Home Study on the Mechanism of Shugan Xiaozhi Fang on Cells with Non-alcoholic Fatty Liver Disease
Article Open Access

Study on the Mechanism of Shugan Xiaozhi Fang on Cells with Non-alcoholic Fatty Liver Disease

  • Yufeng Xing , Chuantao Zhang , Fenfen Zhai EMAIL logo , Tianran Zhou , Xiang Cui , Zhiyi Han , Deti Peng and Guangdong Tong EMAIL logo
Published/Copyright: December 31, 2019

Abstract

Cells with non-alcoholic fatty liver disease (NAFLD) were studied to determine the mechanism of liver deficiency via the AdipoR2-PPARa pathway. NAFLD cells were randomly divided into a normal control group, blank control group, model group, low dose group, medium dose group, and high dose group. The NAFLD models were established by incubating the cells with linoleic acid (LA) and palmitic acid (PA) (2:1) for 24 h. The test groups were incubated with different doses of Shugan Xiaozhi Fang extract. The pathological changes in cells that accumulated lipids were detected by Oil Red O staining. Malondialdehyde (MDA) and triglyceride (TG) levels were measured. The apoptosis of cells was evaluated by flow cytometry. The levels of AdipoR2, PPARa, CD36, acyl-CoA mRNA, and protein were confirmed by RT- PCR and Western blot. The results of the Oil Red O staining demonstrated that the NAFLD cell model was successfully established. Compared with the model group, the levels of TG and MDA in the groups that received low, medium, and high doses of Shugan Xiaozhi were significantly lower (P<0.01), and a dose effect was evident. In addition, the expression of AdipoR2, PPARa, CD36, acyl-CoA protein, and mRNA in the Shugan Xiaozhi-treated groups was upregulated. Furthermore, the levels of AdipoR2, PPAR, CD36, acyl-CoA protein, and mRNA in all drug treatment groups that were extracted from L-O2 normal human hepatocytes were significantly upregulated (P<0.01). Moreover, the factor pattern of HepG2 human liver carcinoma cells was similar to that of L-O2. The levels of AdipoR, CD36, acyl-CoA, and AdipoR mRNA in the HepG2 low group were increased (P<0.05). AdipoR, PPAR, CD36, and acyl-CoA protein levels and AdipoR mRNA expression were significantly increased in the intermediate dose group and high dose group (P<0.01). Shugan Xiaozhi Fang attenuates hepatic lipid deposition in NAFLD induced by incubating with LA and PA for 24 h, which is associated with the activation of the AdipoR2-PPARα pathway.

1 Introduction

Non-alcoholic fatty liver disease (NAFLD) is severely debilitating the health of people in China with increasing frequency. Currently, a two-hit hypothesis has been widely accepted, which proposes that an increase in free fatty acid and accumulation of fat in the liver are responsible for the pathogenesis of NAFLD [1, 2]{Day, 1998 #1}.

At present, the research on the treatment of NALFD with traditional Chinese medicine mostly starts with dampness, phlegm and heat, and seldom considers qi depression (it is a physical state characterized by introversion and instability, melancholy and fragility, sensitivity and suspicion, which is caused by long-term emotional disorder and stagnation of qi) as an important pathogenic factor of NALFD [3]. This study is based on clinical findings. It is found that the disease is mainly caused by emotional discomfort, liver failure, spleen failure, phlegm-dampness heat, or blood stasis and other pathological factors accumulated in the liver. Finally, “depression”, “heat” and “blood stasis” are intertwined, and “liver stagnation and spleen deficiency” are the main clinical syndromes [3].

Shugan Xiaozhi Fang has been found to significantly improve the clinical manifestations and laboratory indices of NALFD patients; however, the mechanism is still not clear. Based on a previous study, the influences of Shugan Xiaozhi Fang on the expression of lipid metabolic factors and relevant receptors in hepatocytes with steatosis were observed, and the effects and possible metabolic interaction with NAFLD cells were explored, which provides a theoretical basis for the mechanism of action of Shugan Xiaozhi Fang [3].

2 Materials and Methods

2.1 Preparation of Serum Containing Drugs

Sprague-Dawley rats were acclimated for 1 week, and randomly divided into a blank group, and Shugan Xiaozhi Fang (Guangdong Institute of Traditional Chinese Medicine Engineering Technology, Guangdong, China) high, medium, and low dose groups (n=3) according to body weight. The rats in the high, medium, and low dose groups received Shugan Xiaozhi Fang at doses of 20, 15, and 10 g/kg by gavage twice daily for 3 consecutive days, and those in the blank group were given distilled water (10 mL/kg) instead. On Day 4, the rats were given the corresponding drugs in the morning, and after 2 h, the rats received a second dose of Shugan Xiaozhi Fang that was a repeat of the first morning dose. Blood samples were collected from the abdominal aorta after 1 h, maintained at room temperature for 3-4 h, and then centrifuged at 3000 rpm/min under 4°C. The serum was collected, inactivated at 56°C in a water bath, filtered with a 0.22-μm membrane, and stored at -70°C.

2.2 Cell culture

L-O2 (human fetal hepatocyte cells) and HepG2 (human liver carcinoma cells) cells (ATCC, VA, USA) were cultured with Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, NY, USA) containing 10% fetal bovine serum (FBS) (Gibco, NY, USA) and divided into a normal group, fenofibrate group (25 μM), blank control group, model group, low dose group, medium dose group, and high dose group (Serum Containing Drugs in high, middle and low dose groups were derived from section 2.1). The cells in the normal control group were cultured with medium only, and those in the blank control group were cultured with medium containing 0.3% skim bovine serum albumin (BSA) (Sigma-Aldrich, MO, USA). The cells in fenofibrate group (the drug control group) were cultured with medium containing 25 μM fenofibrate. Cells in all groups were cultured for 48 hours. For the model and drug treatment groups, after the medium was discarded, a lipid deposition inducer was then added and reacted for 24 h.

2.3 Model establishment and identification

The L-O2 and HepG2 cells were cultured with (RPMI)-1640 medium (Gibco, NY, USA) containing 10% fetal bovine serum (FBS) (Gibco, NY, USA). When the growth of the cells was in the logarithmic stage, the cells were subcultured and divided into a normal group and model group. After being cultured for 24 h, the control group was incubated with RPMI-1640 medium containing 1% BSA, and the model group was incubated with linoleic acid/palmitic acid solution (LA:PA=2:1) for 24 h. Triglyceride (TG) and malondialdehyde (MDA) levels were measured and calculated according to the following equation:

TG or MDA level (mmol/L) = (sample OD-blank OD)/(standard OD-blank OD) × concentration of standard sample.

The wavelengths for OD measurement are 450nm and 532nm respectively.

