Startseite hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
Artikel Open Access

hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling

  • Yiting Wan , Jiami Huang , Yanhua Song , Cancan Gu , Jueying Kong , Ling Zuo und Jing Chen EMAIL logo
Veröffentlicht/Copyright: 17. März 2022
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 17 Heft 1

Abstract

Increasing evidence has verified the indispensable effect of microRNAs (miRNAs) in the biological processes of human diseases, including endometriosis. hsa-miR-340-5p was reported to display a low level in patients with endometriosis, but the detailed function of miR-340-5p in endometriosis is unclarified. RT-qPCR was used for the assessment of RNA levels of miR-340-5p and its downstream target genes in endometrial stromal cells (ESCs). Western blotting and Transwell assays revealed that upregulation of miR-340-5p suppressed the migration, invasiveness, and epithelial–mesenchymal transition (EMT) in ESCs. Bioinformatics tools were used to predict miR-340-5p downstream genes. Luciferase reporter assay displayed that miR-340-5p could bind to messenger RNA mitogen-activated protein kinase kinase kinase 2 (MAP3K2). MAP3K2 was targeted by miR-349-5p and could reverse the influence of miR-340-5p. miR-340-5p exerted its impact on the invasive characters of ESCs by inactivating the MAP3K2-mediated MAPK/ERK signaling. In conclusion, miR-340-5p restrains cell migration, invasiveness, and EMT in ESCs by targeting MAP3K2 and inactivating MAPK/ERK signaling.

Keywords: endometriosis; hsa-miR-340-5p; MAP3K2; epithelial–mesenchymal transition; MAPK/ERK

1 Introduction

Endometriosis is a chronic gynecological disorder characterized by the abnormal location of endometrial tissue outside the uterus [1,2]. Endometriosis affects nearly 10% of women of reproductive age, which may result in infertility, pelvic scarring and pain [3,4]. Pharmacotherapy and surgery, mainly laparoscopy, are the typically adopted therapies for endometriosis [5]. Although endometriosis is a benign disease, patients with endometriosis living with pain or the threat of relapse suffer from the great depression and anxiety [6]. Hence, it is significant to figure out the mechanism underlying the progression of endometriosis.

Epithelial–mesenchymal transition (EMT) is a complicated process in which epithelial cells transdifferentiate into mesenchymal cells with migratory and invasive properties [7,8]. EMT is featured with expression decrease in epithelial markers, such as E-cadherin, and expression enhancement in mesenchymal markers, such as N-cadherin [9]. Many studies have elucidated that EMT is involved in the pathogenesis and development of endometriosis [10,11,12]. Alterations in EMT marker proteins have been examined in endometrial stromal cells (ESCs), leading to increased migration and invasiveness and considered as a prerequisite for endometriotic lesion development [13]. Oestrogen treatment can increase N- cadherin expression and decrease E-cadherin expression in endometriosis [14]. MTA1 facilitates the development of endometriosis by inducing EMT via ZEB2 [15].

MicroRNAs (miRNAs) are a group of endogenous RNAs with 18–25 nucleotides [16,17]. Although miRNAs do not encode proteins, they play a significant role in regulating gene expression at the posttranscriptional level [18,19]. The dysregulation of miRNAs has been indicated to implicate in the biological processes of various human diseases, including endometriosis. For example, hsa-miR-199a-3p suppresses the cell motility, contractility and invasiveness in endometriosis [20]. miR-143-3p represses the cell proliferative and invasive abilities in endometriosis by inactivating autophagy [21]. Importantly, miR-340-5p was reported to display a low level in patients with endometriosis [22]. However, the detailed function of miR-340-5p in EMT of ESCs remains unanswered.

Mitogen-activated protein kinase kinase kinase 2 (MAP3K2) encodes the serine/threonine protein kinase family, which preferentially activates other kinases implicated in the mitogen-activated protein kinase (MAPK, originally called ERK) signaling pathway [23]. The MAPK/ERK signaling activation is recognized to play an essential role in the growth and development of endometriotic cells in ectopic sites [24]. In the processes of migration, implantation and invasiveness into the pelvic structures, the aberrant activation of MAPK/ERK signaling leads to the formation of endometriosis and aggravates the condition of patients with endometriosis [25].

This study intended to figure out the detailed function of miR-340-5p in the EMT process, migration and invasion of ESCs. The findings might provide a new perspective for treating endometriosis.

2 Materials and methods

2.1 Cell culture and transfection

Endometrial stromal cells (ESCs) were purchased from Honsun Biological Technology (Shanghai, China), which were isolated from patients with endometriosis (with no other pathology). ESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/Ham’s F12 (Corning Inc., Corning, NY, USA) containing 10% fetal bovine serum (FBS, Corning) and penicillin (100 U/mL, RMBIO, Missoula, MT, USA)/streptomycin (100 µg/mL, RMBIO) at 37°C with 5% CO2 in a humidified incubator. hsa-miR-340-5p mimics and negative control (NC mimics) were constructed by GenePharma (Shanghai, China) and transfected into ESCs to upregulate miR-340-5p. To overexpress MAP3K2, ESCs were transfected with pcDNA3.1/MAP3K2 or control pcDNA3.1 (GenePharma). Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was utilized for oligonucleotide or plasmid transfection. After 48 h, the transfection efficiency was evaluated by RT-qPCR.

