Home Medicine Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation
Article Open Access

Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation

  • Chengrong Wu , Hualei Cai EMAIL logo , Qian Pu , Lei Yu EMAIL logo , Ashutosh Goswami and Zhongyuan Mo
Published/Copyright: December 4, 2024
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 19 Issue 1

Abstract

Background

Intrauterine adhesions (IUAs) are a significant clinical challenge, affecting reproductive health and leading to infertility or recurrent pregnancy loss. Understanding the molecular mechanisms underlying IUA prevention is crucial for developing effective treatment strategies.

Objective

To investigate the interaction between oviductal mucosal cells and endometrial cells and their effects on the expression of key molecules involved in embryo implantation, specifically leukemia inhibitory factor (LIF), avβ3, estrogen receptor (ER), and progesterone receptor (PR).

Methods

Tubal mucosa and endometrium specimens were collected from 22 patients undergoing surgical interventions. Cells were cultured alone and co-cultured at ratios of 1:1, 1:0.5, and 1:0.1. LIF, avβ3, ER, and PR expression levels were measured using real-time fluorescence quantitative polymerase chain reaction and enzyme-linked immunosorbent assay.

Results

Our results demonstrated that LIF expression was significantly augmented in co-culture conditions, particularly in the 1:1 ratio, compared to oviductal mucosa monoculture (P < 0.05). Although LIF expression was also elevated in 1:0.5 and 1:0.1 co-culture ratios, these increases were not statistically significant (P > 0.05). For avβ3, increased expression was observed in the 1:1 co-culture group (P < 0.05), but no significant differences were detected in 1:0.5 and 1:0.1 co-culture groups. ER expression showed a downward trend in co-culture, but without statistical significance (P > 0.05), and PR expression remained stable across all groups.

Conclusion

Co-culture modulates key molecules involved in embryo implantation, particularly LIF and avβ3. These findings highlight the potential roles of LIF and avβ3 in IUA prevention strategies and provide important insights for future clinical interventions. Tubal mucosal cells can not only grow in the endometrial cell microenvironment, but also the tolerance of tubal mucosal cells can be improved when they are co-cultured.

Keywords: uterine adhesion; tubal mucosa; endometrium; co-culture; endometrial tolerance

1 Introduction

Infertility remains a significant global public health issue, affecting approximately 10–15% of couples worldwide, with a rising trend in recent years [1]. Over the past years, China has witnessed an accelerated decline in its population, prompting the government to sequentially introduce the two-child and then the three-child policies to boost demographic growth [2]. Despite these efforts, the country’s natural growth rate has fallen short of expectations, with a persistent downward trend in the birth rate. Consequently, addressing the fertility rate decline has become a pressing concern in China [3]. Notably, infertility is now recognized as one of the world’s top three public health issues, affecting 10–15% of couples globally, with a rising trend in recent times [4]. According to a recent study by the World Health Organization, the global prevalence of infertility has increased by approximately 2% per year over the past decade [5]. Alongside this, the infertility rate among the Chinese population is higher than anticipated, contributing to the declining birth rate annually. In China, the prevalence of infertility is estimated to be around 12%, with a significant proportion attributed to uterine factors [6].

Among the various causes of infertility, intrauterine adhesions (IUAs) are a leading cause [7]. IUAs arise from infection or trauma, resulting from damage to the endometrium’s basal layer due to diverse factors such as repeated abortions and infections [8]. This leads to a scarcity of cells for endometrial regeneration, fibrosis, unregulated extracellular matrix deposition, and substitution of the interstitium with fibrous connective tissue, along with glands being replaced by inactive cuboidal columnar epithelium [9]. Symptoms often include reduced menstrual flow, amenorrhea, abdominal pain, or infertility. Hysteroscopic transcervical resection of adhesions is the principal treatment for IUA, followed by hormonal therapy, vasodilatory agents, and non-degradable stent insertion as common postoperative adjunct therapies [10]. However, these interventions have limited efficacy in preventing adhesion recurrence and preserving fertility. Studies have shown that the recurrence rate of IUAs after surgical intervention ranges from 21 to 62.5%, with a significant impact on reproductive outcomes [11].

These rare instances of surviving ectopic pregnancies and even the delivery of live offspring [9,10] suggest that alternative sites, albeit unconventional, can support implantation. This implies that while the uterine endometrium is uniquely suited for timed embryo implantation, allowing only a specific window for this process, other tissues may possess certain capabilities for implantation under extraordinary circumstances. Given the challenges faced by patients with moderate to severe IUA, seeking expanded therapeutic strategies to restore fertility is crucial. Our research team initially posited the concept of using fallopian tube mucosa as an alternative to endometrial tissue. Our previous studies have shown that tubal mucosa cells can coexist harmoniously with endometrial cells, and that these coexisting tubal mucosa cells exhibit cell passage potential [11]. This innovative approach aims to broaden the treatment landscape for IUA patients and potentially facilitate successful pregnancy outcomes. Indeed, a successful pregnancy not only requires a repaired uterine environment but also a receptive endometrium, the key factor in embryo acceptance. Endometrial receptivity acts as a biological marker of embryo quality, rejecting low-quality embryos. While embryo quality contributes to about one-third of implantation failures, the majority, two-thirds, are due to inadequate endometrial tolerance [12–15]. The endometrium serves as the final barrier in assisted reproductive technologies (ART), and poor tolerance is the primary reason for ART-related implantation failures [16].

Given the clinical significance of IUAs and the limitations of current treatments, there is a critical need to explore new and effective therapeutic targets for the treatment of IUA. This study aims to explore the interaction between oviductal mucosal cells and endometrial cells using real-time fluorescence quantitative polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) to better understand the change of key molecules such as leukemia inhibitory factor (LIF) and avβ3 in tubal mucosal cells during co-culture.

2 Materials and methods

2.1 Sample section

The tubal mucosa and endometrium specimens used in this study were collected from 22 patients who underwent endometrial scraping and removal of fallopian tubes and uterus due to infertility, uterine fibroids, adenomyosis, CIN III, and other conditions requiring surgical intervention. The collections took place at the Department of Gynecology, Affiliated Hospital of Guizhou Medical University, from November 2019 to December 2020.

2.1.1 Inclusion criteria

Inclusion criteria include: (1) uterus and fallopian tubes needed to be removed due to benign gynecological diseases, (2) women of reproductive age, (3) no steroid hormone was taken 3 months before surgery, (4) postoperative pathological examination confirmed no malignant pathological changes in fallopian tubes and endometrium, (5) surgery was performed at the early and middle stages of hyperplasia, and (6) patients gave informed consent and signed the informed consent form.

2.1.2 Exclusion criteria

Exclusion criteria include: (1) gynecological malignancy; (2) postoperative pathological examination of the fallopian tubes or endometrium with malignant or precancerous lesions; (3) hormonal drugs within 3 months after surgery; (4) postmenopausal women; (5) patients with combined renal disease, hyper- or hypothyroidism, and immune diseases; and (6) patients who did not agree to the use of specimens for this experiment.

2.2 Experimental trials and grouping

The cells were co-cultured in the following groups: (A) fallopian tube mucosal cells (control group), (B) endometrial cells (upper chamber) + oviductal mucosal cells (lower chamber) with a 1:1 ratio of cells in the upper chamber: lower chamber (experimental group 1), (C) endometrial cells (upper chamber) + oviductal mucosal cells (lower chamber) with a 0.5:1 ratio of cells in the upper chamber: lower chamber (experimental group 2), and (D) endometrial cells (upper chamber) + oviductal mucosal cells (lower chamber) with a 0.1:1 ratio of cells in the upper chamber: lower chamber (experimental group 3).

2.3 In vitro analysis and cultivations

After removing the uterus and fallopian tubes from the body, the endometrium and separated fallopian tube mucosa were immediately collected in sterile specimen bottles containing saline, stored at 4°C, and sent to the laboratory within 1 h. The specimens were removed and placed in a 3.5 cm diameter petri dish, washed thrice with phosphate-buffered salt (PBS) solution to remove the surface red blood cells, tissues were cut into small pieces less than 1 mm, transferred to 15 mL centrifuge tubes with pipettes, washed once with PBS solution, centrifuged at 1,200 rpm for 5 min, and the supernatant was discarded; type I collagenase (C0103, Sigma) was added separately. About 0.1 mg/mL was added for digestion and placed in a constant temperature water bath at 37°C, during which the tubes were shaken every 10 min, and the digestion was terminated by adding DMEM/F12 after 90 min.

The endometrial suspension and oviductal mucosa suspension were centrifuged at 1,200 rpm for 5 min, and the supernatant was removed to obtain the precipitates. Then 10% fetal bovine serum (extra fetal bovine serum (South America), 04-001-1ACS, BI) complete culture solution was added to both precipitates, blown and mixed, and inoculated into cell culture flasks, then the endometrial and oviductal mucosa cell culture flasks were incubated at 37°C CO2 thermostat for 24 h to observe the cell apposition and growth, and if the cells were well opposed to the bottom and growing, the fluid was changed every 48 h and the cell morphology was observed by inverted microscope.

When the cells grew to 80–90% of the bottom of the culture flask, the original medium was discarded and washed twice with PBS, 0.25% trypsin was added to just cover the bottom of the flask, and the flask was placed in 37°C 5% CO2 incubator for 1–2 min to digest. Added 10% fetal bovine serum complete medium to the cell precipitate, mixed well by blowing, inoculated with 105 cells/mL cell suspension in culture flasks for cell passaging, and replenished with 10% fetal bovine serum complete medium to 6 mL in culture flasks, and placed them in a 37°C 5% CO2 incubator.

2.4 Cell co-culture analysis

The fifth-generation oviductal mucosa cells in the logarithmic growth phase with good growth status were inserted into the lower chamber of the six-well plate with 1.8 × 105 cells/well, while the fifth-generation endometrial cells in logarithmic growth phase with good growth status were inserted into the upper chamber of six-well plate with 1.8 × 105, 9 × 104, 1.8 × 104 cells/well (the membrane pore size of transwell chamber is 0.4 μm, so the cells cannot pass through). After the cells were attached to the wall, the endometrial cells were first cultured in cell culture medium with 2% fetal bovine serum, and co-cultured with oviductal mucosal epithelial cells; after 48 h of culture, the medium was changed to that for inducing cell metaphase (inducing cell metaphase medium). Ingredients: 2% fetal bovine serum cell culture medium, 1 μm progesterone (V900699, Sigma), 10 nM 17-β-estradiol (E110145, Aladdin), 0.5 mM 8-bromoadenosine 3′,5′-cyclic monophosphate (B5386, Sigma) were continued to be cultured for 96 h; after metaphase cell growth the changes of cells were observed under inverted microscope.

2.5 Gene expression analysis using PCR

The real-time fluorescence quantitative PCR method was used to detect the expression levels of mRNA of avβ3 and LIF in oviductal mucosal cells in the lower chamber of each group: oviductal mucosal cells in each group after co-culture and metaphase treatment as previously grouped, total RNA was extracted with Trizol reagent instructions for concentration determination, quantification, reverse transcription, and amplification. The primers were synthesized by Beijing Prime Tech Biotechnology Co. β-actin was used as the internal reference, and the relative expression was calculated according to 2−△△Ct. The primer sequences are detailed in Table 1.