2.4 Oil Red O staining

Hepatocytes were grown on cover glasses. In the model group, the cells were cultured with high-fat medium (containing 200 μM oleic acid and 100 μM palmitic acid) for 24 h. The cells in the control group were cultured with medium containing 0.3% skim BSA for 24 h. The cover glasses were washed with sterile PBS, and fixed with 4% formaldehyde for 10 min. Afterwards, they were adequately washed, rinsed with 60% isopropanol, stained with Oil Red O (Beyotime Biotechnology, Shanghai, China) for 10 min, differentiated by 60% isopropanol until the mesenchyme became clear, and then washed with distilled water. After the cell nuclei were stained with hematoxylin, the cover glasses were adequately washed with distilled water again, and sealed with glycerin and gelatin. The lipid droplet distribution in the liver cells was observed by microscope.

2.5 Detection for Annexin V-FITC and PI apoptosis

The suspended cells were collected by centrifugation (2000 rpm, 5 min), and then digested with trypsin without EDTA. The cells were washed with phosphate-buffered saline (PBS) (Beyotime Biotechnology, Shanghai, China) twice, and collected by centrifugation (2000 rpm, 5 min). The cells (1-5×105) were then suspended in 500 μL of binding buffer, mixed with 5 μL of Annexin V-FITC, and 5 μL of propidium iodide for 5-15 min at room temperature avoiding light, and finally were analyzed using flow cytometry.

2.6 Detection of dipoR2, PPARα, CD36, and acyl-CoA mRNA levels

The cell precipitate was collected and digested with 0.8 mL of TRIzol reagent (Invitrogen, CA, USA). The homogenate was maintained at room temperature for 5-10 min, and a 0.2-fold volume of chloroform was added. After mixing for 15 s, the homogenate was centrifuged at 12000 × g for 10 min at 4°C. The supernatant was transferred to a clear tube, and a 0.5-fold volume of isopropanol was added. After mixing, the solution was maintained at -20°C for 10 min and then centrifuged at 12000 × g for 10 min under 4°C to separate the precipitate. The RNA precipitate was washed with 1 mL of 75% ethanol, and centrifuged at 7500 × g for 5 min at 4°C to discard the supernatant. After the RNA precipitate was appropriately dried, RNase-free water was added to dissolve the RNA. The RNA was centrifuged at 2000 rpm for 20 s. The integrity of the RNA was determined by agarose gel electrophoresis.

Total RNA was reversely transcribed using a reverse transcription kit (Takara, Dalian, China) to obtain cDNA. A fluorescent quantitation PCR reaction system (Takara, Dalian, China) was used: cDNA 1 μL, upstream primer 100 nM, downstream primer 100 nM, 2× SYBR Green PCR Master mix 12.5 μL, and then the volume was brought to 25 μL with ddH2O. Reaction conditions: 94°C for 3 min, 94°C for 30 s, 59°C for 30 s, 72°C for 45 s, 40 cycles total, 72°C for 5 min, and then the reactions were stored at 4°C.

2.7 Detection of AdipoR2, PPARα, CD36, and acyl-CoA protein levels

The cells were collected, mixed with 1 mL of lysis buffer, blown, placed on ice for 10-20 min, blown for 5-20 min, and transferred into a 1.5-mL tube. The cells were ultrasonicated 3 times (3 s each time), and centrifuged at 9000 rpm for 10 min. The obtained supernatant was transferred into a 1.5-mL tube, and stored at -20°C. The protein concentration was measured by bicinchoninic acid (BCA). After transformation, the membrane was soaked in 5% skim milk at 37°C for 2 h, and then washed with Tris-buffered saline (TBS) containing 0.1% Tween-20 (TBST) 2-3 times. Primary antibodies were added (goat anti-AdipoR2 antibody, mouse anti-PPARα antibody, rabbit anti-CD36 antibody, rabbit acyl-CoA antibody, and mouse anti-β-actin antibody) (Abcam, MA, USA), and then the membrane was incubated at room temperature for 2 h. The membrane was washed with TBST 4 times, 5-10 min/time. Secondary antibody was added, and then the membrane was incubated at room temperature for 2 h. The membrane was washed with TBST 4 times, 5-10 min/time, exposed in a dark room, and developed using X-ray film.

2.8 Statistical analysis

SPSS 17.0 software was used to analyze the data. The measurement data are expressed as the mean ± SD. One-way analysis of variance (ANOVA) was used to analyze the comparisons within group. When the variance was equal, least squares difference (LSD) was used to perform comparison between groups, and Dunnett’s T3 test was used when the variance was not equal. P0.05 was termed as statistical difference.

The research related to animal use has been complied with all the relevant national regulations and institutional policies, and has been approved by the Animal experiment center of Guangzhou university of Chinese medicine review board committee.

3 Results

3.1 Oil Red O staining

Pathological changes of Oil Red O staining in L-O2 human fetal hepatocyte cells and HepG2 human liver carcinoma cells were observed under a microscope. As illustrated in Figures 1 and 2, the cell nuclei of hepatocytes in the normal group (Figure 1A, 2A) and Fenofibrate group (Figure 1B, 2B) were blue. Orange lipid droplets were not observed, and the cell structure was normal. The hepatocytes in the model group (Figure 1C, 2C) were affected with orange lipid droplets of different sizes and diffuse orange lipid droplet fusion. Most of the cell nuclei were pushed to one side, and the cell structure was disordered. Compared with the model group (Figure 1D, 2D), the cells in the low dose group exhibited reduced lipid droplet deposition, and the deposition in the medium (Figure 1E, 2E) and high dose groups (Figure 1F, 2F) was significantly decreased.

Figure 1 Oil Red O staining of the HepG2 cells in each group. A: Normal group; B: Fenofibrate group; C: model group; D: low dose group; E: medium dose group; F: high dose group. The hepatocytes in the model group were affected with orange lipid droplets of different sizes and diffuse orange lipid droplet fusion (scale bar 100 μm).
Figure 1

Oil Red O staining of the HepG2 cells in each group. A: Normal group; B: Fenofibrate group; C: model group; D: low dose group; E: medium dose group; F: high dose group. The hepatocytes in the model group were affected with orange lipid droplets of different sizes and diffuse orange lipid droplet fusion (scale bar 100 μm).

Figure 2 Oil Red O staining of L-O2 cells in each group. A: Normal group; B: Fenofibrate group; C: Model group; D: Low dose group; E: Medium dose group; F: High dose group. The hepatocytes in the model group were affected with orange lipid droplets of different sizes and diffuse orange lipid droplet fusion (scale bar 100 μm).
Figure 2

Oil Red O staining of L-O2 cells in each group. A: Normal group; B: Fenofibrate group; C: Model group; D: Low dose group; E: Medium dose group; F: High dose group. The hepatocytes in the model group were affected with orange lipid droplets of different sizes and diffuse orange lipid droplet fusion (scale bar 100 μm).