2.2 Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated using TRIzol reagent (Invitrogen) from ESCs and was reverse transcribed into cDNA using a Bestar qPCR Reverse Transcription Kit (DBI® Bioscience, Shanghai, China). RT-qPCR was implemented using SYBR Green qPCR Master Mix (DBI® Bioscience) on an ABI7300 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The quantification of miRNA and mRNAs was achieved with the 2−ΔΔCt method, normalized to U6 and GAPDH, respectively. Primer sequences are provided in Table 1.

Table 1

Primer sequences used in RT-qPCR

Gene Sequence (5′ → 3′)
hsa-miR-340-5p forward CACTCCAGCTGGGTTATAAAGCAATGAGA
hsa-miR-340-5p reverse TGGTGTCGTGGAGTCG
CYLD forward CTCTTTACCATTCAGTCTCACC
CYLD reverse CTCATCTTCCAGTTCCAGTCC
DMD forward ACAGCTGGCATGGAAGATGAA
DMD reverse ACGAGTTGATTGTCGGACCC
RPS6KA5 forward TTGTGCTTGCCCTCGAACAT
RPS6KA5 reverse CTGTAGGCAGACAAAACTTGCT
NFAT5 forward TACCTCAGTCACCGACAGCAAG
NFAT5 reverse CGACTGTTATCCAGCAAGTC
JPH1 forward AATTAGGAAAGCCCCATCCG
JPH1 reverse AAGGCAGCTGTTGACTTCCA
IPMK forward GCACATGTACGGGAAGGACA
IPMK reverse GGACAAGCTTTTGCCCACTG
SYDE2 forward ACAGCCAATTCCCATGTCCA
SYDE2 reverse TGTTGCAGTGTACCAGGACC
ESYT2 forward CCGGGATCAGCGCGAG
ESYT2 reverse GTGCTAAGGTGGGTGTTTGC
MAP3K2 forward GCTTACGGTCTCCTGTGAGTT
MAP3K2 reverse AGGATTGTCTATGTCACTTCCCC
GAPDH forward GAGTCAACGGATTTGGTCGT
GAPDH reverse TTGATTTTGGAGGGATCTCG
U6 forward CTCGCTTCGGCAGCACA
U6 reverse AACGCTTCACGAATTTGCGT

2.3 Western blotting

Total proteins were isolated from ESCs by RIPA buffer (Beyotime, Shanghai, China) and quantified with a BCA assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Proteins (20 µg) were separated by 10% SDS-PAGE gels and transferred to polyvinylidene difluoride (PVDF) membranes (Roche, Mannheim, Germany). The membranes were blocked with 5% defatted milk and incubated with the primary antibodies as follows: anti-E-cadherin (ab40772, 1:10,000), anti-N-cadherin (ab76011, 1:5,000), anti-GAPDH (ab9485, 1:2,500), anti-MAP3K2 (ab33918, 1:10,000), anti-p-Erk1/2 (ab223500, 1:400), anti-Erk1/2 (ab184699, 1:10,000), anti-p-JNK (ab124956, 1:5,000), anti-JNK (ab199380, 1:2,500), anti-p-p38 (ab178867, 1:1,000), and anti-p38 (ab170099, 1:5,000) (all from Abcam, Cambridge, MA, USA) at 4°C overnight, followed by incubation with the horseradish peroxidase-conjugated secondary antibody of goat anti-rabbit IgG H&L (Abcam, ab175781, 1:10,000) at room temperature for 2 h. The proteins were visualized using an ECL kit (Cwbiotech, Beijing, China) and quantified with the Amersham Imager 600 (GE Healthcare Life Sciences, Little Chalfont, UK).

2.4 Transwell assay

A Transwell chamber (Corning) was used for assessing ESC migration and invasion. After 48 h of incubation, ESCs were washed and incubated with serum-free DMEM for 12 h. Afterward, the suspension (100 µL, 5 × 104 cells) was added into the upper chambers and DMEM (500 µL) containing 10% FBS was placed into the lower chambers. After treatment for 24 h, a cotton swab was utilized to gently remove the nonmigratory cells. The migratory cells were fixed in 4% formaldehyde, stained with 0.1% crystal violet solution and counted under an Eclipse Ti-s microscope (Olympus, Tokyo, Japan). Invasion assay was conducted similar to the above migration assay, except that Matrigel (Corning) was precoated for the chambers.

2.5 Luciferase reporter assay

The putative binding site between miR-340-5p and MAP3K2 was predicted by TargetScan (http://www.targetscan.org/vert_71/). Wild type (Wt) or mutant (Mut) 3′untranslated region (3′UTR) of MAP3K2 was inserted into pmirGLO vectors (Promega, Madison, WI, USA). These vectors were co-transfected with miR-340-5p mimics or NC mimics into ESCs using Lipofectamine 2000 (Invitrogen). Measurement of the luciferase activity was performed with a dual luciferase® reporter assay system (Promega).