Table 1

Primer sequences with their product size

Gene Sequence Product (bp)
Homo b-actin Forward CCCTGGAGAAGAGCTACGAG 180
Reverse CGTACAGGTCTTTGCGGATG
Homo avβ3 Forward TGGGGCTGATGACTGAGAAG 206
Reverse ACGCACTTCCAGCTCTACTT
Homo LIF Forward CCAACAACCTGGACAAGCTATG 118
Reverse GTGCCAAGGTACACGACTATGC

2.6 Western blot analysis

The oviductal mucosal cells grouped as before were taken, extracted the total protein after sufficient lysis, determined the protein concentration by BCA method, then performed SDS-PAGE electrophoresis, transferred the membrane, close the transferred membrane with 5% skimmed milk for 1 h, diluted the primary antibody (estrogen receptor-alpha antibody; Affinity, Af6058, 1:1,000 and progesterone receptor; Affinity, Af6106, 1:1,000 dilution), put overnight at 4°C, washed with TBST, then diluted the secondary antibody 10,000 times with TBST, incubated for 1 h at room temperature, washed again with TBST, dropwise added equal volume of mixed ECL developer, and put into the gel imager for exposure imaging. Finally, the grayscale values were analyzed using Image J 1.8.0 software, with β-actin as the internal reference.

2.7 ELISA

The supernatant of each group of cell culture was collected and centrifuged at 3,000 rpm for 10 min, and the supernatant was taken to detect the secretion of human LIF. The procedure was performed according to the instructions of the reagent vendor (Elabscience®). The optical density of each group was measured at 450 nm using an enzyme standardization instrument.

2.8 Immunohistochemistry (IHC) analysis

Cell crawling was performed as in our previously published article. After crawling with 4% paraformaldehyde fixed for 15 min and 0.5% Triton X-100 (PBS preparation) permeabilized at room temperature for 20 min, antigen repair and closure were performed, and 100 μL of diluted primary antibody (estrogen; Affinity, AF6058, 1:100) (αv + β3; Bioss,bs-1310R, 1:100) was added dropwise to each section), put to rest overnight at 4°C, rinsed with PBS; then 100 μL of biotin-labeled secondary antibody working solution (1:150 dilution) was added dropwise, incubated at 37°C for 30 min, rinsed with PBS. Added DAB chromogenic solution dropwise, developed color at room temperature, re-stained, returning blue, dehydrated transparently, dried with air and sealed the film, placed under a microscope, and observed and photographed the results with Imagepro-Plus to detect the average optical density (AOD) value of the pictures.

2.9 Statistical analysis

All statistical analyses were performed using GraphPad (version 7.0; GraphPad Software, Inc.) and SPSS (22.0; IBM, Corp.), and measures conforming to a normal distribution were expressed as mean ± standard deviation, and comparisons of measures between multiple groups conforming to a normal distribution with chi-square were performed using one-way ANOVA analysis, and two-way comparisons between groups were performed using the Dunnett test. Dunnett’s test was used for comparison between groups, and the Kruskal–Wallis H method was used for non-conformity.

  1. Informed consent: Patients gave informed consent and signed the informed consent form.

  2. Ethics approval: This study was approved by the Ethics Committee of the Affiliated Hospital of Guizhou Medical University (No. 2020-(264-01)).

3 Results

Endometrial and fallopian tube mucosal cell identification and metaphase manifestations have been shown in detail in our previous published articles [11] and results were presented in detail.

3.1 Comparative expression of LIF and avβ3 in co-culture and monoculture of oviductal mucosa and endometrial cells

Endometrial tolerance is influenced by expression of LIF in the key molecule for embryo implantation. Changes in avβ3 expression may affect cell adhesion and embryo implantation. To demonstrate the effect of intercellular interaction on LIF and avβ3 expression when tubal mucosal cells were co-cultured with endometrial cells.

Our PCR results showed that LIF expression was notably higher in the group co-culturing oviductal mucosa with endometrial cells (group 1) compared to the solo oviductal mucosa group (control), with a strong statistical difference (P < 0.01). However, LIF levels in the 1:0.5 and 1:0.1 co-culture groups (groups 2 and 3) were also upregulated, but not significantly as compared to the control (P > 0.05) (Figure 1a and b). For avβ3, its expression was increased in the 1:1 combined culture of tubal mucosa and endometrial cells (group 1) versus the tubal mucosa-only group (control), with a statistically significant difference (P < 0.05) (Figure 1a and c). There was no significant difference in avβ3 expression between the 1:0.5 and 1:0.1 co-culture groups and the control (P > 0.05).

Figure 1 (a) and (b) Compared with the tubal mucosal cell alone culture group (control group), avβ3 expression was higher in the tubal mucosal cell and endometrial cell (1:1) co-culture group (experimental group 1), P < 0.05, with statistical differences. (a) and (c) (1:0.5, 1:0.1) Co-culture (experimental groups 2 and 3) avβ3 expression P > 0.05, without statistical difference. TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.
Figure 1

(a) and (b) Compared with the tubal mucosal cell alone culture group (control group), avβ3 expression was higher in the tubal mucosal cell and endometrial cell (1:1) co-culture group (experimental group 1), P < 0.05, with statistical differences. (a) and (c) (1:0.5, 1:0.1) Co-culture (experimental groups 2 and 3) avβ3 expression P > 0.05, without statistical difference. TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.

3.2 Quantitative analysis of LIF expression via ELISA in oviductal mucosa–endometrial cell co-culture systems

To substantiate the LIF expression results, we conducted an ELISA, revealing that LIF levels were indeed significantly augmented in the co-culture of tubal mucosa and endometrial cells (experimental group 1) relative to the solitary tubal mucosa group (control), with a statistically significant difference (P < 0.05). Moreover, in the 1:0.5 and 1:0.1 co-culture conditions (groups 2 and 3), LIF expression was also higher compared to the control, though the differences were not statistically significant (P > 0.05) (Figure 2).

Figure 2 ELISA detection showed that the expression of LIF in the co-culture group of oviduct mucosal cells and endometrial cells (experimental group 1) was also significantly higher than that in the simple oviduct mucosal cells group (control group), P < 0.05, the expression of LIF in the co-culture group (experimental groups 2 and 3) (1:0.5 and 1: 0.1) was also higher than that in the control group, but P > 0.05, the difference was not statistically significant. TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.
Figure 2

ELISA detection showed that the expression of LIF in the co-culture group of oviduct mucosal cells and endometrial cells (experimental group 1) was also significantly higher than that in the simple oviduct mucosal cells group (control group), P < 0.05, the expression of LIF in the co-culture group (experimental groups 2 and 3) (1:0.5 and 1: 0.1) was also higher than that in the control group, but P > 0.05, the difference was not statistically significant. TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.

3.3 Estrogen receptor (ER) downregulation and progesterone receptor (PR) stability in oviductal mucosa–endometrial cell co-culture models

Observations of ER expression indicated a discernible downregulation in tubal mucosa cells cultivated independently, as opposed to their co-culture with endometrial cells at ratios of 1:1, 1:0.5, and 1:0.1 (designated as experimental groups 1, 2, and 3). However, these differences did not attain statistical significance (P > 0.05) (Figure 3b and d). Conversely, PR expression demonstrated a remarkable similarity between solitary tubal mucosa cells and those co-cultured with endometrial cells across the same ratios, with no statistically appreciable disparities noted between the groups (P > 0.05) (Figure 3a and c).

Figure 3 Expression of ER was lower in both tubal mucosal cells alone than in co-culture with endometrial cells (1:1, 1:0.5, and 1:0.1 ratios; experimental groups 1, 2, and 3), but the P value was >0.05, no statistical difference (b) and (d). Expression of PR was close to that in tubal mucosal cells alone and co-culture with endometrial cells (1:1, 1:0.5, and 1:0.1 ratio) were close to each other, and there was no significant difference between the groups, P > 0.05, no statistical difference (a) and (c). Intrauterine adhesions: IUAs; PCR: polymerase chain reaction; ELISA: enzyme-linked immunosorbent assay; LIF: leukemia inhibitory factor; ER: estrogen receptor; TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.
Figure 3

Expression of ER was lower in both tubal mucosal cells alone than in co-culture with endometrial cells (1:1, 1:0.5, and 1:0.1 ratios; experimental groups 1, 2, and 3), but the P value was >0.05, no statistical difference (b) and (d). Expression of PR was close to that in tubal mucosal cells alone and co-culture with endometrial cells (1:1, 1:0.5, and 1:0.1 ratio) were close to each other, and there was no significant difference between the groups, P > 0.05, no statistical difference (a) and (c). Intrauterine adhesions: IUAs; PCR: polymerase chain reaction; ELISA: enzyme-linked immunosorbent assay; LIF: leukemia inhibitory factor; ER: estrogen receptor; TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.

3.4 Immunohistochemical validation of avβ3 expression and ER stability in oviductal mucosa–endometrial co-culture

To further validate the expression patterns of avβ3 and ER, we conducted post-climb immunohistochemical analyses on each cellular group. Our findings aligned with the PCR outcomes, demonstrating that avβ3 expression, when oviductal mucosa cells were co-cultured with endometrial cells at ratios of 1:1, 1:0.5, and 1:0.1, was consistent. Specifically, at the 1:1 ratio, a significant increase was observed (P < 0.05) (Figure 5a and b), while at the other ratios, there was an increase in expression, albeit not statistically significant (P > 0.05) (Figures 4 and 5). Regarding ER, no significant differences were detected across all three co-culture ratios (P > 0.05) (Figure 4a and b).

Figure 4 Immunohistochemical assay to detect ER expression in each group of cells. (a) Quantitative comparison of mean optical density values (AOD) of ER expression in each group of cells. (b) Immunohistochemical results of ER in each group of cells, blue is the nucleus and tan or brown is the target protein expression. Intrauterine adhesions: IUAs; PCR: polymerase chain reaction; ELISA: enzyme-linked immunosorbent assay; LIF: leukemia inhibitory factor; ER: estrogen receptor; TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.
Figure 4

Immunohistochemical assay to detect ER expression in each group of cells. (a) Quantitative comparison of mean optical density values (AOD) of ER expression in each group of cells. (b) Immunohistochemical results of ER in each group of cells, blue is the nucleus and tan or brown is the target protein expression. Intrauterine adhesions: IUAs; PCR: polymerase chain reaction; ELISA: enzyme-linked immunosorbent assay; LIF: leukemia inhibitory factor; ER: estrogen receptor; TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.

Figure 5 Immunohistochemical assay to detect the expression of avβ3 in each group of cells. (a) Quantitative comparison of mean optical density values (AOD) of avβ3 expression in each group of cells. (b) Immunohistochemical results of avβ3 in each group of cells, blue is the nucleus, and tan or brown is the target protein expression. Intrauterine adhesions: IUAs; PCR: polymerase chain reaction; ELISA: enzyme-linked immunosorbent assay; LIF: leukemia inhibitory factor; ER: estrogen receptor; TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.
Figure 5

Immunohistochemical assay to detect the expression of avβ3 in each group of cells. (a) Quantitative comparison of mean optical density values (AOD) of avβ3 expression in each group of cells. (b) Immunohistochemical results of avβ3 in each group of cells, blue is the nucleus, and tan or brown is the target protein expression. Intrauterine adhesions: IUAs; PCR: polymerase chain reaction; ELISA: enzyme-linked immunosorbent assay; LIF: leukemia inhibitory factor; ER: estrogen receptor; TE: tubal mucosal cell and endometrial cell; TS: tubular mucosal cells single.

4 Discussion

Uterine adhesions pose significant physical and emotional distress to a substantial proportion of reproductive-aged women, necessitating treatment that aims to restore the uterine cavity’s normal anatomy, decrease adhesive recurrence rates, regenerate the endometrium, and ultimately enhance fertility in patients with IUA. However, current therapeutic approaches often prove insufficient or ineffective in promoting adequate endometrial regeneration following surgery in cases of severe IUA. Available evidence highlights the resemblance between tubal mucosa and endometrium in both tissue structure and functionality. Structurally, these tissues exhibit embryonic homology, being primarily composed of epithelial and stromal cells, including ciliated and secretory cells, all of which are governed by ovarian hormones and display comparable cellular morphology, albeit with varying cell ratios [17–20]. Functionally, both mucous membranes undergo hormonally-driven morphological, physiological, and biochemical alterations throughout the menstrual cycle, displaying numerous parallels that support early embryonic development and implantation [21–23]. In this study, we isolated primary endometrial and oviductal mucosa cells for in vitro cultivation and co-cultivated the retrieved oviductal mucosa cells with varying quantities of endometrial cells through Transwell inserts, endeavoring to mimic distinct endometrial absence scenarios within the uterine cavity. These endometrial cells, predominantly consisting of epithelial and stromal cells, were used to assess the growth of oviductal mucosa cells under these conditions. Our earlier findings indicated that oviductal mucosal cells can coexist and thrive alongside the endometrium, regardless of its quantity, without affecting their morphology or proliferation rate, and they are capable of undergoing in vitro meiosis.