3.2 Changes in the blood fat and liver fat levels

Compared with the normal group, the TG and MDA levels in the L-O2 and HepG2 cells of the model group were significantly increased (P < 0.01). Compared with the model group, those in the 3 dose groups were significantly decreased (P < 0.01), and were increased with the decrease in the dose (Figure 3). Fenofibrate, the approved chemotherapeutic agent for NAFLD, was used in the study and compared with the high dose group. There is no significant difference (P > 0.05).

Figure 3 TG and MDA levels in the L-O2 and HepG2 cells treated with different doses. A.TG levels in cells treated with different doses. B. MDA levels in cells treated with different doses. 1: Normal group; 2: blank control group; 3: Fenofibrate group; 4: model group; 5: low dose group; 6: medium dose group; 7: high dose group. *p<0.05, **p<0.01vs the normal group. #p<0.05, ##p<0.01 vs the model group.
Figure 3

TG and MDA levels in the L-O2 and HepG2 cells treated with different doses. A.TG levels in cells treated with different doses. B. MDA levels in cells treated with different doses. 1: Normal group; 2: blank control group; 3: Fenofibrate group; 4: model group; 5: low dose group; 6: medium dose group; 7: high dose group. *p<0.05, **p<0.01vs the normal group. #p<0.05, ##p<0.01 vs the model group.

Table 1

List of PCR primers.

基因序列(5’-3’)产物/bp
AdipoR2F:CCCTCTGCAAGAGAAGGTGG247
R:AATGCCCAGCACACAGATGA
PPARαF:GCGAACGATTCGACTCAAGC118
R:CATCCCGACAGAAAGGCACT
CD36F:CGCTGAGGACAACACAGTCT113
R:CTGCCACAGCCAGATTGAGA
acyl-CoAF:ATGGAGCCTGAAGAGTTCGG258
R:TACCTCGGGATGACTGAGCA
Beta-actinF:CTCCATCCTGGCCTCGCTGT268
R:GCTGTCACCTTCACCGTTCC

3.3 Apoptosis

The apoptosis of L-O2 and HepG2 cells treated with Shugan Xiaozhi Fang at different doses for 24 h was detected using flow cytometry. Compared with the normal group, the apoptosis rate in the model group was significantly increased (P < 0.01). In the L-O2 cells, the apoptosis rate in the low dose group was significantly lower than that in the model group, and that in the medium and high dose groups was significantly decreased (P < 0.01). In HepG2 cells, the apoptosis rate in the 3 dose groups was significantly lower than that in the model group (P < 0.01). Compared with the normal group, the apoptosis rate in the drug control group wasn’t significantly increased (P > 0.05). The results indicated that Shugan Xiaozhi Fang effectively inhibited the apoptosis of non-alcoholic fatty hepatocytes and was non-toxic to normal cells, as shown in Figure 4.

Figure 4 Influence of dose on apoptosis. The apoptosis of L-O2 and HepG2 cells treated with Shugan Xiaozhi Fang at different doses for 24 h was detected using flow cytometry. 1: Normal group; 2: blank control group; 3: Fenofibrate group 4: model group; 5: low dose group; 6: medium dose group; 7: high dose group. *p<0.05, **p<0.01vs the normal group. #p<0.05,##p<0.01 vs the model group.
Figure 4

Influence of dose on apoptosis. The apoptosis of L-O2 and HepG2 cells treated with Shugan Xiaozhi Fang at different doses for 24 h was detected using flow cytometry. 1: Normal group; 2: blank control group; 3: Fenofibrate group 4: model group; 5: low dose group; 6: medium dose group; 7: high dose group. *p<0.05, **p<0.01vs the normal group. #p<0.05,##p<0.01 vs the model group.

3.4 Change in AdipoR, PPARα, CD36, and acyl-CoA mRNA expression

Compared with the normal group, AdipoR, PPARα, CD36, and acyl-CoA mRNA expression in the L-O2 cell model group was downregulated (P < 0.05 or P < 0.01). Compared with the model group, the expression levels of AdipoR, PPARα, CD36, and acyl-CoA in the medium and high dose groups were significantly increased (P < 0.01). Compared with the model group, the expression levels of AdipoR, PPARα, CD36, and acyl-CoA in HepG2 cells in the medium and high dose groups were significantly increased (P < 0.01) (Figure 5).

Figure 5 AdipoR2, PPARα, CD36, and acyl-CoA mRNA expression. 1: Normal group; 2: blank control group; 3: model group; 4: low dose group; 5: medium dose group; 6: high dose group. *p<0.05, **p<0.01vs the normal group. #p<0.05, ##p<0.01 vs the model group.
Figure 5

AdipoR2, PPARα, CD36, and acyl-CoA mRNA expression. 1: Normal group; 2: blank control group; 3: model group; 4: low dose group; 5: medium dose group; 6: high dose group. *p<0.05, **p<0.01vs the normal group. #p<0.05, ##p<0.01 vs the model group.

3.5 Changes in AdipoR, PPARα, CD36, and acyl-CoA protein expression

Compared with the normal group, AdipoR, PPARα and CD36 protein expression levels in the L-O2 model group were significantly decreased (P < 0.01). The acyl-CoA protein was downregulated without statistical significance (P > 0.05). Compared with the model group, the expression levels of AdipoR, PPARα, CD36, and acyl-CoA in L- O2 cells in the 3 dose groups were significantly increased (P < 0.01) (Figure 6).

Figure 6 Changes in AdipoR, PPARα, CD36, and acyl-CoA protein expression. 1: Normal group; 2: blank control group; 3: model group; 4: low dose group; 5: medium dose group; 6: high dose group. *p<0.05, **p<0.01vs the normal group. #p<0.05, ##p<0.01 vs the model group.
Figure 6

Changes in AdipoR, PPARα, CD36, and acyl-CoA protein expression. 1: Normal group; 2: blank control group; 3: model group; 4: low dose group; 5: medium dose group; 6: high dose group. *p<0.05, **p<0.01vs the normal group. #p<0.05, ##p<0.01 vs the model group.

Compared with the normal group, AdipoR, PPARα, CD36, and acyl-CoA protein expression levels in the HepG2 cell model group were significantly decreased (P<0.05 or P < 0.01). Compared with the model group, AdipoR, CD36 and acyl-CoA proteins in the low dose group were upregulated (P < 0.05), and AdipoR, PPARα, CD36, and acyl-CoA protein expression levels were all significantly increased (P < 0.01) (Figure 6).

The results show that Shogun Xiaozhi Fang was proven to significantly reduce serum TG and MDA levels (Figure 7).