2.6 Statistical analysis

SPSS 20.0 software (IBM Corp, Armonk, NY, USA) was used for data analysis. Specific data are provided in supplementary Table 2. All numerical results are expressed as the mean ± standard deviation. Comparisons between two groups were evaluated by Student’s t-test, and those among more groups were assessed by analysis of variance (ANOVA) followed by Tukey’s post hoc test. Each experiment was performed at least three times. p < 0.05 was considered statistically significant.

Table 2

Data from SPSS analysis

Value 1 Value 2 Value 3 Average SD p value
Figure 1a
 NC mimics 0.91 0.96 1.12 1 0.11 1.28 × 10−04
 miR-340-5p mimics 3.87 4.26 4.61 4.25 0.37
Figure 1c
Migration
 NC mimics 162.00 178.00 191.00 177 14.45 3.47 × 10−04
 miR-340-5p mimics 59.00 70.00 75.00 68 7.98
Invasion
 NC mimics 128.00 140.00 158.00 142 15.39 2.73 × 10−04
 miR-340-5p mimics 31.00 36.00 37.00 35 3.22
Figure 1d
E-cadherin
 NC mimics 0.89 0.97 1.14 1 0.13 0.006
 miR-340-5p mimics 1.59 1.75 2.03 1.79 0.22
N-cadherin
 NC mimics 0.90 0.98 1.12 1 0.11 3.24 × 10−04
 miR-340-5p mimics 0.23 0.24 0.27 0.25 0.021
Figure 2b
CYLD
 NC mimics 0.92 0.96 1.11 1 0.1 0.733
 miR-340-5p mimics 0.92 1.04 1.12 1.03 0.1
DMD
 NC mimics 0.90 0.98 1.12 1 0.11 0.819
 miR-340-5p mimics 0.92 0.94 1.08 0.98 0.09
RPS6KA5
 NC mimics 0.88 0.98 1.14 1 0.13 0.691
 miR-340-5p mimics 0.87 0.95 1.06 0.96 0.098
NFAT5
 NC mimics 0.91 1.01 1.09 1 0.09 0.946
 miR-340-5p mimics 0.91 0.96 1.16 1.01 0.13
JPH1
 NC mimics 0.95 1.00 1.05 1 0.05 1
 miR-340-5p mimics 0.91 0.97 1.12 1 0.11
IPMK
 NC mimics 0.93 0.96 1.11 1 0.1 0.903
 miR-340-5p mimics 0.91 0.97 1.09 0.99 0.09
SYDE2
 NC mimics 0.92 0.99 1.08 1 0.08 0.606
 miR-340-5p mimics 0.92 1.05 1.16 1.04 0.12
ESYT2
 NC mimics 0.94 0.99 1.08 1 0.07 0.824
 miR-340-5p mimics 0.94 0.99 1.13 1.02 0.1
MAP3K2
 NC mimics 0.89 0.97 1.14 1 0.13 0.002
 miR-340-5p mimics 0.41 0.43 0.49 0.44 0.04
Figure 2d
 NC mimics 0.92 1.00 1.08 1 0.08 0.001
 miR-340-5p mimics 0.48 0.54 0.58 0.53 0.05
Figure 2f
Wt
 NC mimics 0.92 0.98 1.10 1 0.09 3.70 × 10−04
 miR-340-5p mimics 0.35 0.38 0.41 0.38 0.032
Mut
 NC mimics 0.92 0.96 1.12 1 0.11 0.713
 miR-340-5p mimics 0.86 0.98 1.06 0.97 0.1
Figure 3b
 Empty 0.93 0.96 1.11 1 0.1 0.001
 MAP3K2 2.52 2.94 3.12 2.86 0.31
Figure 3d
Migration
 NC mimics 154.00 158.00 183.00 165 15.47
 miR-340-5p mimics 53.00 62.00 65.00 60 5.93 5.79 × 10−05
 miR-340-5p mimics + MAP3K2 105.00 89.00 91.00 95 8.8 0.019
Invasion
 NC mimics 114.00 118.00 133.00 122 10.02
 miR-340-5p mimics 31.00 34.00 37.00 34 3.44 1.50 × 10−05
 miR-340-5p mimics + MAP3K2 71.00 82.00 84.00 79 7.45 0.001
Figure 3e
E-cadherin
 NC mimics 0.88 0.98 1.14 1 0.13
 miR-340-5p mimics 2.93 3.11 3.64 3.23 0.37 9.55 × 10−05
 miR-340-5p mimics + MAP3K2 1.69 1.86 2.09 1.88 0.2 0.002
N-cadherin
 NC mimics 0.91 0.99 1.11 1 0.1
 miR-340-5p mimics 0.17 0.20 0.20 0.19 0.02 1.38 × 10−05
 miR-340-5p mimics + MAP3K2 0.43 0.45 0.53 0.47 0.053 0.005
Figure 4b
p-Erk1/2/Erk1/2
 NC mimics 0.93 0.98 1.09 1 0.08
 miR-340-5p mimics 0.29 0.31 0.35 0.32 0.031 3.04 × 10−05
 miR-340-5p mimics + MAP3K2 0.52 0.55 0.65 0.57 0.07 0.006
p-JNK/JNK
 NC mimics 0.92 0.95 1.13 1 0.11
 miR-340-5p mimics 0.42 0.49 0.49 0.47 0.04 0.001
 miR-340-5p mimics + MAP3K2 0.87 0.92 1.03 0.94 0.084 0.001
p-p38/p38
 NC mimics 0.89 0.98 1.13 1 0.12
 miR-340-5p mimics 0.37 0.39 0.44 0.4 0.037 1.89 × 10−04
 miR-340-5p mimics + MAP3K2 0.60 0.61 0.68 0.63 0.045 0.025