In the present investigation, we delved deeper into the tolerance of oviductal mucosa cells following this coexistence and discovered that their tolerance was not hindered by the number of endometrial cells. Notably, when the two cell types were co-cultured in equal proportions, there was a significant increase in the expression of two crucial tolerance mediators, LIF and avβ3, which are essential for embryo implantation, with statistically significant differences (P < 0.05). This suggests that the tubal mucosa retains its tolerance after residing within the uterine cavity and implies that the endometrial cells might secrete certain substances that stimulate LIF and avβ3 production in the tubal mucosa cells, hence proposing that the co-culture enhances the tolerance of the tubal mucosa cells. Previous studies have shown that integrin αvβ3 is the most studied tolerogenic marker in the endometrium [24] that plays an important role in embryonic attachment [25]. Also, the literature indicates that Avβ3 is also expressed in the fallopian tube epithelium throughout the human menstrual cycle and is sharply upregulated in the mid-secretory phase, which is the endometrial tolerogenic phase, and this expression is synchronized with the endometrium [26]. These reports suggest that the tubal mucosa may have a similar or even the same tolerogenic properties as the endometrium. The expression of avβ3 was indeed detected in the tubal mucosal cells of all groups in the present study. However, unlike previous studies, the cells used in the present study for the detection of avβ3 were relatively purified oviductal mucosal stromal cells by enzymatic digestion, whereas previous studies reported expression in oviductal mucosal epithelial cells [26]. This study complements this gap, as the expression of avβ3 in oviductal mucosal stromal cells has not been reported in previous studies. The literature shows that avβ3 is also expressed in endometrial stromal cells [27]. Thus, combining previous studies with the present study further provides more evidence for the similarity between the tubal mucosa and endometrium. In addition, this study also found that the expression of avβ3 was elevated in the tubal mucosa cells when the tubal mucosa cells were co-cultured with endometrial cells in a 1:1 ratio, with a significant difference, P < 0.05, and there was no significant difference in the 1:0.5 and 1:0.1 ratios, and this result was consistent in RT-PCR and cellular IHC, indicating that the co-cultured tubal mucosa stromal cells had avβ3 which consistently improved from transcription to the protein synthesis stage of performing function. The mechanism of enhancement also needs further study in follow-up.

Indeed, we know that the embryo implantation process is extremely complex, with thousands of proteins, i.e., molecular languages, involved. To be able to know more about the tolerance of the tubal mucosal cells in the endometrial cell microenvironment, we performed ER, PR, and LIF tests simultaneously. Previous studies have shown that estrogen promotes endometrial proliferation, while progesterone causes secretory changes, metaplasia, and edema in the endometrium, and that these two hormones together provide a suitable environment for implantation of the embryonic follicle, acting mainly through the cognate receptors ER and PR [28–32]; LIF, on the other hand, is involved in mediating and facilitating the communication between the embryo and the endometrium through multiple pathways [33–39]. Previous studies have confirmed that PR and ER are also expressed in the fallopian tube, and that ER and PR are expressed in the nuclei of the epithelial and mesenchymal cells of the fallopian tube, with expression increasing during the proliferative phase and decreasing during the secretory phase [7].

In the present study, we found that tubal mucosal cells expressed ER and PR when cultured alone versus when cultured in different concentrations of endometrial cell microenvironment.

Observations of ER expression indicated a discernible downregulation in tubal mucosa cells when cultivated independently, as opposed to their co-culture with endometrial cells at ratios of 1:1, 1:0.5, and 1:0.1 (designated as experimental groups 1, 2, and 3). This suggests that the presence of endometrial cells may have a modulatory effect on ER expression in tubal mucosa cells. Specifically, the co-culture conditions appear to mitigate the downregulation observed in isolated tubal mucosa cells. In the context of reproductive health, estrogen plays a crucial role in regulating the menstrual cycle and maintaining endometrial function. The observed downregulation of ER in isolated tubal mucosa cells highlights the importance of cellular interactions within the reproductive tract. Endometrial cells likely provide signals that stabilize or upregulate ER expression, which could be critical for maintaining normal tubal function and fertility. This finding aligns with previous studies that have demonstrated the importance of crosstalk between different cell types in the reproductive tract, particularly in the regulation of hormone receptors.

In contrast, the expression of PR was similar whether the tubal mucosa cells were cultured alone or co-cultured with endometrial cells at ratios of 1:1, 1:0.5, and 1:0.1. There was no significant difference in PR expression between the different co-culture groups (P > 0.05), indicating that the presence of endometrial cells does not significantly alter PR expression in tubal mucosa cells. This suggests that while endometrial cells influence ER expression, they do not have a comparable effect on PR expression. This differential regulation underscores the complex interplay between hormonal signaling pathways in the reproductive tract. Overall, these findings provide important insights into the cellular mechanisms underlying hormonal regulation in the reproductive tract. Understanding these interactions is essential for developing targeted therapies for conditions such as infertility, uterine fibroids, and adenomyosis, where hormonal imbalances play a significant role.

Another study showed that LIF was also expressed in the human fallopian tube, while LIF in the human fallopian tube did not change much throughout the menstrual cycle, its expression was higher in the fallopian tube mucosa than in the remaining layers and was higher in the distal part of the fallopian tube, and its expression in the epithelium and mesenchyme of the fallopian tube was not regulated by ovarian hormones [40,41]. The expression in the epithelium and interstitium of the fallopian tube was not regulated by ovarian hormones. The expression and secretion of LIF were detected in all groups of cells and cell cultures in this study, which further corroborates previous studies. In addition, when compared with oviductal mucosal cells cultured alone, elevated levels were found in all groups in co-culture, with significant differences at a 1:1 ratio. In contrast, when LIF expression in oviductal mucosal cells was detected by RT-PCR, the difference was even more significant at P < 0.01 when the oviductal mucosal cells were co-cultured with endometrial cells in a 1:1 ratio, indicating that the more endometrial cells there were, when the two cells were co-grown, the more LIF was secreted. The mechanism of LIF elevation in tubal mucosal cells when co-cultured with endometrial cells is still unclear. Previous studies found that the expression of LIF was significantly higher in tubal pregnancy than in normal [40]. It is speculated that LIF may be involved in regulating the implantation of tubal pregnancy. Whether the mechanism of LIF elevation in the present study is similar to that of LIF elevation in tubal pregnancy needs to be further investigated.

One key limitation is the relatively small sample size of this study group. The tubal mucosa and endometrium specimens were collected from only 22 patients who underwent endometrial scraping and removal of fallopian tubes and uterus due to various conditions. Given the small sample size, the generalizability of our findings may be limited. Future studies with larger, more diverse patient populations are needed to confirm and expand upon our results.

In conclusion, our findings demonstrate that the expression of key tolerance-related markers within oviductal mucosa cells was not diminished during their co-culture with endometrial cells, and, intriguingly, the expression levels of the pivotal tolerogenic marker, avβ3, as well as LIF, were significantly upregulated at a 1:1 cell ratio. These observations imply an enhancement of the tubal mucosa’s tolerogenic capacity within the simulated uterine environment, and they tentatively propose that our approach utilizing tubal mucosa as an alternative to the endometrium for treating IUA holds promise. However, this study represents just the initial stage, and more extensive experimental evidence is required to substantiate the underlying mechanisms.

5 Conclusion

This study demonstrates that co-culture conditions, particularly in a 1:1 ratio, significantly enhance the expression of LIF and avβ3. While ER expression showed a non-significant downward trend, PR expression remained stable across all groups. These findings indicate that tubal mucosal cells can grow in the endometrial cell microenvironment and that co-culture improves the tolerance of tubal mucosal cells. These results suggest that the interaction between tubal mucosal cells and endometrial cells modulates critical pathways involved in IUAs. Understanding these molecular mechanisms could lead to the development of new therapeutic strategies for preventing and treating IUAs. Future research should focus on elucidating the specific roles of LIF and avβ3 in IUA prevention and exploring potential clinical applications.

Abbreviations

ELISA

enzyme-linked immunosorbent assay

ER

estrogen receptor

IUAs

intrauterine adhesions

LIF

leukemia inhibitory factor

PCR

polymerase chain reaction

# Chengrong Wu, Qian Pu contributed equally to this work.

Acknowledgements

The authors would like to specially thank all those who helped with this article.

  1. Funding information: This work was supported by the Guizhou Provincial Science and Technology Foundation – 2K [2023]352.

  2. Author contributions: Chengrong Wu, Hualei Cai, and Lei Yu: conceived and designed the experiments, wrote the article. Qian Pu: performed the experiments; analyzed and interpreted the data; contributed reagents, materials, analysis tools, or data. Ashutosh Goswami: performed the experiments, translated the manuscript, and polished. Zhongyuan Mo: collection of specimens and performed the experiments. All authors read and revised the manuscript, agreed to publish.

  3. Conflict of interest: All authors declare that they have no conflict of interest.

  4. Data availability statement: The data used to support this study are available from the corresponding author upon request.

References

[1] Bhattacharya I, Sharma SS, Majumdar SS. Etiology of male infertility: an update. Reprod Sci. 2024 Apr;31(4):942–65.10.1007/s43032-023-01401-xSearch in Google Scholar PubMed

[2] Zhou Z, Zheng D, Wu H, Li R, Xu S, Kang Y, et al. Epidemiology of infertility in China: a population-based study. BJOG. 2018 Mar;125(4):432–41.10.1111/1471-0528.14966Search in Google Scholar PubMed

[3] Bai X, Liu J, Yuan W, Liu Y, Li W, Cao S, et al. Therapeutic effect of human amniotic epithelial cells in rat models of intrauterine adhesions. Cell Transplant. 2020;29:963689720908495.10.1177/0963689720908495Search in Google Scholar PubMed PubMed Central

[4] Valle RF, Sciarra JJ. Intrauterine adhesions: hysteroscopic diagnosis, classification, treatment, and reproductive outcome. Am J Obstet Gynecol. 1988;158(6 Pt 1):1459–70.10.1016/0002-9378(88)90382-1Search in Google Scholar PubMed

[5] AAGL Elevating Gynecologic Surgery. AAGL practice report: practice guidelines on intrauterine adhesions developed in collaboration with the European Society of Gynaecological Endoscopy (ESGE). Gynecol Surg. 2017;14(1):6.10.1186/s10397-017-1007-3Search in Google Scholar PubMed PubMed Central

[6] Senturk LM, Erel CT. Thin endometrium in assisted reproductive technology. Curr Opin Obstet Gynecol. 2008;20(3):221–8.10.1097/GCO.0b013e328302143cSearch in Google Scholar PubMed

[7] Shah A, Nandedkar TD, Raghavan VP, Parulekar SV, Natraj U. Characterization and localization of estrogen and progesterone receptors of human fallopian tube. Indian J Exp Biol. 1999;37(9):893–9.Search in Google Scholar

[8] Goddijn M, van der Veen F, Schuring-Blom GH, Ankum WM, Leschot NJ. Cytogenetic characteristics of ectopic pregnancy. Hum Reprod (Oxford, Engl). 1996;11(12):2769–71.10.1093/oxfordjournals.humrep.a019207Search in Google Scholar PubMed