Figure 7 A schematic diagram of mechanism of Shogun Xiaozhi Fang for reducing serum TG and MDA levels.. Shugan Xiaozhi Fang activated the AdipoR2-PPARα-CD36/acyl-CoA signaling pathway. In the liver, Shugan Xiaozhi Fang can upregulate the expression of the PPARα target gene and regulate fatty acid metabolism, such as induction of lipid transporter CD36 gene expression, as well as lipid uptake and transport. It can also upregulate acyl-CoA gene expression and fatty acid oxidation.
Figure 7

A schematic diagram of mechanism of Shogun Xiaozhi Fang for reducing serum TG and MDA levels.. Shugan Xiaozhi Fang activated the AdipoR2-PPARα-CD36/acyl-CoA signaling pathway. In the liver, Shugan Xiaozhi Fang can upregulate the expression of the PPARα target gene and regulate fatty acid metabolism, such as induction of lipid transporter CD36 gene expression, as well as lipid uptake and transport. It can also upregulate acyl-CoA gene expression and fatty acid oxidation.

4 Discussion

NAFLD has been considered as the main reason for chronic liver disease [4, 5]. NAFLD is a metabolic stress that damages the liver, and is closely related to insulin resistance (IR) and genetic susceptibility, including nonalcoholic simple fatty liver, non-alcoholic steatohepatitis, and relevant cirrhosis and hepatocellular carcinoma. Currently, there is no consensus for the treatment of NAFLD. Most of the interventions for NAFLD involve improving the IR.

Adiponectin is one of the widely used intervention targets for NAFLD. It is a protein with 30 kDa, and specifically secreted in adipose tissue, possessing anti-inflammatory, anti-diabetic, and anti-atherosclerotic characteristics [6]. The serum adiponectin level has been proven to be reduced under obesity, IR, NAFLD, and type 2 diabetes mellitus (T2DM) [7, 8]. Thus, adiponectin deficiency-type mice represent IR and diabetes [9]. Contrarily, transgenic overexpression of adiponectin or injection of recombinant adiponectin can prevent the occurrence of diabetes and hyperlipidaemia [10, 11, 12, 13]. Thus, adiponectin plays a very important role in the development of diabetes.

The biological function of adiponectin not only depends on the serum circulation concentration of hormone, but also depends on the expression level and function of the specific receptor (including AdipoR1 and AdipoR2). AdipoR1 and AdipoR2 are widely expressed in each organ and tissue, and are highly expressed in the skeletal muscle and liver, respectively [14]. It has been reported that a deficiency of adiponectin receptors will lead to hyperglycemia and hyperinsulinemia [15, 16]. The triglyceride content in mice with AdipoR1/AdipoR2 knockout is increased, and systemic inflammation, oxidative stress, insulin resistance, and glucose tolerance are aggravated [17]. After AdipoR1/AdipoR2 is activated, fatty acid oxidation in the liver and skeletal muscle is increased, as well as the generation of lactic acid in skeletal muscle. Hepatic gluconeogenesis is reduced, glucose uptake of cells is increased, and inflammation and oxidative stress are inhibited [14].

As a main medium for adiponectin metabolism, AdipoR1 and AdipoR2 play very important roles in transmitting adiponectin signal. In the HepG2 PA cell model, MiR-375 regulates the expression of IL-6, TNF-α, leptin, and adiponectin by mediating AdipoR2 [18]. In skeletal muscle, globular and full-length adiponectin activates AMPK, and stimulates the phosphorylation of ACC, oxidation of fatty acid, and uptake of glucose [13]. Adiponectin can activate PPARα and stimulate fatty acid oxidation to reduce the TG content [14]. AdipoR2 plays a very important role in regulating glucose, lipid metabolism, and NAFLD inflammation, which is related to the activation of the PPARα signaling pathway and inhibition of inflammation [17, 19].

As a critical transcription factor of glycolipid metabolism, PPARα participates in lipid metabolism, energy balance, and expression of inflammatory genes. It is the main regulator of β-oxidation in the liver (mitochondrion and peroxidase) and ω-oxidation in microsomes. In the liver, adiponectin can upregulate the expression of the PPARα target gene and regulate fatty acid metabolism, such as induction of lipid transporter CD36 gene expression, as well as lipid uptake and transport. It can also upregulate acyl-CoA gene expression and fatty acid oxidation. Adiponectin improves insulin sensitivity and glucose uptake by regulating PPAR, and alleviates NAFLD development by the PPAR receptor [20, 21, 22]. Wogonin inhibits hepatocyte lipotoxicity by activating PPARα and increasing AdipoR2 expression [23]. Thus, an increase in the activity of adiponectin signaling pathway AdipoR2-PPARα-CD36/acyl-CoA is an effective method for treating glycolipid metabolic disorder diseases.

Currently, traditional Chinese medicine treats NAFLD by mainly focusing on dampness, phlegm, and heat, but often ignore that qi depression is the main pathogenic factor of non-alcoholic steatohepatitis (NASH). Based on clinical investigation, we found that the disease is mainly caused by accumulation of emotional upset, liver dysfunction, phlegm-damp retention, or blood stasis in the liver. It leads to interaction between depression, heat, and stasis, and subsequent formation by arthralgia blocked in the liver venation. Liver depression and spleen deficiency are the main clinical syndrome types. From the qi depression, we propose that qi depression-phlegm-damp retention-stasis is the pathogenesis of NALFD.

Shugan Xiaozhi Fang was developed from an established prescription, and its formula has been submitted for a Chinese patent (application number: 201610520975.6). Shugan Xiaozhi Fang has been proven to significantly reduce blood fat, free fatty acid levels, and hemorheological indices in non-alcoholic fatty liver disease model rats. The intervention could upregulate expression of PPARα mRNA and L-FABP mRNA, and alleviate the steatosis and inflammation in the liver [3].

In this study, Shugan Xiaozhi Fang was proven to significantly reduce serum TG and MDA levels in the model group, and improve steatosis and apoptosis, which indicates that it possesses the ability to ameliorate NAFLD. We also found that AdipoR2, PPARα, CD36, and acyl-CoA protein and mRNA levels in the model group were downregulated, indicating that AdipoR2-PPARα-CD36/acyl-CoA (the adiponectin signaling pathway) was inhibited. After the intervention by Shugan Xiaozhi Fang, the AdipoR2, PPARα, CD36, acyl-CoA protein, and mRNA levels in cells were upregulated, suggesting that Shugan Xiaozhi Fang activated the AdipoR2-PPARα-CD36/acyl-CoA signaling pathway. Thus, this intervention may be one of the effective treatments for glycolipid metabolic disorder diseases such as NAFLD.

Acknowledgements

The present study was supported by Shenzhen Science and Technology Planning Project (grant No. JCYJ20170307155651057), Sanming Project of Medicine in Shenzhen (grant No. SZSM201612074), Shenzhen Health Family Planning System Research Project (grant No. SZBC2017026), and the Guangdong Natural Science Foundation (grant No. 2018A030313181).