  1. Ethical approval: Our study did not require an ethical board approval because it did not contain human or animal trials.

3 Results

3.1 miR-340-5p inhibits cell migration, invasiveness and EMT in ESCs

To determine the role of miR-340-5p in endometriosis, we first overexpressed miR-340-5p. As shown by RT-qPCR, the miR-340-5p level was significantly enhanced after transfection with miR-340-5p mimics (Figure 1a). Afterward, we performed Transwell assays, which displayed that overexpressing miR-340-5p restrained the migratory ability of ESCs as well as the invasive ability (Figure 1b and c). Moreover, western blotting suggested that miR-340-5p upregulation increased the protein level of E-cadherin but reduced that of N-cadherin (Figure 1d). This suggested that miR-340-5p restrains EMT process in ESCs.

Figure 1 miR-340-5p restrains cell migration, invasiveness and EMT in endometriosis. (a) RT-qPCR for the transfection efficiency of miR-340-5p mimics in ESCs. (b and c) Transwell assays for evaluating ESC migratory and invasive abilities after overexpressing miR-340-5p. (d) Western blotting for assessing protein levels of EMT-associated markers (E-cadherin and N-cadherin). **p < 0.01, ***p < 0.001.
Figure 1

miR-340-5p restrains cell migration, invasiveness and EMT in endometriosis. (a) RT-qPCR for the transfection efficiency of miR-340-5p mimics in ESCs. (b and c) Transwell assays for evaluating ESC migratory and invasive abilities after overexpressing miR-340-5p. (d) Western blotting for assessing protein levels of EMT-associated markers (E-cadherin and N-cadherin). **p < 0.01, ***p < 0.001.

3.2 miR-340-5p directly targets MAP3K2

To clarify how miR-340-5p exerts its impact on endometriosis progression, we used miRDB (http://mirdb.org/mirdb/index.html) for identifying the downstream targets of miR-340-5p and selected the top nine mRNAs with 100 binding scores (Figure 2a). Subsequently, we implemented RT-qPCR to detect the levels of these mRNAs in ESCs and the results indicated that only MAP3K2 level was markedly decreased by miR-340-5p mimics (Figure 2b). Additionally, the MAP3K2 protein level was reduced by miR-340-5p mimics, as revealed by western blotting (Figure 2c and d). Bioinformatics analysis with TargetScan elucidated the complementary site of miR-340-5p on MAP3K2 3′UTR (Figure 2e). To substantiate the relationship between MAP3K2 and miR-340-5p, the luciferase reporter assay was conducted. miR-340-5p mimics weakened the luciferase activity in the MAP3K2-Wt group, whereas it almost had no impact on the MAP3K2-Mut group (Figure 2f). Collectively, MAP3K2 is targeted by miR-340-5p in ESCs.

Figure 2 miR-340-5p targets MAP3K2. (a) MiRDB was used for screening the downstream targets of miR-340-5p. (b) RT-qPCR of the potential mRNA levels in ESCs transfected with miR-340-5p or NC mimics. (c and d) Western blotting of MAP3K2 protein expression in ESCs with above transfection. (e) Bioinformatics analysis of the potential complementary site of miR-340-5p on MAP3K2. (f) The luciferase reporter assay revealed luciferase activity of Wt/Mut pmirGLO-MAP3K2-3′UTR in ESCs after upregulating miR-340-5p. **p < 0.01, ***p < 0.001.
Figure 2

miR-340-5p targets MAP3K2. (a) MiRDB was used for screening the downstream targets of miR-340-5p. (b) RT-qPCR of the potential mRNA levels in ESCs transfected with miR-340-5p or NC mimics. (c and d) Western blotting of MAP3K2 protein expression in ESCs with above transfection. (e) Bioinformatics analysis of the potential complementary site of miR-340-5p on MAP3K2. (f) The luciferase reporter assay revealed luciferase activity of Wt/Mut pmirGLO-MAP3K2-3′UTR in ESCs after upregulating miR-340-5p. **p < 0.01, ***p < 0.001.