[9] Zuñiga LA, Alas-Pineda C, Reyes-Guardado CL, Melgar GI, Gaitán-Zambrano K, Gough S. Advanced abdominal ectopic pregnancy with subsequent fetal and placental extraction: a case report. Biomed Hub. 2022;7(1):42–7.10.1159/000521733Search in Google Scholar PubMed PubMed Central

[10] Mhaskar R, Harish M, Jaiprakash T. Unruptured ampullary ectopic pregnancy at 16-week period of gestation with live fetus. J Obstet Gynaecol India. 2014;64(1):73–4.10.1007/s13224-012-0228-7Search in Google Scholar PubMed PubMed Central

[11] Wu CR, Cai HL, Cai DX, Li TL, Shen R, Zi D. A simulation study on the growth of oviduct mucosa cells in the uterine cavity microenvironment. Int J Women’s Health. 2021;13:829–40.10.2147/IJWH.S328567Search in Google Scholar PubMed PubMed Central

[12] Simón C, Moreno C, Remohí J, Pellicer A. Molecular interactions between embryo and uterus in the adhesion phase of human implantation. Hum Reprod (Oxford, Engl). 1998;13(Suppl 3):219–32, discussion 233–236.10.1093/humrep/13.suppl_3.219Search in Google Scholar PubMed

[13] Simón C, Landeras J, Zuzuarregui JL, Martín JC, Remohí J, Pellicer A. Early pregnancy losses in in vitro fertilization and oocyte donation. Fertil Steril. 1999;72(6):1061–5.10.1016/S0015-0282(99)00408-2Search in Google Scholar PubMed

[14] Simón C, Martín JC, Galan A, Valbuena D, Pellicer A. Embryonic regulation in implantation. Sem Reprod Endocrinol. 1999;17(3):267–74.10.1055/s-2007-1016234Search in Google Scholar PubMed

[15] Pellicer A, Rubio C, Vidal F, Mínguez Y, Giménez C, Egozcue J, et al. In vitro fertilization plus preimplantation genetic diagnosis in patients with recurrent miscarriage: an analysis of chromosome abnormalities in human preimplantation embryos. Fertil Steril. 1999;71(6):1033–9.10.1016/S0015-0282(99)00143-0Search in Google Scholar

[16] Neykova K, Tosto V, Giardina I, Tsibizova V, Vakrilov G. Endometrial receptivity and pregnancy outcome. J Maternal-Fetal Neonatal Med. 2022;35(13):2591–605.10.1080/14767058.2020.1787977Search in Google Scholar PubMed

[17] Schueller EF. Ciliated epithelia of the human uterine mucosa. Obstet Gynecol. 1968;31(2):215–23.10.1097/00006250-196802000-00011Search in Google Scholar PubMed

[18] Weström L, Mårdh PA, Mecklenburg CV, Håkansson CH. Studies on ciliated epithelia of the human genital tract. II. The mucociliary wave pattern of fallopian tube epithelium. Fertil Steril. 1977;28(9):955–61.10.1016/S0015-0282(16)42798-6Search in Google Scholar PubMed

[19] Chan RWS, Schwab KE, Gargett CE. Clonogenicity of human endometrial epithelial and stromal cells. Biol Reprod. 2004;70(6):1738–50.10.1095/biolreprod.103.024109Search in Google Scholar PubMed

[20] Hagiwara H, Ohwada N, Aoki T, Suzuki T, Takata K. Immunohistochemical and electron microscopic observations of stromal cells in the human oviduct mucosa. Med Mol Morphol. 2008;41(4):221–6.10.1007/s00795-008-0422-ySearch in Google Scholar PubMed

[21] Varga I, Miko M, Kachlík D, Žišková M, Danihel Jr Ľ, Babál P. How many cell types form the epithelial lining of the human uterine tubes? Revision of the histological nomenclature of the human tubal epithelium. Ann Anat = Anatomischer Anzeiger: Off Organ Anatomische Ges. 2019;224:73–80.10.1016/j.aanat.2019.03.012Search in Google Scholar PubMed

[22] Crow J, Amso NN, Lewin J, Shaw RW. Morphology and ultrastructure of fallopian tube epithelium at different stages of the menstrual cycle and menopause. Hum Reprod (Oxford, Engl). 1994;9(12):2224–33.10.1093/oxfordjournals.humrep.a138428Search in Google Scholar PubMed

[23] Fitzgerald HC, Dhakal P, Behura SK, Schust DJ, Spencer TE. Self-renewing endometrial epithelial organoids of the human uterus. Proc Natl Acad Sci USA 2019;116(46):23132–42.10.1073/pnas.1915389116Search in Google Scholar PubMed PubMed Central

[24] Wang L, Lv S, Mao W, Pei M, Yang X. Assessment of endometrial receptivity during implantation window in women with unexplained infertility. Gynecol Endocrinol. 2020;36(10):917–21.10.1080/09513590.2020.1727433Search in Google Scholar PubMed

[25] Yu M, Qin H, Wang H, Liu J, Liu S, Yan Q. N-glycosylation of uterine endometrium determines its receptivity. J Cell Physiol. 2020;235(2):1076–89.10.1002/jcp.29022Search in Google Scholar PubMed

[26] Makrigiannakis A, Karamouti M, Petsas G, Makris N, Nikas G, Antsaklis A. The expression of receptivity markers in the fallopian tube epithelium. Histochem Cell Biol. 2009;132(2):159–67.10.1007/s00418-009-0593-1Search in Google Scholar PubMed

[27] Illera MJ, Cullinan E, Gui Y, Yuan L, Beyler SA, Lessey BA. Blockade of the alpha(v)beta(3) integrin adversely affects implantation in the mouse. Biol Reprod. 2000;62(5):1285–90.10.1095/biolreprod62.5.1285Search in Google Scholar PubMed

[28] Mertens HJ, Heineman MJ, Theunissen PH, de Jong FH, Evers JL. Androgen, estrogen and progesterone receptor expression in the human uterus during the menstrual cycle. Eur J Obstet Gynecol Reprod Biol. 2001;98(1):58–65.10.1016/S0301-2115(00)00554-6Search in Google Scholar PubMed

[29] Godinjak Z, Bilalovic N. Estrogen and progesterone receptors in endometrium in women with unexplained infertility. Mater Socio-Medica. 2014;26(1):51–2.10.5455/msm.2014.26.51-52Search in Google Scholar PubMed PubMed Central

[30] Marquardt RM, Kim TH, Shin JH, Jeong JW. Progesterone and estrogen signaling in the endometrium: what goes wrong in endometriosis? Int J Mol Sci. 2019;20(15):3822.10.3390/ijms20153822Search in Google Scholar PubMed PubMed Central

[31] Wu SP, Li R, DeMayo FJ. Progesterone receptor regulation of uterine adaptation for pregnancy. Trends Endocrinol Metab: TEM. 2018;29(7):481–91.10.1016/j.tem.2018.04.001Search in Google Scholar PubMed PubMed Central

[32] Liang YX, Liu L, Jin ZY, Liang XH, Fu YS, Gu XW, et al. The high concentration of progesterone is harmful for endometrial receptivity and decidualization. Sci Rep. 2018;8(1):712.10.1038/s41598-017-18643-wSearch in Google Scholar PubMed PubMed Central

[33] Morgani SM, Brickman JM. LIF supports primitive endoderm expansion during pre-implantation development. Development (Cambridge, Engl). 2015;142(20):3488–99.10.1242/dev.125021Search in Google Scholar PubMed

[34] Simón C, Martín JC, Pellicer A. Paracrine regulators of implantation. Bailliere’s Best Pract Res Clin Obstet Gynaecol. 2000;14(5):815–26.10.1053/beog.2000.0121Search in Google Scholar PubMed

[35] Wang W, Taylor RN, Bagchi IC, Bagchi MK. Regulation of human endometrial stromal proliferation and differentiation by C/EBPβ involves cyclin E-cdk2 and STAT3. Mol Endocrinol (Baltimore, MD). 2012;26(12):2016–30.10.1210/me.2012-1169Search in Google Scholar PubMed PubMed Central

[36] Fukui Y, Hirota Y, Saito-Fujita T, Aikawa S, Hiraoka T, Kaku T, et al. Uterine epithelial LIF receptors contribute to implantation chamber formation in blastocyst attachment. Endocrinology. 2021;162(11):bqab169.10.1210/endocr/bqab169Search in Google Scholar PubMed

[37] Shuya LL, Menkhorst EM, Yap J, Li P, Lane N, Dimitriadis E, et al. Leukemia inhibitory factor enhances endometrial stromal cell decidualization in humans and mice. PLoS One. 2011;6(9):e25288.10.1371/journal.pone.0025288Search in Google Scholar PubMed PubMed Central

[38] Staun-Ram E, Shalev E. Human trophoblast function during the implantation process. Reprod Biol Endocrinol: RB & E. 2005;3:56.10.1186/1477-7827-3-56Search in Google Scholar PubMed PubMed Central

[39] Yen CF, Liao SK, Huang SJ, Tabak S, Arcuri F, Lee CL, et al. Decreased endometrial expression of leukemia inhibitory factor receptor disrupts the STAT3 signaling in adenomyosis during the implantation window. Reprod Sci (Thousand Oaks, CA). 2017;24(8):1176–86.10.1177/1933719116681515Search in Google Scholar PubMed

[40] Keltz MD, Attar E, Buradagunta S, Olive DL, Kliman HJ, Arici A. Modulation of leukemia inhibitory factor gene expression and protein biosynthesis in the human fallopian tube. Am J Obstet Gynecol. 1996;175(6):1611–9.10.1016/S0002-9378(96)70114-XSearch in Google Scholar

[41] Li Y, Sun L, Zhao D, Ouyang J, Xiang M. Aberrant expression of leukemia inhibitory factor receptor (LIFR) and leukemia inhibitory factor (LIF) is associated with tubal pregnancy occurrence. Turkish J Med Sci. 2015;45(1):214–20.10.3906/sag-1307-103Search in Google Scholar PubMed

Received: 2024-07-03
Revised: 2024-09-24
Accepted: 2024-10-05
Published Online: 2024-12-04