  1. Conflict of interest Authors declare no conflict of interest.

Reference

[1] Day C.P., James O.F., Steatohepatitis: a tale of two “hits”? Gastroenterology, 1998, 114(4), 842-845.10.1016/S0016-5085(98)70599-2Search in Google Scholar

[2] Monteillet L., Gjorgjieva M., Silva M., Verzieux V., Imikirene L., Duchampt A., Guillou H., Mithieux G., Rajas F., Intracellular lipids are an independent cause of liver injury and chronic kidney disease in non alcoholic fatty liver disease-like context, Mo.l Metab., 2018, 16, 100-115.10.1016/j.molmet.2018.07.006Search in Google Scholar PubMed PubMed Central

[3] Xing Y.F., Zhang Z., Fu W.J., Zhou D.Q., Yuen A.C.,et al., Shugan Xiaozhi Decoction Attenuates Nonalcoholic Steatohepatitis by Enhancing PPARalpha and L-FABP Expressions in High-Fat-Fed Rats, Evid. Based Complement Alternat. Med., 2016, 2016, 7870189.10.1155/2016/7870189Search in Google Scholar PubMed PubMed Central

[4] Farrell G.C., Larter C.Z., Nonalcoholic fatty liver disease: from steatosis to cirrhosis, Hepatology 2006, 43(2 Suppl 1), S99-S112.10.1002/hep.20973Search in Google Scholar PubMed

[5] Haga Y., Kanda T., Sasaki R., Nakamura M., Nakamoto S., Yokosuka O., Nonalcoholic fatty liver disease and hepatic cirrhosis: Comparison with viral hepatitis-associated steatosis, World J. Gastroenterol, 2015, 21(46), 12989-12995.10.3748/wjg.v21.i46.12989Search in Google Scholar PubMed PubMed Central

[6] Kadowaki T., Yamauchi T., Kubota N., Hara K., Ueki K., Tobe K., Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome, J. Clin. Inves., 2006, 116(7), 1784-1792.10.1172/JCI29126Search in Google Scholar PubMed PubMed Central

[7] Hivert M.F., Sullivan L.M., Fox C.S., Nathan D.M., D’Agostino R.B. Sr., Wilson P.W., et al., Associations of adiponectin, resistin, and tumor necrosis factor-alpha with insulin resistance, J. Clin. Endocrinol. Metab., 2008, 93(8), 3165-3172.10.1210/jc.2008-0425Search in Google Scholar PubMed PubMed Central

[8] Arita Y., Kihara S., Ouchi N., Takahashi M., Maeda K., Miyagawa J., et al., Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity, Biochem. Biophys. Res. Commun., 1999, 257(1), 79-83.10.1006/bbrc.1999.0255Search in Google Scholar PubMed

[9] Kubota N., Terauchi Y., Yamauchi T., Kubota T., Moroi M., Matsui J., et al., Disruption of adiponectin causes insulin resistance and neointimal formation, J. Biol. Chem., 2002, 277(29), 25863-25866.10.1074/jbc.C200251200Search in Google Scholar PubMed

[10] Fruebis J., Tsao T.S., Javorschi S., Ebbets-Reed D., Erickson M.R., Yen F.T., Bihain B.E., et al., Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice, Proc. Natl. Acad. Sci. U S A. 2001, 98(4), 2005-2010.10.1073/pnas.98.4.2005Search in Google Scholar PubMed PubMed Central

[11] Kim J.Y., van de Wall E., Laplante M., Azzara A., Trujillo M.E., Hofmann S.M., et al., Obesity-associated improvements in metabolic profile through expansion of adipose tissue, J. Clin. Invest., 2007, 117(9), 2621-2637.10.1172/JCI31021Search in Google Scholar PubMed PubMed Central

[12] Berg A.H., Combs T.P., Du X., Brownlee M., Scherer P.E., The adipocyte-secreted protein Acrp30 enhances hepatic insulin action, Nat. Med., 2001, 7(8), 947-953.10.1038/90992Search in Google Scholar PubMed

[13] Ma H., You G.P., Zhang X.P., Yang X.J., Lu H.D., Huang Y.L., et al., A novel role of globular adiponectin in treatment with HFD/STZ induced T2DM combined with NAFLD rats, ScientificWorldJournal, 2014, 2014, 230835.10.1155/2014/230835Search in Google Scholar PubMed PubMed Central

[14] Kadowaki T., Yamauchi T., Adiponectin and adiponectin receptors, Endocr. Rev., 2005, 26(3), 439-451.10.1210/er.2005-0005Search in Google Scholar PubMed

[15] Tsuchida A., Yamauchi T., Ito Y., Hada Y., Maki T., Takekawa S., et al., Insulin/Foxo1 pathway regulates expression levels of adiponectin receptors and adiponectin sensitivity., J. Biol. Chem., 2004, 279(29), 30817-30822.10.1074/jbc.M402367200Search in Google Scholar PubMed

[16] Debard C., Laville M., Berbe V., Loizon E., Guillet C., Morio-Liondore B., et al., Expression of key genes of fatty acid oxidation, including adiponectin receptors, in skeletal muscle of Type 2 diabetic patients., Diabetologia, 2004, 47(5), 917-925.10.1007/s00125-004-1394-7Search in Google Scholar PubMed

[17] Yamauchi T., Nio Y., Maki T., Kobayashi M., Takazawa T., Iwabu M., et al., Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions., Nat. Med., 2007, 13(3), 332-339.10.1038/nm1557Search in Google Scholar PubMed

[18] Lei L., Zhou C., Yang X., Li L., Down-regulation of microRNA-375 regulates adipokines and inhibits inflammatory cytokines by targeting AdipoR2 in non-alcoholic fatty liver disease., Clin. Exp. Pharmacol. Physiol., 2018, 45(8), 819-831.10.1111/1440-1681.12940Search in Google Scholar PubMed

[19] Chou I.P., Lin Y.Y., Ding S.T., Chen C.Y., Adiponectin receptor 1 enhances fatty acid metabolism and cell survival in palmitate-treated HepG2 cells through the PI3 K/AKT pathway., Eur. J. Nutr., 2014, 53(3), 907-917.10.1007/s00394-013-0594-7Search in Google Scholar PubMed

[20] Dongiovanni P., Valenti L., Peroxisome proliferator-activated receptor genetic polymorphisms and nonalcoholic Fatty liver disease: any role in disease susceptibility? PPAR Res., 2013, 2013, 452061.10.1155/2013/452061Search in Google Scholar PubMed PubMed Central

[21] Souza-Mello V., Peroxisome proliferator-activated receptors as targets to treat non-alcoholic fatty liver disease, World J. Hepatol., 2015, 7(8), 1012-1019.10.4254/wjh.v7.i8.1012Search in Google Scholar PubMed PubMed Central

[22] Yamauchi T., Kadowaki T., Adiponectin receptor as a key player in healthy longevity and obesity-related diseases. Cell Metab., 2013, 17(2), 185-196.10.1016/j.cmet.2013.01.001Search in Google Scholar PubMed

[23] Chen J., Liu J., Wang Y., Hu X., Zhou F., Hu Y., et al., Wogonin mitigates nonalcoholic fatty liver disease via enhancing PPARalpha/AdipoR2, in vivo and in vitro, Biomed. Pharmacother., 2017, 91, 621-631.10.1016/j.biopha.2017.04.125Search in Google Scholar PubMed

Received: 2018-12-30
Accepted: 2019-10-23
Published Online: 2019-12-31

© 2019 Yufeng Xing et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 Public License.