3.3 Upregulation of MAP3K2 abolishes miR-340-5p upregulation-mediated suppressive impact on the invasive behaviors of ESCs

Subsequently, we explored the detailed effects of MAP3K2 on miR-340-5p in ESCs. As displayed by western blotting, MAP3K2 protein expression was significantly increased after transfection of pcDNA3.1/MAP3K2 in ESCs (Figure 3a and b). Furthermore, Transwell assays demonstrated that overexpressing MAP3K2 abolished the suppressive influence on cell migration and invasiveness caused by miR-340-5p mimics (Figure 3c and d). The levels of EMT-associated markers were examined by western blotting, which suggested that E-cadherin expression enhanced by miR-340-5p mimics was downregulated after upregulating MAP3K2 (Figure 3e). Similarly, MAP3K2 upregulation reversed the level of N-cadherin that was reduced by miR-340-5p upregulation (Figure 3e). In summary, MAP3K2 restoration rescues the miR-340-5p overexpression-induced suppressive impact on the invasive characters of ESCs.

Figure 3 MAP3K2 overexpression abolishes miR-340-5p overexpression-mediated suppressive impact on the invasive behaviors of ESCs. (a and b) Western blotting of MAP3K2 protein level in ESCs after overexpressing MAP3K2. (c and d) Measurement of the migration and invasion by Transwell assays in ESCs transfected with NC mimics, miR-340-5p mimics or miR-340-5p mimics + pcDNA3.1/MAP3K2. (e) Western blotting of E-cadherin and N-cadherin protein levels in ESCs with the above transfection. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure 3

MAP3K2 overexpression abolishes miR-340-5p overexpression-mediated suppressive impact on the invasive behaviors of ESCs. (a and b) Western blotting of MAP3K2 protein level in ESCs after overexpressing MAP3K2. (c and d) Measurement of the migration and invasion by Transwell assays in ESCs transfected with NC mimics, miR-340-5p mimics or miR-340-5p mimics + pcDNA3.1/MAP3K2. (e) Western blotting of E-cadherin and N-cadherin protein levels in ESCs with the above transfection. *p < 0.05, **p < 0.01, ***p < 0.001.

3.4 miR-340-5p regulates the MAPK/ERK signaling pathway by targeting MAP3K2

MAP3K2 is able to activate other kinases involved in the MAPK/ERK signaling pathway [23]. Here, we detected MAPK/ERK signaling pathway-associated proteins in ESCs. As displayed by western blotting, overexpressing miR-340-5p reduced the ratios of p-Erk to total Erk, p-JNK to total JNK and p-p38 to p38, and this effect was then partially reversed by upregulating MAP3K2 (Figure 4a and b). Hence, miR-340-5p influences the progression of endometriosis by regulating MAP3K2-mediated MAPK/ERK signaling.

Figure 4 MiR-340-5p represses endometriosis progression by regulating MAP3K2-mediated MAPK/ERK pathway. (a and b) Western blotting of MAPK/ERK signaling pathway-related protein levels in ESCs. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure 4

MiR-340-5p represses endometriosis progression by regulating MAP3K2-mediated MAPK/ERK pathway. (a and b) Western blotting of MAPK/ERK signaling pathway-related protein levels in ESCs. *p < 0.05, **p < 0.01, ***p < 0.001.

4 Discussion

Emerging evidence has indicated that endometriosis is a precancerous lesion, which exhibits cancer-like characterizations such as cell invasiveness and uncontrolled cell proliferation [26]. Patients with endometriosis, particularly ovarian endometriosis, have an increased risk of developing ovarian cancer [27]. Many factors are considered to be implicated in the pathogenesis of endometriosis, including environmental and genetic factors, immune response and hormonal effects [28,29]. Infiltration of immune cells and excessive secretion of proinflammatory cytokines are observed in the peritoneal cavity of women affected by endometriosis [30,31]. Moreover, previous studies have demonstrated that upregulation of genes related to cell adhesion and extracellular matrix precedes the formation of endometriotic lesions [32]. All the above factors are shown to contribute to the invasive behaviors of endometriotic cells including proliferation, invasion, adhesion and survival, which consequently leads to endometriosis [33].

MiRNAs have been increasingly indicated to be a crucial regulator in the development of diverse human diseases [34,35,36,37]. Numerous studies have confirmed that miR-340-5p exerts an indispensable impact on multiple diseases. For example, miR-340-5p upregulation improves spinal cord injury-induced apoptosis and neuroinflammation via regulating the p38/MAPK pathway [38]. miR-340-5p targets PDCD4 to protect from a brain injury after intracerebral hemorrhage [39]. Furthermore, a previous study has elucidated the decreased expression of miR-340-5p in patients with endometriosis [40]. EMT is considered as a key factor in a variety of pathological processes, including tumor metastasis and invasiveness [41]. Numerous studies have verified that EMT is a prerequisite for endometriosis since ectopic lesions in endometriosis display similar biological properties as cancer metastasis [13]. In the process of EMT, cells gain increased migratory and invasive properties, consequently contributing to the development of endometriotic cells in ectopic sites [42]. In the present study, we examined the specific function of miR-340-5p in ESCs. As revealed by the results, overexpressed-miR-340-5p had a suppressive impact on the migration, invasiveness and EMT of ESCs. This indicates that miR-340-5p might protect against the formation of endometriosis, which is in accord with the previous study.