© 2024 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway
  3. STK11 (LKB1) mutation suppresses ferroptosis in lung adenocarcinoma by facilitating monounsaturated fatty acid synthesis
  4. Association of SOX6 gene polymorphisms with Kashin-Beck disease risk in the Chinese Han population
  5. The pyroptosis-related signature predicts prognosis and influences the tumor immune microenvironment in dedifferentiated liposarcoma
  6. METTL3 attenuates ferroptosis sensitivity in lung cancer via modulating TFRC
  7. Identification and validation of molecular subtypes and prognostic signature for stage I and stage II gastric cancer based on neutrophil extracellular traps
  8. Novel lumbar plexus block versus femoral nerve block for analgesia and motor recovery after total knee arthroplasty
  9. Correlation between ABCB1 and OLIG2 polymorphisms and the severity and prognosis of patients with cerebral infarction
  10. Study on the radiotherapy effect and serum neutral granulocyte lymphocyte ratio and inflammatory factor expression of nasopharyngeal carcinoma
  11. Transcriptome analysis of effects of Tecrl deficiency on cardiometabolic and calcium regulation in cardiac tissue
  12. Aflatoxin B1 induces infertility, fetal deformities, and potential therapies
  13. Serum levels of HMW adiponectin and its receptors are associated with cytokine levels and clinical characteristics in chronic obstructive pulmonary disease
  14. METTL3-mediated methylation of CYP2C19 mRNA may aggravate clopidogrel resistance in ischemic stroke patients
  15. Understand how machine learning impact lung cancer research from 2010 to 2021: A bibliometric analysis
  16. Pressure ulcers in German hospitals: Analysis of reimbursement and length of stay
  17. Metformin plus L-carnitine enhances brown/beige adipose tissue activity via Nrf2/HO-1 signaling to reduce lipid accumulation and inflammation in murine obesity
  18. Downregulation of carbonic anhydrase IX expression in mouse xenograft nasopharyngeal carcinoma model via doxorubicin nanobubble combined with ultrasound
  19. Feasibility of 3-dimensional printed models in simulated training and teaching of transcatheter aortic valve replacement
  20. miR-335-3p improves type II diabetes mellitus by IGF-1 regulating macrophage polarization
  21. The analyses of human MCPH1 DNA repair machinery and genetic variations
  22. Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy
  23. Comprehensive analysis based on the disulfidptosis-related genes identifies hub genes and immune infiltration for pancreatic adenocarcinoma
  24. Changes of serum CA125 and PGE2 before and after high-intensity focused ultrasound combined with GnRH-a in treatment of patients with adenomyosis
  25. The clinical value of the hepatic venous pressure gradient in patients undergoing hepatic resection for hepatocellular carcinoma with or without liver cirrhosis
  26. Development and validation of a novel model to predict pulmonary embolism in cardiology suspected patients: A 10-year retrospective analysis
  27. Downregulation of lncRNA XLOC_032768 in diabetic patients predicts the occurrence of diabetic nephropathy
  28. Circ_0051428 targeting miR-885-3p/MMP2 axis enhances the malignancy of cervical cancer
  29. Effectiveness of ginkgo diterpene lactone meglumine on cognitive function in patients with acute ischemic stroke
  30. The construction of a novel prognostic prediction model for glioma based on GWAS-identified prognostic-related risk loci
  31. Evaluating the impact of childhood BMI on the risk of coronavirus disease 2019: A Mendelian randomization study
  32. Lactate dehydrogenase to albumin ratio is associated with in-hospital mortality in patients with acute heart failure: Data from the MIMIC-III database
  33. CD36-mediated podocyte lipotoxicity promotes foot process effacement
  34. Efficacy of etonogestrel subcutaneous implants versus the levonorgestrel-releasing intrauterine system in the conservative treatment of adenomyosis
  35. FLRT2 mediates chondrogenesis of nasal septal cartilage and mandibular condyle cartilage
  36. Challenges in treating primary immune thrombocytopenia patients undergoing COVID-19 vaccination: A retrospective study
  37. Let-7 family regulates HaCaT cell proliferation and apoptosis via the ΔNp63/PI3K/AKT pathway
  38. Phospholipid transfer protein ameliorates sepsis-induced cardiac dysfunction through NLRP3 inflammasome inhibition
  39. Postoperative cognitive dysfunction in elderly patients with colorectal cancer: A randomized controlled study comparing goal-directed and conventional fluid therapy
  40. Long-pulsed ultrasound-mediated microbubble thrombolysis in a rat model of microvascular obstruction
  41. High SEC61A1 expression predicts poor outcome of acute myeloid leukemia
  42. Comparison of polymerase chain reaction and next-generation sequencing with conventional urine culture for the diagnosis of urinary tract infections: A meta-analysis
  43. Secreted frizzled-related protein 5 protects against renal fibrosis by inhibiting Wnt/β-catenin pathway
  44. Pan-cancer and single-cell analysis of actin cytoskeleton genes related to disulfidptosis
  45. Overexpression of miR-532-5p restrains oxidative stress response of chondrocytes in nontraumatic osteonecrosis of the femoral head by inhibiting ABL1
  46. Autologous liver transplantation for unresectable hepatobiliary malignancies in enhanced recovery after surgery model
  47. Clinical analysis of incomplete rupture of the uterus secondary to previous cesarean section
  48. Abnormal sleep duration is associated with sarcopenia in older Chinese people: A large retrospective cross-sectional study
  49. No genetic causality between obesity and benign paroxysmal vertigo: A two-sample Mendelian randomization study
  50. Identification and validation of autophagy-related genes in SSc
  51. Long non-coding RNA SRA1 suppresses radiotherapy resistance in esophageal squamous cell carcinoma by modulating glycolytic reprogramming
  52. Evaluation of quality of life in patients with schizophrenia: An inpatient social welfare institution-based cross-sectional study
  53. The possible role of oxidative stress marker glutathione in the assessment of cognitive impairment in multiple sclerosis
  54. Compilation of a self-management assessment scale for postoperative patients with aortic dissection
  55. Left atrial appendage closure in conjunction with radiofrequency ablation: Effects on left atrial functioning in patients with paroxysmal atrial fibrillation
  56. Effect of anterior femoral cortical notch grade on postoperative function and complications during TKA surgery: A multicenter, retrospective study
  57. Clinical characteristics and assessment of risk factors in patients with influenza A-induced severe pneumonia after the prevalence of SARS-CoV-2
  58. Analgesia nociception index is an indicator of laparoscopic trocar insertion-induced transient nociceptive stimuli
  59. High STAT4 expression correlates with poor prognosis in acute myeloid leukemia and facilitates disease progression by upregulating VEGFA expression
  60. Factors influencing cardiovascular system-related post-COVID-19 sequelae: A single-center cohort study
  61. HOXD10 regulates intestinal permeability and inhibits inflammation of dextran sulfate sodium-induced ulcerative colitis through the inactivation of the Rho/ROCK/MMPs axis
  62. Mesenchymal stem cell-derived exosomal miR-26a induces ferroptosis, suppresses hepatic stellate cell activation, and ameliorates liver fibrosis by modulating SLC7A11
  63. Endovascular thrombectomy versus intravenous thrombolysis for primary distal, medium vessel occlusion in acute ischemic stroke
  64. ANO6 (TMEM16F) inhibits gastrointestinal stromal tumor growth and induces ferroptosis
  65. Prognostic value of EIF5A2 in solid tumors: A meta-analysis and bioinformatics analysis
  66. The role of enhanced expression of Cx43 in patients with ulcerative colitis
  67. Choosing a COVID-19 vaccination site might be driven by anxiety and body vigilance
  68. Role of ICAM-1 in triple-negative breast cancer
  69. Cost-effectiveness of ambroxol in the treatment of Gaucher disease type 2
  70. HLA-DRB5 promotes immune thrombocytopenia via activating CD8+ T cells
  71. Efficacy and factors of myofascial release therapy combined with electrical and magnetic stimulation in the treatment of chronic pelvic pain syndrome
  72. Efficacy of tacrolimus monotherapy in primary membranous nephropathy
  73. Mechanisms of Tripterygium wilfordii Hook F on treating rheumatoid arthritis explored by network pharmacology analysis and molecular docking
  74. FBXO45 levels regulated ferroptosis renal tubular epithelial cells in a model of diabetic nephropathy by PLK1
  75. Optimizing anesthesia strategies to NSCLC patients in VATS procedures: Insights from drug requirements and patient recovery patterns
  76. Alpha-lipoic acid upregulates the PPARγ/NRF2/GPX4 signal pathway to inhibit ferroptosis in the pathogenesis of unexplained recurrent pregnancy loss
  77. Correlation between fat-soluble vitamin levels and inflammatory factors in paediatric community-acquired pneumonia: A prospective study
  78. CD1d affects the proliferation, migration, and apoptosis of human papillary thyroid carcinoma TPC-1 cells via regulating MAPK/NF-κB signaling pathway
  79. miR-let-7a inhibits sympathetic nerve remodeling after myocardial infarction by downregulating the expression of nerve growth factor
  80. Immune response analysis of solid organ transplantation recipients inoculated with inactivated COVID-19 vaccine: A retrospective analysis
  81. The H2Valdien derivatives regulate the epithelial–mesenchymal transition of hepatoma carcinoma cells through the Hedgehog signaling pathway
  82. Clinical efficacy of dexamethasone combined with isoniazid in the treatment of tuberculous meningitis and its effect on peripheral blood T cell subsets
  83. Comparison of short-segment and long-segment fixation in treatment of degenerative scoliosis and analysis of factors associated with adjacent spondylolisthesis
  84. Lycopene inhibits pyroptosis of endothelial progenitor cells induced by ox-LDL through the AMPK/mTOR/NLRP3 pathway
  85. Methylation regulation for FUNDC1 stability in childhood leukemia was up-regulated and facilitates metastasis and reduces ferroptosis of leukemia through mitochondrial damage by FBXL2
  86. Correlation of single-fiber electromyography studies and functional status in patients with amyotrophic lateral sclerosis
  87. Risk factors of postoperative airway obstruction complications in children with oral floor mass
  88. Expression levels and clinical significance of serum miR-19a/CCL20 in patients with acute cerebral infarction
  89. Physical activity and mental health trends in Korean adolescents: Analyzing the impact of the COVID-19 pandemic from 2018 to 2022
  90. Evaluating anemia in HIV-infected patients using chest CT
  91. Ponticulus posticus and skeletal malocclusion: A pilot study in a Southern Italian pre-orthodontic court
  92. Causal association of circulating immune cells and lymphoma: A Mendelian randomization study
  93. Assessment of the renal function and fibrosis indexes of conventional western medicine with Chinese medicine for dredging collaterals on treating renal fibrosis: A systematic review and meta-analysis
  94. Comprehensive landscape of integrator complex subunits and their association with prognosis and tumor microenvironment in gastric cancer
  95. New target-HMGCR inhibitors for the treatment of primary sclerosing cholangitis: A drug Mendelian randomization study
  96. Population pharmacokinetics of meropenem in critically ill patients
  97. Comparison of the ability of newly inflammatory markers to predict complicated appendicitis
  98. Comparative morphology of the cruciate ligaments: A radiological study
  99. Immune landscape of hepatocellular carcinoma: The central role of TP53-inducible glycolysis and apoptosis regulator
  100. Serum SIRT3 levels in epilepsy patients and its association with clinical outcomes and severity: A prospective observational study
  101. SHP-1 mediates cigarette smoke extract-induced epithelial–mesenchymal transformation and inflammation in 16HBE cells
  102. Acute hyper-hypoxia accelerates the development of depression in mice via the IL-6/PGC1α/MFN2 signaling pathway
  103. The GJB3 correlates with the prognosis, immune cell infiltration, and therapeutic responses in lung adenocarcinoma
  104. Physical fitness and blood parameters outcomes of breast cancer survivor in a low-intensity circuit resistance exercise program
  105. Exploring anesthetic-induced gene expression changes and immune cell dynamics in atrial tissue post-coronary artery bypass graft surgery
  106. Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism
  107. Analysis of the risk factors of the radiation-induced encephalopathy in nasopharyngeal carcinoma: A retrospective cohort study
  108. Reproductive outcomes in women with BRCA 1/2 germline mutations: A retrospective observational study and literature review