Articles in the same Issue

  1. Regular Articles
  2. Research on correlation of compositions with oestrogenic activity of Cistanche based on LC/Q-TOF-MS/MS technology
  3. Efficacy of Pyrus elaeagnifolia subsp. elaeagnifolia in acetic acid–induced colitis model
  4. Anti-inflammatory and antinociceptive features of Bryonia alba L.: As a possible alternative in treating rheumatism
  5. High efficiency liposome fusion induced by reducing undesired membrane peptides interaction
  6. Prediction of the Blood-Brain Barrier Permeability Using RP-18 Thin Layer Chromatography
  7. Phytic Acid Extracted from Rice Bran as a Growth Promoter for Euglena gracilis
  8. Development of a validated spectrofluorimetric method for assay of sotalol hydrochloride in tablets and human plasma: application for stability-indicating studies
  9. Topological Indices of Hyaluronic Acid-Paclitaxel Conjugates’ Molecular Structure in Cancer Treatment
  10. Thermodynamic properties of the bubble growth process in a pool boiling of water-ethanol mixture two-component system
  11. Critical Roles of the PI3K-Akt-mTOR Signaling Pathway in Apoptosis and Autophagy of Astrocytes Induced by Methamphetamine
  12. Characteristics of Stable Hydrogen and Oxygen Isotopes of Soil Moisture under Different Land Use in Dry Hot Valley of Yuanmou
  13. Specific, highly sensitive and simple spectrofluorimetric method for quantification of daclatasvir in HCV human plasma patients and in tablets dosage form
  14. Chromium-modified cobalt molybdenum nitrides as catalysts for ammonia synthesis
  15. Langerhans cell-like dendritic cells treated with ginsenoside Rh2 regulate the differentiation of Th1 and Th2 cells in vivo
  16. Identification of Powdery Mildew Blumeria graminis f. sp. tritici Resistance Genes in Selected Wheat Varieties and Development of Multiplex PCR
  17. Computational Analysis of new Degree-based descriptors of oxide networks
  18. The Use Of Chemical Composition And Additives To Classify Petrol And Diesel Using Gas Chromatography–Mass Spectrometry And Chemometric Analysis: A Uk Study
  19. Minimal Energy Tree with 4 Branched Vertices
  20. Jatropha seed oil derived poly(esteramide-urethane)/ fumed silica nanocomposite coatings for corrosion protection
  21. Calculating topological indices of certain OTIS interconnection networks
  22. Energy storage analysis of R125 in UIO-66 and MOF-5 nanoparticles: A molecular simulation study
  23. Velvet Antler compounds targeting major cell signaling pathways in osteosarcoma - a new insight into mediating the process of invasion and metastasis in OS
  24. Effects of Azadirachta Indica Leaf Extract, Capping Agents, on the Synthesis of Pure And Cu Doped ZnO-Nanoparticles: A Green Approach and Microbial Activity
  25. Aqueous Micro-hydration of Na+(H2O)n=1-7 Clusters: DFT Study
  26. A proposed image-based detection of methamidophos pesticide using peroxyoxalate chemiluminescence system
  27. Phytochemical screening and estrogenic activity of total glycosides of Cistanche deserticola
  28. Biological evaluation of a series of benzothiazole derivatives as mosquitocidal agents
  29. Chemical pretreatments of Trapa bispinosa's peel (TBP) biosorbent to enhance adsorption capacity for Pb(ll)
  30. Dynamic Changes in MMP1 and TIMP1 in the Antifibrotic Process of Dahuang Zhechong Pill in Rats with Liver Fibrosis
  31. The Optimization and Production of Ginkgolide B Lipid Microemulsion
  32. Photodynamic Therapy Enhanced the Antitumor Effects of Berberine on HeLa Cells
  33. Chiral and Achiral Enantiomeric Separation of (±)-Alprenolol
  34. Correlation of Water Fluoride with Body Fluids, Dental Fluorosis and FT4, FT3 –TSH Disruption among Children in an Endemic Fluorosis area in Pakistan
  35. A one-step incubation ELISA kit for rapid determination of dibutyl phthalate in water, beverage and liquor
  36. Free Radical Scavenging Activity of Essential Oil of Eugenia caryophylata from Amboina Island and Derivatives of Eugenol
  37. Effects of Blue and Red Light On Growth And Nitrate Metabolism In Pakchoi
  38. miRNA-199a-5p functions as a tumor suppressor in prolactinomas
  39. Solar photodegradation of carbamazepine from aqueous solutions using a compound parabolic concentrator equipped with a sun tracking system
  40. Influence of sub-inhibitory concentration of selected plant essential oils on the physical and biochemical properties of Pseudomonas orientalis
  41. Preparation and spectroscopic studies of Fe(II), Ru(II), Pd(II) and Zn(II) complexes of Schiff base containing terephthalaldehyde and their transfer hydrogenation and Suzuki-Miyaura coupling reaction
  42. Complex formation in a liquid-liquid extraction-chromogenic system for vanadium(IV)
  43. Synthesis, characterization (IR, 1H, 13C & 31P NMR), fungicidal, herbicidal and molecular docking evaluation of steroid phosphorus compounds
  44. Analysis and Biological Evaluation of Arisaema Amuremse Maxim Essential Oil
  45. A preliminary assessment of potential ecological risk and soil contamination by heavy metals around a cement factory, western Saudi Arabia
  46. Anti- inflammatory effect of Prunus tomentosa Thunb total flavones in LPS-induced RAW264.7 cells
  47. Collaborative Influence of Elevated CO2 Concentration and High Temperature on Potato Biomass Accumulation and Characteristics
  48. Methods of extraction, physicochemical properties of alginates and their applications in biomedical field – a review
  49. Characteristics of liposomes derived from egg yolk
  50. Preparation of ternary ZnO/Ag/cellulose and its enhanced photocatalytic degradation property on phenol and benzene in VOCs
  51. Influence of Human Serum Albumin Glycation on the Binding Affinities for Natural Flavonoids
  52. Synthesis and antioxidant activity of 2-methylthio-pyrido[3,2-e][1,2,4] triazolo[1,5-a]pyrimidines
  53. Comparative study on the antioxidant activities of ten common flower teas from China
  54. Molecular Properties of Symmetrical Networks Using Topological Polynomials
  55. Synthesis of Co3O4 Nano Aggregates by Co-precipitation Method and its Catalytic and Fuel Additive Applications
  56. Phytochemical analysis, Antioxidant and Antiprotoscolices potential of ethanol extracts of selected plants species against Echinococcus granulosus: In-vitro study