MiRNAs are well-known to exert their regulatory impacts on gene expression by targeting mRNA 3′UTRs, subsequently causing either translational repression or mRNA degradation [43]. With the assistance of bioinformatics tools, MAP3K2 was identified as the target of miR-340-5p. MAP3K2 is implicated in diverse cellular processes, including cell differentiation, migration and proliferation [44]. Notably, in this study, overexpressing MAP3K2 attenuated the suppressive impact on the invasive characters of ESCs caused by miR-340-5p upregulation. Furthermore, MAP3K2 has been verified to participate in various pathways, including the MAPK/ERK signaling pathway [45]. MAP3K2 is able to activate several downstream kinases of the MAPK signaling pathway, including Erk1/2, JNK and p38 [46]. In this study, we analyzed the levels of these kinases in ESCs with indicated treatment. As anticipated, the phosphorylation of Erk, JNK and p38 was markedly reduced by miR-340-5p mimics and this effect was then rescued by overexpressing MAP3K2, revealing that miR-340-5p inactivates MAPK/ERK signaling by targeting MAP3K2 in ESCs.

5 Conclusion

In conclusion, we investigated the function and mechanism of miR-340-5p in ESCs. As indicated by the results, miR-340-5p inhibits the migration, invasiveness and EMT in ESCs, which can be reversed by its downstream target MAP3K2. miR-340-5p inactivates the MAP3K2-mediated MAPK/ERK signaling in ESCs. Our findings might provide a new perspective for the treatment of patients with endometriosis. However, there are still limitations in this study. To better understand the role of miR-340-5p in endometriosis, in vivo experiments are demanded in future studies. Additionally, further investigations are needed to have a better understanding of the pathogenesis of endometriosis.

Acknowledgements

Not applicable.

  1. Funding information: This work were supported by the Shanghai Committee of Science and Technology, China (20Y21901400), the Shanghai Committee of Science and Technology, China (20Z21900400), the Shanghai innovation pilot construction project of TCM diagnosis and treatment model (No. ZY(2018-2020)-FWTX-6006), the Project of Shanghai Health Bureau (No. 201840163), the Shinkang phase II three year action plan major clinical research program (No. SHDC2020CR4056), the Youth Project of Traditional Chinese Medicine Research Project of Shanghai Health (2020LQ001) and the Traditional Chinese Medicine Research Project of Shanghai Health (2020LP001).

  2. Author contributions: Yiting Wan and Jing Chen were the main designers of this study. All authors performed the experiments and analyzed the data. Jing Chen drafted the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors have no conflicts of interest to declare.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request

References

[1] Ding Y, Zhu Q, He Y, Lu Y, Wang Y, Qi J, et al. Induction of autophagy by Beclin-1 in granulosa cells contributes to follicular progesterone elevation in ovarian endometriosis. Transl Res: J Lab Clin Med. 2021;227:15–29.10.1016/j.trsl.2020.06.013Suche in Google Scholar PubMed

[2] Wang Y, Nicholes K, Shih IJ. The origin and pathogenesis of endometriosis. Annu Rev Pathol. 2020;15:71–95.10.1146/annurev-pathmechdis-012419-032654Suche in Google Scholar PubMed PubMed Central

[3] Méar L, Herr M, Fauconnier A, Pineau C, Vialard FJ. Polymorphisms and endometriosis: a systematic review and meta-analyses. Hum Reprod Update. 2020;26(1):73–102.10.1093/humupd/dmz034Suche in Google Scholar PubMed

[4] Vallvé-Juanico J, Houshdaran S, Giudice LJ. The endometrial immune environment of women with endometriosis. Hum Reprod Update. 2019;25(5):564–91.10.1093/humupd/dmz018Suche in Google Scholar PubMed PubMed Central

[5] Greenbaum H, Galper B, Decter D, Eisenberg VJ. Endometriosis and autoimmunity: can autoantibodies be used as a non-invasive early diagnostic tool? Autoimmunity Rev. 2021;20(5):102795.10.1016/j.autrev.2021.102795Suche in Google Scholar PubMed

[6] Bulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, et al. Endometriosis. Endocr Rev. 2019;40(4):1048–79.10.1016/B978-0-323-47912-7.00025-1Suche in Google Scholar

[7] Bischoff J. Endothelial-to-mesenchymal transition. Circulation Res. 2019;124(8):1163–5.10.1161/CIRCRESAHA.119.314813Suche in Google Scholar PubMed PubMed Central

[8] Chen T, You Y, Jiang H, Wang ZZ. Epithelial-mesenchymal transition (EMT): A biological process in the development, stem cell differentiation, and tumorigenesis. J Cell Physiol. 2017;232(12):3261–72.10.1002/jcp.25797Suche in Google Scholar PubMed PubMed Central

[9] Serrano-Gomez SJ, Maziveyi M, Alahari SK. Regulation of epithelial-mesenchymal transition through epigenetic and post-translational modifications. Mol Cancer. 2016;15:18.10.1186/s12943-016-0502-xSuche in Google Scholar PubMed PubMed Central