  109. Evaluation of upper airway ultrasonographic measurements in predicting difficult intubation: A cross-section of the Turkish population
  110. Prognostic and diagnostic value of circulating IGFBP2 in pancreatic cancer
  111. Postural stability after operative reconstruction of the AFTL in chronic ankle instability comparing three different surgical techniques
  112. Research trends related to emergence agitation in the post-anaesthesia care unit from 2001 to 2023: A bibliometric analysis
  113. Frequency and clinicopathological correlation of gastrointestinal polyps: A six-year single center experience
  114. ACSL4 mediates inflammatory bowel disease and contributes to LPS-induced intestinal epithelial cell dysfunction by activating ferroptosis and inflammation
  115. Affibody-based molecular probe 99mTc-(HE)3ZHER2:V2 for non-invasive HER2 detection in ovarian and breast cancer xenografts
  116. Effectiveness of nutritional support for clinical outcomes in gastric cancer patients: A meta-analysis of randomized controlled trials
  117. The relationship between IFN-γ, IL-10, IL-6 cytokines, and severity of the condition with serum zinc and Fe in children infected with Mycoplasma pneumoniae
  118. Paraquat disrupts the blood–brain barrier by increasing IL-6 expression and oxidative stress through the activation of PI3K/AKT signaling pathway
  119. Sleep quality associate with the increased prevalence of cognitive impairment in coronary artery disease patients: A retrospective case–control study
  120. Dioscin protects against chronic prostatitis through the TLR4/NF-κB pathway
  121. Association of polymorphisms in FBN1, MYH11, and TGF-β signaling-related genes with susceptibility of sporadic thoracic aortic aneurysm and dissection in the Zhejiang Han population
  122. Application value of multi-parameter magnetic resonance image-transrectal ultrasound cognitive fusion in prostate biopsy
  123. Laboratory variables‐based artificial neural network models for predicting fatty liver disease: A retrospective study
  124. Decreased BIRC5-206 promotes epithelial–mesenchymal transition in nasopharyngeal carcinoma through sponging miR-145-5p
  125. Sepsis induces the cardiomyocyte apoptosis and cardiac dysfunction through activation of YAP1/Serpine1/caspase-3 pathway
  126. Assessment of iron metabolism and iron deficiency in incident patients on incident continuous ambulatory peritoneal dialysis
  127. Tibial periosteum flap combined with autologous bone grafting in the treatment of Gustilo-IIIB/IIIC open tibial fractures
  128. The application of intravenous general anesthesia under nasopharyngeal airway assisted ventilation undergoing ureteroscopic holmium laser lithotripsy: A prospective, single-center, controlled trial
  129. Long intergenic noncoding RNA for IGF2BP2 stability suppresses gastric cancer cell apoptosis by inhibiting the maturation of microRNA-34a
  130. Role of FOXM1 and AURKB in regulating keratinocyte function in psoriasis
  131. Parental control attitudes over their pre-school children’s diet
  132. The role of auto-HSCT in extranodal natural killer/T cell lymphoma
  133. Significance of negative cervical cytology and positive HPV in the diagnosis of cervical lesions by colposcopy
  134. Echinacoside inhibits PASMCs calcium overload to prevent hypoxic pulmonary artery remodeling by regulating TRPC1/4/6 and calmodulin
  135. ADAR1 plays a protective role in proximal tubular cells under high glucose conditions by attenuating the PI3K/AKT/mTOR signaling pathway
  136. The risk of cancer among insulin glargine users in Lithuania: A retrospective population-based study
  137. The unusual location of primary hydatid cyst: A case series study
  138. Intraoperative changes in electrophysiological monitoring can be used to predict clinical outcomes in patients with spinal cavernous malformation
  139. Obesity and risk of placenta accreta spectrum: A meta-analysis
  140. Shikonin alleviates asthma phenotypes in mice via an airway epithelial STAT3-dependent mechanism
  141. NSUN6 and HTR7 disturbed the stability of carotid atherosclerotic plaques by regulating the immune responses of macrophages
  142. The effect of COVID-19 lockdown on admission rates in Maternity Hospital
  143. Temporal muscle thickness is not a prognostic predictor in patients with high-grade glioma, an experience at two centers in China
  144. Luteolin alleviates cerebral ischemia/reperfusion injury by regulating cell pyroptosis
  145. Therapeutic role of respiratory exercise in patients with tuberculous pleurisy
  146. Effects of CFTR-ENaC on spinal cord edema after spinal cord injury
  147. Irisin-regulated lncRNAs and their potential regulatory functions in chondrogenic differentiation of human mesenchymal stem cells
  148. DMD mutations in pediatric patients with phenotypes of Duchenne/Becker muscular dystrophy
  149. Combination of C-reactive protein and fibrinogen-to-albumin ratio as a novel predictor of all-cause mortality in heart failure patients
  150. Significant role and the underly mechanism of cullin-1 in chronic obstructive pulmonary disease
  151. Ferroptosis-related prognostic model of mantle cell lymphoma
  152. Observation of choking reaction and other related indexes in elderly painless fiberoptic bronchoscopy with transnasal high-flow humidification oxygen therapy
  153. A bibliometric analysis of Prader-Willi syndrome from 2002 to 2022
  154. The causal effects of childhood sunburn occasions on melanoma: A univariable and multivariable Mendelian randomization study
  155. Oxidative stress regulates glycogen synthase kinase-3 in lymphocytes of diabetes mellitus patients complicated with cerebral infarction
  156. Role of COX6C and NDUFB3 in septic shock and stroke
  157. Trends in disease burden of type 2 diabetes, stroke, and hypertensive heart disease attributable to high BMI in China: 1990–2019
  158. Purinergic P2X7 receptor mediates hyperoxia-induced injury in pulmonary microvascular endothelial cells via NLRP3-mediated pyroptotic pathway
  159. Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation
  160. Analgesic effect of external oblique intercostal block in laparoscopic cholecystectomy: A retrospective study
  161. Elevated serum miR-142-5p correlates with ischemic lesions and both NSE and S100β in ischemic stroke patients
  162. Correlation between the mechanism of arteriopathy in IgA nephropathy and blood stasis syndrome: A cohort study
  163. Risk factors for progressive kyphosis after percutaneous kyphoplasty in osteoporotic vertebral compression fracture
  164. Predictive role of neuron-specific enolase and S100-β in early neurological deterioration and unfavorable prognosis in patients with ischemic stroke
  165. The potential risk factors of postoperative cognitive dysfunction for endovascular therapy in acute ischemic stroke with general anesthesia
  166. Fluoxetine inhibited RANKL-induced osteoclastic differentiation in vitro
  167. Detection of serum FOXM1 and IGF2 in patients with ARDS and their correlation with disease and prognosis
  168. Rhein promotes skin wound healing by activating the PI3K/AKT signaling pathway
  169. Differences in mortality risk by levels of physical activity among persons with disabilities in South Korea
  170. Review Articles
  171. Cutaneous signs of selected cardiovascular disorders: A narrative review
  172. XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis
  173. A narrative review on adverse drug reactions of COVID-19 treatments on the kidney
  174. Emerging role and function of SPDL1 in human health and diseases
  175. Adverse reactions of piperacillin: A literature review of case reports
  176. Molecular mechanism and intervention measures of microvascular complications in diabetes
  177. Regulation of mesenchymal stem cell differentiation by autophagy
  178. Molecular landscape of borderline ovarian tumours: A systematic review
  179. Advances in synthetic lethality modalities for glioblastoma multiforme
  180. Investigating hormesis, aging, and neurodegeneration: From bench to clinics
  181. Frankincense: A neuronutrient to approach Parkinson’s disease treatment
  182. Sox9: A potential regulator of cancer stem cells in osteosarcoma
  183. Early detection of cardiovascular risk markers through non-invasive ultrasound methodologies in periodontitis patients
  184. Advanced neuroimaging and criminal interrogation in lie detection
  185. Maternal factors for neural tube defects in offspring: An umbrella review
  186. The chemoprotective hormetic effects of rosmarinic acid
  187. CBD’s potential impact on Parkinson’s disease: An updated overview
  188. Progress in cytokine research for ARDS: A comprehensive review
  189. Utilizing reactive oxygen species-scavenging nanoparticles for targeting oxidative stress in the treatment of ischemic stroke: A review
  190. NRXN1-related disorders, attempt to better define clinical assessment
  191. Lidocaine infusion for the treatment of complex regional pain syndrome: Case series and literature review
  192. Trends and future directions of autophagy in osteosarcoma: A bibliometric analysis
  193. Iron in ventricular remodeling and aneurysms post-myocardial infarction
  194. Case Reports
  195. Sirolimus potentiated angioedema: A case report and review of the literature
  196. Identification of mixed anaerobic infections after inguinal hernia repair based on metagenomic next-generation sequencing: A case report
  197. Successful treatment with bortezomib in combination with dexamethasone in a middle-aged male with idiopathic multicentric Castleman’s disease: A case report
  198. Complete heart block associated with hepatitis A infection in a female child with fatal outcome
  199. Elevation of D-dimer in eosinophilic gastrointestinal diseases in the absence of venous thrombosis: A case series and literature review
  200. Four years of natural progressive course: A rare case report of juvenile Xp11.2 translocations renal cell carcinoma with TFE3 gene fusion
  201. Advancing prenatal diagnosis: Echocardiographic detection of Scimitar syndrome in China – A case series
  202. Outcomes and complications of hemodialysis in patients with renal cancer following bilateral nephrectomy
  203. Anti-HMGCR myopathy mimicking facioscapulohumeral muscular dystrophy
  204. Recurrent opportunistic infections in a HIV-negative patient with combined C6 and NFKB1 mutations: A case report, pedigree analysis, and literature review
  205. Letter to the Editor
  206. Letter to the Editor: Total parenteral nutrition-induced Wernicke’s encephalopathy after oncologic gastrointestinal surgery
  207. Erratum
  208. Erratum to “Bladder-embedded ectopic intrauterine device with calculus”
  209. Retraction
  210. Retraction of “XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis”
  211. Corrigendum
  212. Corrigendum to “Investigating hormesis, aging, and neurodegeneration: From bench to clinics”
  213. Corrigendum to “Frankincense: A neuronutrient to approach Parkinson’s disease treatment”
  214. Special Issue The evolving saga of RNAs from bench to bedside - Part II
  215. Machine-learning-based prediction of a diagnostic model using autophagy-related genes based on RNA sequencing for patients with papillary thyroid carcinoma
  216. Unlocking the future of hepatocellular carcinoma treatment: A comprehensive analysis of disulfidptosis-related lncRNAs for prognosis and drug screening
  217. Elevated mRNA level indicates FSIP1 promotes EMT and gastric cancer progression by regulating fibroblasts in tumor microenvironment
  218. Special Issue Advancements in oncology: bridging clinical and experimental research - Part I
  219. Ultrasound-guided transperineal vs transrectal prostate biopsy: A meta-analysis of diagnostic accuracy and complication rates
  220. Assessment of diagnostic value of unilateral systematic biopsy combined with targeted biopsy in detecting clinically significant prostate cancer
  221. SENP7 inhibits glioblastoma metastasis and invasion by dissociating SUMO2/3 binding to specific target proteins
  222. MARK1 suppress malignant progression of hepatocellular carcinoma and improves sorafenib resistance through negatively regulating POTEE
  223. Analysis of postoperative complications in bladder cancer patients
  224. Carboplatin combined with arsenic trioxide versus carboplatin combined with docetaxel treatment for LACC: A randomized, open-label, phase II clinical study
  225. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part I
  226. Comprehensive pan-cancer investigation of carnosine dipeptidase 1 and its prospective prognostic significance in hepatocellular carcinoma
  227. Identification of signatures associated with microsatellite instability and immune characteristics to predict the prognostic risk of colon cancer
  228. Single-cell analysis identified key macrophage subpopulations associated with atherosclerosis
https://doi.org/10.1515/med-2024-1077
Keywords for this article
uterine adhesion; tubal mucosa; endometrium; co-culture; endometrial tolerance
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. EDNRB inhibits the growth and migration of prostate cancer cells by activating the cGMP-PKG pathway
