress in cytokine research for ARDS: A comprehensive review
  189. Utilizing reactive oxygen species-scavenging nanoparticles for targeting oxidative stress in the treatment of ischemic stroke: A review
  190. NRXN1-related disorders, attempt to better define clinical assessment
  191. Lidocaine infusion for the treatment of complex regional pain syndrome: Case series and literature review
  192. Trends and future directions of autophagy in osteosarcoma: A bibliometric analysis
  193. Iron in ventricular remodeling and aneurysms post-myocardial infarction
  194. Case Reports
  195. Sirolimus potentiated angioedema: A case report and review of the literature
  196. Identification of mixed anaerobic infections after inguinal hernia repair based on metagenomic next-generation sequencing: A case report
  197. Successful treatment with bortezomib in combination with dexamethasone in a middle-aged male with idiopathic multicentric Castleman’s disease: A case report
  198. Complete heart block associated with hepatitis A infection in a female child with fatal outcome
  199. Elevation of D-dimer in eosinophilic gastrointestinal diseases in the absence of venous thrombosis: A case series and literature review
  200. Four years of natural progressive course: A rare case report of juvenile Xp11.2 translocations renal cell carcinoma with TFE3 gene fusion
  201. Advancing prenatal diagnosis: Echocardiographic detection of Scimitar syndrome in China – A case series
  202. Outcomes and complications of hemodialysis in patients with renal cancer following bilateral nephrectomy
  203. Anti-HMGCR myopathy mimicking facioscapulohumeral muscular dystrophy
  204. Recurrent opportunistic infections in a HIV-negative patient with combined C6 and NFKB1 mutations: A case report, pedigree analysis, and literature review
  205. Letter to the Editor
  206. Letter to the Editor: Total parenteral nutrition-induced Wernicke’s encephalopathy after oncologic gastrointestinal surgery
  207. Erratum
  208. Erratum to “Bladder-embedded ectopic intrauterine device with calculus”
  209. Retraction
  210. Retraction of “XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis”
  211. Corrigendum
  212. Corrigendum to “Investigating hormesis, aging, and neurodegeneration: From bench to clinics”
  213. Corrigendum to “Frankincense: A neuronutrient to approach Parkinson’s disease treatment”
  214. Special Issue The evolving saga of RNAs from bench to bedside - Part II
  215. Machine-learning-based prediction of a diagnostic model using autophagy-related genes based on RNA sequencing for patients with papillary thyroid carcinoma
  216. Unlocking the future of hepatocellular carcinoma treatment: A comprehensive analysis of disulfidptosis-related lncRNAs for prognosis and drug screening
  217. Elevated mRNA level indicates FSIP1 promotes EMT and gastric cancer progression by regulating fibroblasts in tumor microenvironment
  218. Special Issue Advancements in oncology: bridging clinical and experimental research - Part I
  219. Ultrasound-guided transperineal vs transrectal prostate biopsy: A meta-analysis of diagnostic accuracy and complication rates
  220. Assessment of diagnostic value of unilateral systematic biopsy combined with targeted biopsy in detecting clinically significant prostate cancer
  221. SENP7 inhibits glioblastoma metastasis and invasion by dissociating SUMO2/3 binding to specific target proteins
  222. MARK1 suppress malignant progression of hepatocellular carcinoma and improves sorafenib resistance through negatively regulating POTEE
  223. Analysis of postoperative complications in bladder cancer patients
  224. Carboplatin combined with arsenic trioxide versus carboplatin combined with docetaxel treatment for LACC: A randomized, open-label, phase II clinical study
  225. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part I
  226. Comprehensive pan-cancer investigation of carnosine dipeptidase 1 and its prospective prognostic significance in hepatocellular carcinoma
  227. Identification of signatures associated with microsatellite instability and immune characteristics to predict the prognostic risk of colon cancer
  228. Single-cell analysis identified key macrophage subpopulations associated with atherosclerosis
Downloaded on 26.4.2026 from https://www.degruyterbrill.com/document/doi/10.1515/med-2024-1007/html?lang=en
Scroll to top button