[10] Liu Y, Wang X, Wan L, Liu X, Yu H, Zhang D, et al. TIPE2 inhibits the migration and invasion of endometrial cells by targeting β-catenin to reverse epithelial-mesenchymal transition. Hum Reprod (Oxford, Engl). 2020;35(6):1377–90.10.1093/humrep/deaa062Suche in Google Scholar PubMed

[11] Wang D, Luo Y, Wang G, Yang Q. CircATRNL1 promotes epithelial-mesenchymal transition in endometriosis by upregulating Yes-associated protein 1 in vitro. Cell Death Dis. 2020;11(7):594.10.1038/s41419-020-02784-4Suche in Google Scholar PubMed PubMed Central

[12] Xiong Y, Liu Y, Xiong W, Zhang L, Liu H, Du Y, et al. Hypoxia-inducible factor 1α-induced epithelial-mesenchymal transition of endometrial epithelial cells may contribute to the development of endometriosis. Hum Reprod (Oxford, Engl). 2016;31(6):1327–38.10.1093/humrep/dew081Suche in Google Scholar PubMed

[13] Dong L, Zhang L, Liu H, Xie M, Gao J, Zhou X, et al. Circ_0007331 knock-down suppresses the progression of endometriosis via miR-200c-3p/HiF-1α axis. J Cell Mol Med. 2020;24(21):12656–66.10.1111/jcmm.15833Suche in Google Scholar PubMed PubMed Central

[14] He X, Liu N, Mu T, Lu D, Jia C, Wang S, et al. Oestrogen induces epithelial-mesenchymal transition in endometriosis via circ_0004712/miR-148a-3p sponge function. J Cell Mol Med. 2020;24(17):9658–66.10.1111/jcmm.15495Suche in Google Scholar PubMed PubMed Central

[15] Kong X, Xu X, Zhou L, Zhu M, Yao S, Ding Y, et al. MTA1, a target of resveratrol, promotes epithelial-mesenchymal transition of endometriosis via ZEB2. Mol Ther Methods Clin Dev. 2020;19:295–306.10.1016/j.omtm.2020.09.013Suche in Google Scholar PubMed PubMed Central

[16] Correia de Sousa M, Gjorgjieva M, Dolicka D, Sobolewski C, Foti M. Deciphering miRNAs’ action through miRNA editing. Int J Mol Sci. 2019;20(24):6249.10.3390/ijms20246249Suche in Google Scholar PubMed PubMed Central

[17] Tiwari A, Mukherjee B, Dixit M. MicroRNA key to angiogenesis regulation: MiRNA biology and therapy. Curr Cancer Drug Targets. 2018;18(3):266–77.10.2174/1568009617666170630142725Suche in Google Scholar PubMed

[18] Yang Q, Yang F, Dai W, Meng X, Wei W, Cheng Y, et al. DNA logic circuits for multiple tumor cells identification using intracellular MicroRNA molecular bispecific recognition. Adv Healthc Mater. 2021;10:e2101130.10.1002/adhm.202101130Suche in Google Scholar PubMed

[19] Li W, Guan X, Sun B, Sun LJ. A novel microRNA of japanese flounder regulates antimicrobial immunity involving a bacteria-binding CSF3. Front Immunol. 2021;12:723401.10.3389/fimmu.2021.723401Suche in Google Scholar PubMed PubMed Central

[20] Zhu R, Nasu K, Hijiya N, Yoshihashi M, Hirakawa T, Aoyagi Y, et al. hsa-miR-199a-3p inhibits motility, invasiveness, and contractility of ovarian endometriotic stromal cells. Reprod Sci (Thousand Oaks, Calif). 2021;28:3498–507.10.1007/s43032-021-00604-4Suche in Google Scholar PubMed

[21] Yang H, Hu T, Hu P, Qi C, Qian L. miR-143-3p inhibits endometriotic stromal cell proliferation and invasion by inactivating autophagy in endometriosis. Mol Med Rep. 2021;23(5):356.10.3892/mmr.2021.11995Suche in Google Scholar PubMed PubMed Central

[22] Papari E, Noruzinia M, Kashani L, Foster WG. Identification of candidate microRNA markers of endometriosis with the use of next-generation sequencing and quantitative real-time polymerase chain reaction. Fertil Steril. 2020;113(6):1232–41.10.1016/j.fertnstert.2020.01.026Suche in Google Scholar PubMed

[23] Wu N, Sun H, Zhao X, Zhang Y, Tan J, Qi Y, et al. MAP3K2-regulated intestinal stromal cells define a distinct stem cell niche. Nature. 2021;592(7855):606–10.10.1038/s41586-021-03283-ySuche in Google Scholar PubMed

[24] Hung S, Zhang R, Tan Z, Chung J, Zhang T, Wang C. Pharmaceuticals targeting signaling pathways of endometriosis as potential new medical treatment: a review. Med Res Rev. 2021;41(4):2489–564.10.1002/med.21802Suche in Google Scholar PubMed PubMed Central