  3. STK11 (LKB1) mutation suppresses ferroptosis in lung adenocarcinoma by facilitating monounsaturated fatty acid synthesis
  4. Association of SOX6 gene polymorphisms with Kashin-Beck disease risk in the Chinese Han population
  5. The pyroptosis-related signature predicts prognosis and influences the tumor immune microenvironment in dedifferentiated liposarcoma
  6. METTL3 attenuates ferroptosis sensitivity in lung cancer via modulating TFRC
  7. Identification and validation of molecular subtypes and prognostic signature for stage I and stage II gastric cancer based on neutrophil extracellular traps
  8. Novel lumbar plexus block versus femoral nerve block for analgesia and motor recovery after total knee arthroplasty
  9. Correlation between ABCB1 and OLIG2 polymorphisms and the severity and prognosis of patients with cerebral infarction
  10. Study on the radiotherapy effect and serum neutral granulocyte lymphocyte ratio and inflammatory factor expression of nasopharyngeal carcinoma
  11. Transcriptome analysis of effects of Tecrl deficiency on cardiometabolic and calcium regulation in cardiac tissue
  12. Aflatoxin B1 induces infertility, fetal deformities, and potential therapies
  13. Serum levels of HMW adiponectin and its receptors are associated with cytokine levels and clinical characteristics in chronic obstructive pulmonary disease
  14. METTL3-mediated methylation of CYP2C19 mRNA may aggravate clopidogrel resistance in ischemic stroke patients
  15. Understand how machine learning impact lung cancer research from 2010 to 2021: A bibliometric analysis
  16. Pressure ulcers in German hospitals: Analysis of reimbursement and length of stay
  17. Metformin plus L-carnitine enhances brown/beige adipose tissue activity via Nrf2/HO-1 signaling to reduce lipid accumulation and inflammation in murine obesity
  18. Downregulation of carbonic anhydrase IX expression in mouse xenograft nasopharyngeal carcinoma model via doxorubicin nanobubble combined with ultrasound
  19. Feasibility of 3-dimensional printed models in simulated training and teaching of transcatheter aortic valve replacement
  20. miR-335-3p improves type II diabetes mellitus by IGF-1 regulating macrophage polarization
  21. The analyses of human MCPH1 DNA repair machinery and genetic variations
  22. Activation of Piezo1 increases the sensitivity of breast cancer to hyperthermia therapy
  23. Comprehensive analysis based on the disulfidptosis-related genes identifies hub genes and immune infiltration for pancreatic adenocarcinoma
  24. Changes of serum CA125 and PGE2 before and after high-intensity focused ultrasound combined with GnRH-a in treatment of patients with adenomyosis
  25. The clinical value of the hepatic venous pressure gradient in patients undergoing hepatic resection for hepatocellular carcinoma with or without liver cirrhosis
  26. Development and validation of a novel model to predict pulmonary embolism in cardiology suspected patients: A 10-year retrospective analysis
  27. Downregulation of lncRNA XLOC_032768 in diabetic patients predicts the occurrence of diabetic nephropathy
  28. Circ_0051428 targeting miR-885-3p/MMP2 axis enhances the malignancy of cervical cancer
  29. Effectiveness of ginkgo diterpene lactone meglumine on cognitive function in patients with acute ischemic stroke
  30. The construction of a novel prognostic prediction model for glioma based on GWAS-identified prognostic-related risk loci
  31. Evaluating the impact of childhood BMI on the risk of coronavirus disease 2019: A Mendelian randomization study
  32. Lactate dehydrogenase to albumin ratio is associated with in-hospital mortality in patients with acute heart failure: Data from the MIMIC-III database
  33. CD36-mediated podocyte lipotoxicity promotes foot process effacement
  34. Efficacy of etonogestrel subcutaneous implants versus the levonorgestrel-releasing intrauterine system in the conservative treatment of adenomyosis
  35. FLRT2 mediates chondrogenesis of nasal septal cartilage and mandibular condyle cartilage
  36. Challenges in treating primary immune thrombocytopenia patients undergoing COVID-19 vaccination: A retrospective study
  37. Let-7 family regulates HaCaT cell proliferation and apoptosis via the ΔNp63/PI3K/AKT pathway
  38. Phospholipid transfer protein ameliorates sepsis-induced cardiac dysfunction through NLRP3 inflammasome inhibition
  39. Postoperative cognitive dysfunction in elderly patients with colorectal cancer: A randomized controlled study comparing goal-directed and conventional fluid therapy
  40. Long-pulsed ultrasound-mediated microbubble thrombolysis in a rat model of microvascular obstruction
  41. High SEC61A1 expression predicts poor outcome of acute myeloid leukemia
  42. Comparison of polymerase chain reaction and next-generation sequencing with conventional urine culture for the diagnosis of urinary tract infections: A meta-analysis
  43. Secreted frizzled-related protein 5 protects against renal fibrosis by inhibiting Wnt/β-catenin pathway
  44. Pan-cancer and single-cell analysis of actin cytoskeleton genes related to disulfidptosis
  45. Overexpression of miR-532-5p restrains oxidative stress response of chondrocytes in nontraumatic osteonecrosis of the femoral head by inhibiting ABL1
  46. Autologous liver transplantation for unresectable hepatobiliary malignancies in enhanced recovery after surgery model
  47. Clinical analysis of incomplete rupture of the uterus secondary to previous cesarean section
  48. Abnormal sleep duration is associated with sarcopenia in older Chinese people: A large retrospective cross-sectional study
  49. No genetic causality between obesity and benign paroxysmal vertigo: A two-sample Mendelian randomization study
  50. Identification and validation of autophagy-related genes in SSc
  51. Long non-coding RNA SRA1 suppresses radiotherapy resistance in esophageal squamous cell carcinoma by modulating glycolytic reprogramming
  52. Evaluation of quality of life in patients with schizophrenia: An inpatient social welfare institution-based cross-sectional study
  53. The possible role of oxidative stress marker glutathione in the assessment of cognitive impairment in multiple sclerosis
  54. Compilation of a self-management assessment scale for postoperative patients with aortic dissection
  55. Left atrial appendage closure in conjunction with radiofrequency ablation: Effects on left atrial functioning in patients with paroxysmal atrial fibrillation
  56. Effect of anterior femoral cortical notch grade on postoperative function and complications during TKA surgery: A multicenter, retrospective study
  57. Clinical characteristics and assessment of risk factors in patients with influenza A-induced severe pneumonia after the prevalence of SARS-CoV-2
  58. Analgesia nociception index is an indicator of laparoscopic trocar insertion-induced transient nociceptive stimuli
  59. High STAT4 expression correlates with poor prognosis in acute myeloid leukemia and facilitates disease progression by upregulating VEGFA expression
  60. Factors influencing cardiovascular system-related post-COVID-19 sequelae: A single-center cohort study
  61. HOXD10 regulates intestinal permeability and inhibits inflammation of dextran sulfate sodium-induced ulcerative colitis through the inactivation of the Rho/ROCK/MMPs axis
  62. Mesenchymal stem cell-derived exosomal miR-26a induces ferroptosis, suppresses hepatic stellate cell activation, and ameliorates liver fibrosis by modulating SLC7A11
  63. Endovascular thrombectomy versus intravenous thrombolysis for primary distal, medium vessel occlusion in acute ischemic stroke
  64. ANO6 (TMEM16F) inhibits gastrointestinal stromal tumor growth and induces ferroptosis
  65. Prognostic value of EIF5A2 in solid tumors: A meta-analysis and bioinformatics analysis
  66. The role of enhanced expression of Cx43 in patients with ulcerative colitis
  67. Choosing a COVID-19 vaccination site might be driven by anxiety and body vigilance
  68. Role of ICAM-1 in triple-negative breast cancer
  69. Cost-effectiveness of ambroxol in the treatment of Gaucher disease type 2
  70. HLA-DRB5 promotes immune thrombocytopenia via activating CD8+ T cells
  71. Efficacy and factors of myofascial release therapy combined with electrical and magnetic stimulation in the treatment of chronic pelvic pain syndrome
  72. Efficacy of tacrolimus monotherapy in primary membranous nephropathy
  73. Mechanisms of Tripterygium wilfordii Hook F on treating rheumatoid arthritis explored by network pharmacology analysis and molecular docking
  74. FBXO45 levels regulated ferroptosis renal tubular epithelial cells in a model of diabetic nephropathy by PLK1
  75. Optimizing anesthesia strategies to NSCLC patients in VATS procedures: Insights from drug requirements and patient recovery patterns
  76. Alpha-lipoic acid upregulates the PPARγ/NRF2/GPX4 signal pathway to inhibit ferroptosis in the pathogenesis of unexplained recurrent pregnancy loss
  77. Correlation between fat-soluble vitamin levels and inflammatory factors in paediatric community-acquired pneumonia: A prospective study
  78. CD1d affects the proliferation, migration, and apoptosis of human papillary thyroid carcinoma TPC-1 cells via regulating MAPK/NF-κB signaling pathway
  79. miR-let-7a inhibits sympathetic nerve remodeling after myocardial infarction by downregulating the expression of nerve growth factor
  80. Immune response analysis of solid organ transplantation recipients inoculated with inactivated COVID-19 vaccine: A retrospective analysis
  81. The H2Valdien derivatives regulate the epithelial–mesenchymal transition of hepatoma carcinoma cells through the Hedgehog signaling pathway
  82. Clinical efficacy of dexamethasone combined with isoniazid in the treatment of tuberculous meningitis and its effect on peripheral blood T cell subsets
  83. Comparison of short-segment and long-segment fixation in treatment of degenerative scoliosis and analysis of factors associated with adjacent spondylolisthesis
  84. Lycopene inhibits pyroptosis of endothelial progenitor cells induced by ox-LDL through the AMPK/mTOR/NLRP3 pathway
  85. Methylation regulation for FUNDC1 stability in childhood leukemia was up-regulated and facilitates metastasis and reduces ferroptosis of leukemia through mitochondrial damage by FBXL2
  86. Correlation of single-fiber electromyography studies and functional status in patients with amyotrophic lateral sclerosis
  87. Risk factors of postoperative airway obstruction complications in children with oral floor mass
  88. Expression levels and clinical significance of serum miR-19a/CCL20 in patients with acute cerebral infarction
  89. Physical activity and mental health trends in Korean adolescents: Analyzing the impact of the COVID-19 pandemic from 2018 to 2022
  90. Evaluating anemia in HIV-infected patients using chest CT
  91. Ponticulus posticus and skeletal malocclusion: A pilot study in a Southern Italian pre-orthodontic court
  92. Causal association of circulating immune cells and lymphoma: A Mendelian randomization study
  93. Assessment of the renal function and fibrosis indexes of conventional western medicine with Chinese medicine for dredging collaterals on treating renal fibrosis: A systematic review and meta-analysis
  94. Comprehensive landscape of integrator complex subunits and their association with prognosis and tumor microenvironment in gastric cancer
  95. New target-HMGCR inhibitors for the treatment of primary sclerosing cholangitis: A drug Mendelian randomization study
  96. Population pharmacokinetics of meropenem in critically ill patients
  97. Comparison of the ability of newly inflammatory markers to predict complicated appendicitis
  98. Comparative morphology of the cruciate ligaments: A radiological study
  99. Immune landscape of hepatocellular carcinoma: The central role of TP53-inducible glycolysis and apoptosis regulator
  100. Serum SIRT3 levels in epilepsy patients and its association with clinical outcomes and severity: A prospective observational study
  101. SHP-1 mediates cigarette smoke extract-induced epithelial–mesenchymal transformation and inflammation in 16HBE cells
  102. Acute hyper-hypoxia accelerates the development of depression in mice via the IL-6/PGC1α/MFN2 signaling pathway
  103. The GJB3 correlates with the prognosis, immune cell infiltration, and therapeutic responses in lung adenocarcinoma
  104. Physical fitness and blood parameters outcomes of breast cancer survivor in a low-intensity circuit resistance exercise program
  105. Exploring anesthetic-induced gene expression changes and immune cell dynamics in atrial tissue post-coronary artery bypass graft surgery
  106. Empagliflozin improves aortic injury in obese mice by regulating fatty acid metabolism
  107. Analysis of the risk factors of the radiation-induced encephalopathy in nasopharyngeal carcinoma: A retrospective cohort study
  108. Reproductive outcomes in women with BRCA 1/2 germline mutations: A retrospective observational study and literature review