  57. Silver nanoparticles enhanced fluorescence for sensitive determination of fluoroquinolones in water solutions
  58. Simultaneous Quantification of the New Psychoactive Substances 3-FMC, 3-FPM, 4-CEC, and 4-BMC in Human Blood using GC-MS
  59. Biodiesel Production by Lipids From Indonesian strain of Microalgae Chlorella vulgaris
  60. Miscibility studies of polystyrene/polyvinyl chloride blend in presence of organoclay
  61. Antibacterial Activities of Transition Metal complexes of Mesocyclic Amidine 1,4-diazacycloheptane (DACH)
  62. Novel 1,8-Naphthyridine Derivatives: Design, Synthesis and in vitro screening of their cytotoxic activity against MCF7 cell line
  63. Investigation of Stress Corrosion Cracking Behaviour of Mg-Al-Zn Alloys in Different pH Environments by SSRT Method
  64. Various Combinations of Flame Retardants for Poly (vinyl chloride)
  65. Phenolic compounds and biological activities of rye (Secale cereale L.) grains
  66. Oxidative degradation of gentamicin present in water by an electro-Fenton process and biodegradability improvement
  67. Optimizing Suitable Conditions for the Removal of Ammonium Nitrogen by a Microbe Isolated from Chicken Manure
  68. Anti-inflammatory, antipyretic, analgesic, and antioxidant activities of Haloxylon salicornicum aqueous fraction
  69. The anti-corrosion behaviour of Satureja montana L. extract on iron in NaCl solution
  70. Interleukin-4, hemopexin, and lipoprotein-associated phospholipase A2 are significantly increased in patients with unstable carotid plaque
  71. A comparative study of the crystal structures of 2-(4-(2-(4-(3-chlorophenyl)pipera -zinyl)ethyl) benzyl)isoindoline-1,3-dione by synchrotron radiation X-ray powder diffraction and single-crystal X-ray diffraction
  72. Conceptual DFT as a Novel Chemoinformatics Tool for Studying the Chemical Reactivity Properties of the Amatoxin Family of Fungal Peptides
  73. Occurrence of Aflatoxin M1 in Milk-based Mithae samples from Pakistan
  74. Kinetics of Iron Removal From Ti-Extraction Blast Furnace Slag by Chlorination Calcination
  75. Increasing the activity of DNAzyme based on the telomeric sequence: 2’-OMe-RNA and LNA modifications
  76. Exploring the optoelectronic properties of a chromene-appended pyrimidone derivative for photovoltaic applications
  77. Effect of He Qi San on DNA Methylation in Type 2 Diabetes Mellitus Patients with Phlegm-blood Stasis Syndrome
  78. Cyclodextrin potentiometric sensors based on selective recognition sites for procainamide: Comparative and theoretical study
  79. Greener synthesis of dimethyl carbonate from carbon dioxide and methanol using a tunable ionic liquid catalyst
  80. Nonisothermal Cold Crystallization Kinetics of Poly(lactic acid)/Bacterial Poly(hydroxyoctanoate) (PHO)/Talc
  81. Enhanced adsorption of sulfonamide antibiotics in water by modified biochar derived from bagasse
  82. Study on the Mechanism of Shugan Xiaozhi Fang on Cells with Non-alcoholic Fatty Liver Disease
  83. Comparative Effects of Salt and Alkali Stress on Antioxidant System in Cotton (Gossypium Hirsutum L.) Leaves
  84. Optimization of chromatographic systems for analysis of selected psychotropic drugs and their metabolites in serum and saliva by HPLC in order to monitor therapeutic drugs
  85. Electrocatalytic Properties of Ni-Doped BaFe12O19 for Oxygen Evolution in Alkaline Solution
  86. Study on the removal of high contents of ammonium from piggery wastewater by clinoptilolite and the corresponding mechanisms
  87. Phytochemistry and toxicological assessment of Bryonia dioica roots used in north-African alternative medicine
  88. The essential oil composition of selected Hemerocallis cultivars and their biological activity
  89. Mechanical Properties of Carbon Fiber Reinforced Nanocrystalline Nickel Composite Electroforming Deposit
  90. Anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis
  91. Topical Issue on Applications of Mathematics in Chemistry
  92. Zagreb Connection Number Index of Nanotubes and Regular Hexagonal Lattice
  93. The Sanskruti index of trees and unicyclic graphs
  94. Valency-based molecular descriptors of Bakelite network BNmn
  95. Computing Topological Indices for Para-Line Graphs of Anthracene
  96. Zagreb Polynomials and redefined Zagreb indices of Dendrimers and Polyomino Chains
  97. Topological Descriptor of 2-Dimensional Silicon Carbons and Their Applications
  98. Topological invariants for the line graphs of some classes of graphs
  99. Words for maximal Subgroups of Fi24
  100. Generators of Maximal Subgroups of Harada-Norton and some Linear Groups
  101. Special Issue on POKOCHA 2018
  102. Influence of Production Parameters on the Content of Polyphenolic Compounds in Extruded Porridge Enriched with Chokeberry Fruit (Aronia melanocarpa (Michx.) Elliott)
  103. Effects of Supercritical Carbon Dioxide Extraction (SC-CO2) on the content of tiliroside in the extracts from Tilia L. flowers
  104. Impact of xanthan gum addition on phenolic acids composition and selected properties of new gluten-free maize-field bean pasta
  105. Impact of storage temperature and time on Moldavian dragonhead oil – spectroscopic and chemometric analysis
  106. The effect of selected substances on the stability of standard solutions in voltammetric analysis of ascorbic acid in fruit juices
  107. Determination of the content of Pb, Cd, Cu, Zn in dairy products from various regions of Poland
  108. Special Issue on IC3PE 2018 Conference
  109. The Photocatalytic Activity of Zns-TiO2 on a Carbon Fiber Prepared by Chemical Bath Deposition
  110. N-octyl chitosan derivatives as amphiphilic carrier agents for herbicide formulations
  111. Kinetics and Mechanistic Study of Hydrolysis of Adenosine Monophosphate Disodium Salt (AMPNa2) in Acidic and Alkaline Media
  112. Antimalarial Activity of Andrographis Paniculata Ness‘s N-hexane Extract and Its Major Compounds
  113. Special Issue on ABB2018 Conference
  114. Special Issue on ICCESEN 2017
  115. Theoretical Diagnostics of Second and Third-order Hyperpolarizabilities of Several Acid Derivatives
  116. Determination of Gamma Rays Efficiency Against Rhizoctonia solani in Potatoes