  109. Evaluation of upper airway ultrasonographic measurements in predicting difficult intubation: A cross-section of the Turkish population
  110. Prognostic and diagnostic value of circulating IGFBP2 in pancreatic cancer
  111. Postural stability after operative reconstruction of the AFTL in chronic ankle instability comparing three different surgical techniques
  112. Research trends related to emergence agitation in the post-anaesthesia care unit from 2001 to 2023: A bibliometric analysis
  113. Frequency and clinicopathological correlation of gastrointestinal polyps: A six-year single center experience
  114. ACSL4 mediates inflammatory bowel disease and contributes to LPS-induced intestinal epithelial cell dysfunction by activating ferroptosis and inflammation
  115. Affibody-based molecular probe 99mTc-(HE)3ZHER2:V2 for non-invasive HER2 detection in ovarian and breast cancer xenografts
  116. Effectiveness of nutritional support for clinical outcomes in gastric cancer patients: A meta-analysis of randomized controlled trials
  117. The relationship between IFN-γ, IL-10, IL-6 cytokines, and severity of the condition with serum zinc and Fe in children infected with Mycoplasma pneumoniae
  118. Paraquat disrupts the blood–brain barrier by increasing IL-6 expression and oxidative stress through the activation of PI3K/AKT signaling pathway
  119. Sleep quality associate with the increased prevalence of cognitive impairment in coronary artery disease patients: A retrospective case–control study
  120. Dioscin protects against chronic prostatitis through the TLR4/NF-κB pathway
  121. Association of polymorphisms in FBN1, MYH11, and TGF-β signaling-related genes with susceptibility of sporadic thoracic aortic aneurysm and dissection in the Zhejiang Han population
  122. Application value of multi-parameter magnetic resonance image-transrectal ultrasound cognitive fusion in prostate biopsy
  123. Laboratory variables‐based artificial neural network models for predicting fatty liver disease: A retrospective study
  124. Decreased BIRC5-206 promotes epithelial–mesenchymal transition in nasopharyngeal carcinoma through sponging miR-145-5p
  125. Sepsis induces the cardiomyocyte apoptosis and cardiac dysfunction through activation of YAP1/Serpine1/caspase-3 pathway
  126. Assessment of iron metabolism and iron deficiency in incident patients on incident continuous ambulatory peritoneal dialysis
  127. Tibial periosteum flap combined with autologous bone grafting in the treatment of Gustilo-IIIB/IIIC open tibial fractures
  128. The application of intravenous general anesthesia under nasopharyngeal airway assisted ventilation undergoing ureteroscopic holmium laser lithotripsy: A prospective, single-center, controlled trial
  129. Long intergenic noncoding RNA for IGF2BP2 stability suppresses gastric cancer cell apoptosis by inhibiting the maturation of microRNA-34a
  130. Role of FOXM1 and AURKB in regulating keratinocyte function in psoriasis
  131. Parental control attitudes over their pre-school children’s diet
  132. The role of auto-HSCT in extranodal natural killer/T cell lymphoma
  133. Significance of negative cervical cytology and positive HPV in the diagnosis of cervical lesions by colposcopy
  134. Echinacoside inhibits PASMCs calcium overload to prevent hypoxic pulmonary artery remodeling by regulating TRPC1/4/6 and calmodulin
  135. ADAR1 plays a protective role in proximal tubular cells under high glucose conditions by attenuating the PI3K/AKT/mTOR signaling pathway
  136. The risk of cancer among insulin glargine users in Lithuania: A retrospective population-based study
  137. The unusual location of primary hydatid cyst: A case series study
  138. Intraoperative changes in electrophysiological monitoring can be used to predict clinical outcomes in patients with spinal cavernous malformation
  139. Obesity and risk of placenta accreta spectrum: A meta-analysis
  140. Shikonin alleviates asthma phenotypes in mice via an airway epithelial STAT3-dependent mechanism
  141. NSUN6 and HTR7 disturbed the stability of carotid atherosclerotic plaques by regulating the immune responses of macrophages
  142. The effect of COVID-19 lockdown on admission rates in Maternity Hospital
  143. Temporal muscle thickness is not a prognostic predictor in patients with high-grade glioma, an experience at two centers in China
  144. Luteolin alleviates cerebral ischemia/reperfusion injury by regulating cell pyroptosis
  145. Therapeutic role of respiratory exercise in patients with tuberculous pleurisy
  146. Effects of CFTR-ENaC on spinal cord edema after spinal cord injury
  147. Irisin-regulated lncRNAs and their potential regulatory functions in chondrogenic differentiation of human mesenchymal stem cells
  148. DMD mutations in pediatric patients with phenotypes of Duchenne/Becker muscular dystrophy
  149. Combination of C-reactive protein and fibrinogen-to-albumin ratio as a novel predictor of all-cause mortality in heart failure patients
  150. Significant role and the underly mechanism of cullin-1 in chronic obstructive pulmonary disease
  151. Ferroptosis-related prognostic model of mantle cell lymphoma
  152. Observation of choking reaction and other related indexes in elderly painless fiberoptic bronchoscopy with transnasal high-flow humidification oxygen therapy
  153. A bibliometric analysis of Prader-Willi syndrome from 2002 to 2022
  154. The causal effects of childhood sunburn occasions on melanoma: A univariable and multivariable Mendelian randomization study
  155. Oxidative stress regulates glycogen synthase kinase-3 in lymphocytes of diabetes mellitus patients complicated with cerebral infarction
  156. Role of COX6C and NDUFB3 in septic shock and stroke
  157. Trends in disease burden of type 2 diabetes, stroke, and hypertensive heart disease attributable to high BMI in China: 1990–2019
  158. Purinergic P2X7 receptor mediates hyperoxia-induced injury in pulmonary microvascular endothelial cells via NLRP3-mediated pyroptotic pathway
  159. Investigating the role of oviductal mucosa–endometrial co-culture in modulating factors relevant to embryo implantation
  160. Analgesic effect of external oblique intercostal block in laparoscopic cholecystectomy: A retrospective study
  161. Elevated serum miR-142-5p correlates with ischemic lesions and both NSE and S100β in ischemic stroke patients
  162. Correlation between the mechanism of arteriopathy in IgA nephropathy and blood stasis syndrome: A cohort study
  163. Risk factors for progressive kyphosis after percutaneous kyphoplasty in osteoporotic vertebral compression fracture
  164. Predictive role of neuron-specific enolase and S100-β in early neurological deterioration and unfavorable prognosis in patients with ischemic stroke
  165. The potential risk factors of postoperative cognitive dysfunction for endovascular therapy in acute ischemic stroke with general anesthesia
  166. Fluoxetine inhibited RANKL-induced osteoclastic differentiation in vitro
  167. Detection of serum FOXM1 and IGF2 in patients with ARDS and their correlation with disease and prognosis
  168. Rhein promotes skin wound healing by activating the PI3K/AKT signaling pathway
  169. Differences in mortality risk by levels of physical activity among persons with disabilities in South Korea
  170. Review Articles
  171. Cutaneous signs of selected cardiovascular disorders: A narrative review
  172. XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis
  173. A narrative review on adverse drug reactions of COVID-19 treatments on the kidney
  174. Emerging role and function of SPDL1 in human health and diseases
  175. Adverse reactions of piperacillin: A literature review of case reports
  176. Molecular mechanism and intervention measures of microvascular complications in diabetes
  177. Regulation of mesenchymal stem cell differentiation by autophagy
  178. Molecular landscape of borderline ovarian tumours: A systematic review
  179. Advances in synthetic lethality modalities for glioblastoma multiforme
  180. Investigating hormesis, aging, and neurodegeneration: From bench to clinics
  181. Frankincense: A neuronutrient to approach Parkinson’s disease treatment
  182. Sox9: A potential regulator of cancer stem cells in osteosarcoma
  183. Early detection of cardiovascular risk markers through non-invasive ultrasound methodologies in periodontitis patients
  184. Advanced neuroimaging and criminal interrogation in lie detection
  185. Maternal factors for neural tube defects in offspring: An umbrella review
  186. The chemoprotective hormetic effects of rosmarinic acid
  187. CBD’s potential impact on Parkinson’s disease: An updated overview
  188. Progress in cytokine research for ARDS: A comprehensive review
  189. Utilizing reactive oxygen species-scavenging nanoparticles for targeting oxidative stress in the treatment of ischemic stroke: A review
  190. NRXN1-related disorders, attempt to better define clinical assessment
  191. Lidocaine infusion for the treatment of complex regional pain syndrome: Case series and literature review
  192. Trends and future directions of autophagy in osteosarcoma: A bibliometric analysis
  193. Iron in ventricular remodeling and aneurysms post-myocardial infarction
  194. Case Reports
  195. Sirolimus potentiated angioedema: A case report and review of the literature
  196. Identification of mixed anaerobic infections after inguinal hernia repair based on metagenomic next-generation sequencing: A case report
  197. Successful treatment with bortezomib in combination with dexamethasone in a middle-aged male with idiopathic multicentric Castleman’s disease: A case report
  198. Complete heart block associated with hepatitis A infection in a female child with fatal outcome
  199. Elevation of D-dimer in eosinophilic gastrointestinal diseases in the absence of venous thrombosis: A case series and literature review
  200. Four years of natural progressive course: A rare case report of juvenile Xp11.2 translocations renal cell carcinoma with TFE3 gene fusion
  201. Advancing prenatal diagnosis: Echocardiographic detection of Scimitar syndrome in China – A case series
  202. Outcomes and complications of hemodialysis in patients with renal cancer following bilateral nephrectomy
  203. Anti-HMGCR myopathy mimicking facioscapulohumeral muscular dystrophy
  204. Recurrent opportunistic infections in a HIV-negative patient with combined C6 and NFKB1 mutations: A case report, pedigree analysis, and literature review
  205. Letter to the Editor
  206. Letter to the Editor: Total parenteral nutrition-induced Wernicke’s encephalopathy after oncologic gastrointestinal surgery
  207. Erratum
  208. Erratum to “Bladder-embedded ectopic intrauterine device with calculus”
  209. Retraction
  210. Retraction of “XRCC1 and hOGG1 polymorphisms and endometrial carcinoma: A meta-analysis”
  211. Corrigendum
  212. Corrigendum to “Investigating hormesis, aging, and neurodegeneration: From bench to clinics”
  213. Corrigendum to “Frankincense: A neuronutrient to approach Parkinson’s disease treatment”
  214. Special Issue The evolving saga of RNAs from bench to bedside - Part II
  215. Machine-learning-based prediction of a diagnostic model using autophagy-related genes based on RNA sequencing for patients with papillary thyroid carcinoma
  216. Unlocking the future of hepatocellular carcinoma treatment: A comprehensive analysis of disulfidptosis-related lncRNAs for prognosis and drug screening
  217. Elevated mRNA level indicates FSIP1 promotes EMT and gastric cancer progression by regulating fibroblasts in tumor microenvironment
  218. Special Issue Advancements in oncology: bridging clinical and experimental research - Part I
  219. Ultrasound-guided transperineal vs transrectal prostate biopsy: A meta-analysis of diagnostic accuracy and complication rates
  220. Assessment of diagnostic value of unilateral systematic biopsy combined with targeted biopsy in detecting clinically significant prostate cancer
  221. SENP7 inhibits glioblastoma metastasis and invasion by dissociating SUMO2/3 binding to specific target proteins
  222. MARK1 suppress malignant progression of hepatocellular carcinoma and improves sorafenib resistance through negatively regulating POTEE
  223. Analysis of postoperative complications in bladder cancer patients
  224. Carboplatin combined with arsenic trioxide versus carboplatin combined with docetaxel treatment for LACC: A randomized, open-label, phase II clinical study
  225. Special Issue Exploring the biological mechanism of human diseases based on MultiOmics Technology - Part I
  226. Comprehensive pan-cancer investigation of carnosine dipeptidase 1 and its prospective prognostic significance in hepatocellular carcinoma
  227. Identification of signatures associated with microsatellite instability and immune characteristics to predict the prognostic risk of colon cancer
  228. Single-cell analysis identified key macrophage subpopulations associated with atherosclerosis
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 25.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2024-1077/html
Scroll to top button