  117. Studies On Compatibilization Of Recycled Polyethylene/Thermoplastic Starch Blends By Using Different Compatibilizer
  118. Liquid−Liquid Extraction of Linalool from Methyl Eugenol with 1-Ethyl-3-methylimidazolium Hydrogen Sulfate [EMIM][HSO4] Ionic Liquid
  119. Synthesis of Graphene Oxide Through Ultrasonic Assisted Electrochemical Exfoliation
  120. Special Issue on ISCMP 2018
  121. Synthesis and antiproliferative evaluation of some 1,4-naphthoquinone derivatives against human cervical cancer cells
  122. The influence of the grafted aryl groups on the solvation properties of the graphyne and graphdiyne - a MD study
  123. Electrochemical modification of platinum and glassy carbon surfaces with pyridine layers and their use as complexing agents for copper (II) ions
  124. Effect of Electrospinning Process on Total Antioxidant Activity of Electrospun Nanofibers Containing Grape Seed Extract
  125. Effect Of Thermal Treatment Of Trepel At Temperature Range 800-1200˚C
  126. Topical Issue on Agriculture
  127. The effect of Cladophora glomerata exudates on the amino acid composition of Cladophora fracta and Rhizoclonium sp.
  128. Influence of the Static Magnetic Field and Algal Extract on the Germination of Soybean Seeds
  129. The use of UV-induced fluorescence for the assessment of homogeneity of granular mixtures
  130. The use of microorganisms as bio-fertilizers in the cultivation of white lupine
  131. Lyophilized apples on flax oil and ethyl esters of flax oil - stability and antioxidant evaluation
  132. Production of phosphorus biofertilizer based on the renewable materials in large laboratory scale
  133. Human health risk assessment of potential toxic elements in paddy soil and rice (Oryza sativa) from Ugbawka fields, Enugu, Nigeria
  134. Recovery of phosphates(V) from wastewaters of different chemical composition
  135. Special Issue on the 4th Green Chemistry 2018
  136. Dead zone for hydrogenation of propylene reaction carried out on commercial catalyst pellets
  137. Improved thermally stable oligoetherols from 6-aminouracil, ethylene carbonate and boric acid
  138. The role of a chemical loop in removal of hazardous contaminants from coke oven wastewater during its treatment
  139. Combating paraben pollution in surface waters with a variety of photocatalyzed systems: Looking for the most efficient technology
  140. Special Issue on Chemistry Today for Tomorrow 2019
  141. Applying Discriminant and Cluster Analyses to Separate Allergenic from Non-allergenic Proteins
  142. Chemometric Expertise Of Clinical Monitoring Data Of Prolactinoma Patients
  143. Chemomertic Risk Assessment of Soil Pollution
  144. New composite sorbent for speciation analysis of soluble chromium in textiles
  145. Photocatalytic activity of NiFe2O4 and Zn0.5Ni0.5Fe2O4 modified by Eu(III) and Tb(III) for decomposition of Malachite Green
  146. Photophysical and antibacterial activity of light-activated quaternary eosin Y
  147. Spectral properties and biological activity of La(III) and Nd(III) Monensinates
  148. Special Issue on Monitoring, Risk Assessment and Sustainable Management for the Exposure to Environmental Toxins
  149. Soil organic carbon mineralization in relation to microbial dynamics in subtropical red soils dominated by differently sized aggregates
  150. A potential reusable fluorescent aptasensor based on magnetic nanoparticles for ochratoxin A analysis
  151. Special Issue on 13th JCC 2018
  152. Fluorescence study of 5-nitroisatin Schiff base immobilized on SBA-15 for sensing Fe3+
  153. Thermal and Morphology Properties of Cellulose Nanofiber from TEMPO-oxidized Lower part of Empty Fruit Bunches (LEFB)
  154. Encapsulation of Vitamin C in Sesame Liposomes: Computational and Experimental Studies
  155. A comparative study of the utilization of synthetic foaming agent and aluminum powder as pore-forming agents in lightweight geopolymer synthesis
  156. Synthesis of high surface area mesoporous silica SBA-15 by adjusting hydrothermal treatment time and the amount of polyvinyl alcohol
  157. Review of large-pore mesostructured cellular foam (MCF) silica and its applications
  158. Ion Exchange of Benzoate in Ni-Al-Benzoate Layered Double Hydroxide by Amoxicillin
  159. Synthesis And Characterization Of CoMo/Mordenite Catalyst For Hydrotreatment Of Lignin Compound Models
  160. Production of Biodiesel from Nyamplung (Calophyllum inophyllum L.) using Microwave with CaO Catalyst from Eggshell Waste: Optimization of Transesterification Process Parameters
  161. The Study of the Optical Properties of C60 Fullerene in Different Organic Solvents
  162. Composite Material Consisting of HKUST-1 and Indonesian Activated Natural Zeolite and its Application in CO2 Capture
  163. Topical Issue on Environmental Chemistry
  164. Ionic liquids modified cobalt/ZSM-5 as a highly efficient catalyst for enhancing the selectivity towards KA oil in the aerobic oxidation of cyclohexane
  165. Application of Thermal Resistant Gemini Surfactants in Highly Thixotropic Water-in-oil Drilling Fluid System
  166. Screening Study on Rheological Behavior and Phase Transition Point of Polymer-containing Fluids produced under the Oil Freezing Point Temperature
  167. The Chemical Softening Effect and Mechanism of Low Rank Coal Soaked in Alkaline Solution
  168. The Influence Of NO/O2 On The NOx Storage Properties Over A Pt-Ba-Ce/γ-Al2O3 Catalyst
  169. Special Issue on the International conference CosCI 2018
  170. Design of SiO2/TiO2 that Synergistically Increases The Hydrophobicity of Methyltrimethoxysilane Coated Glass
  171. Antidiabetes and Antioxidant agents from Clausena excavata root as medicinal plant of Myanmar
  172. Development of a Gold Immunochromatographic Assay Method Using Candida Biofilm Antigen as a Bioreceptor for Candidiasis in Rats
  173. Special Issue on Applied Biochemistry and Biotechnology 2019
  174. Adsorption of copper ions on Magnolia officinalis residues after solid-phase fermentation with Phanerochaete chrysosporium
  175. Erratum
  176. Erratum to: Sand Dune Characterization For Preparing Metallurgical Grade Silicon
Downloaded on 5.10.2025 from https://www.degruyterbrill.com/document/doi/10.1515/chem-2019-0145/html
Scroll to top button