[25] Bora G, Yaba A. The role of mitogen-activated protein kinase signaling pathway in endometriosis. The journal of obstetrics and gynaecology research. J Obstet Gynaecol Res. 2021;47(5):1610–23.10.1111/jog.14710Suche in Google Scholar PubMed

[26] Filipchiuk C, Laganà AS, Beteli R, Ponce TG, Christofolini DM, Martins Trevisan C, et al. BIRC5/survivin expression as a non-invasive biomarker of endometriosis. Diagnostics (Basel, Switz). 2020;10(8):533.10.3390/diagnostics10080533Suche in Google Scholar PubMed PubMed Central

[27] Králíčková M, Laganà AS, Ghezzi F, Vetvicka V. Endometriosis and risk of ovarian cancer: what do we know? Arch Gynecol Obstet. 2020;301(1):1–10.10.1007/s00404-019-05358-8Suche in Google Scholar PubMed

[28] Engels S, Nisolle M, Karampelas S. Pseudotumoral endometriotic nodule. J Minim Invasive Gynecol. 2021;28(12):1973–4.10.1016/j.jmig.2021.06.025Suche in Google Scholar PubMed

[29] Laganà AS, Salmeri FM, Vitale SG, Triolo O, Götte M. Stem cell trafficking during endometriosis: may epigenetics play a pivotal role? Reprod Sci (Thousand Oaks, Calif). 2018;25(7):978–9.10.1177/1933719116687661Suche in Google Scholar PubMed

[30] Laganà AS, Salmeri FM, Ban Frangež H, Ghezzi F, Vrtačnik-Bokal E, Granese R. Evaluation of M1 and M2 macrophages in ovarian endometriomas from women affected by endometriosis at different stages of the disease. Gynecol Endocrinol: Off J Int Soc Gynecol Endocrinol. 2020;36(5):441–4.10.1080/09513590.2019.1683821Suche in Google Scholar PubMed

[31] Laganà AS, Triolo O, Salmeri FM, Granese R, Palmara VI, Ban Frangež H, et al. Natural Killer T cell subsets in eutopic and ectopic endometrium: a fresh look to a busy corner. Arch Gynecol Obstet. 2016;293(5):941–9.10.1007/s00404-015-4004-7Suche in Google Scholar PubMed

[32] Umezawa M, Saito Y, Tanaka-Hattori N, Takeda K, Ihara T, Sugamata M. Expression profile of extracellular matrix and adhesion molecules in the development of endometriosis in a mouse model. Reprod Sci (Thousand Oaks, Calif). 2012;19(12):1365–72.10.1177/1933719112450340Suche in Google Scholar PubMed

[33] Luddi A, Marrocco C, Governini L, Semplici B, Pavone V, Luisi S, et al. Expression of matrix metalloproteinases and their inhibitors in endometrium: high levels in endometriotic lesions. Int J Mol Sci. 2020;21(8):2840.10.3390/ijms21082840Suche in Google Scholar PubMed PubMed Central

[34] Ferrante M, Conti GO. Environment and neurodegenerative diseases: an update on miRNA role. MicroRNA (Shariqah, U Arab Emirates). 2017;6(3):157–65.10.2174/2211536606666170811151503Suche in Google Scholar PubMed

[35] Rupaimoole R, Slack FJ. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discovery. 2017;16(3):203–22.10.1038/nrd.2016.246Suche in Google Scholar PubMed

[36] Vanhie A, Peterse O D, Peterse D, Beckers AA, Cuéllar A, Fassbender A, et al. Plasma miRNAs as biomarkers for endometriosis. Hum Reprod (Oxford, Engl). 2019;34(9):1650–60.10.1093/humrep/dez116Suche in Google Scholar PubMed PubMed Central

[37] Vishnoi A, Rani S. MiRNA biogenesis and regulation of diseases: an overview. Methods Mol Biol (Clifton, NJ). 2017;1509:1–10.10.1007/978-1-4939-6524-3_1Suche in Google Scholar PubMed

[38] Qian Z, Chang J, Jiang F, Ge D, Yang L, Li Y, et al. Excess administration of miR-340-5p ameliorates spinal cord injury-induced neuroinflammation and apoptosis by modulating the P38-MAPK signaling pathway. Brain, Behavior, Immun. 2020;87:531–42.10.1016/j.bbi.2020.01.025Suche in Google Scholar PubMed

[39] Zhou W, Huang G, Ye J, Jiang J, Xu QJ. Protective effect of miR-340-5p against Brain injury after intracerebral hemorrhage by targeting PDCD4. Cerebrovasc Dis (Basel, Switz). 2020;49(6):593–600.10.1159/000508210Suche in Google Scholar PubMed

[40] Papari E, Noruzinia M, Kashani L, Foster WJF. Sterility. Identification of candidate microRNA markers of endometriosis with the use of next-generation sequencing and quantitative real-time polymerase chain reaction. Fertil Steril. 2020;113(6):1232–41.10.1016/j.fertnstert.2020.01.026Suche in Google Scholar PubMed

[41] Wang C, Zhang J, Fok KL, Tsang LL, Ye M, Liu J, et al. CD147 induces epithelial-to-mesenchymal transition by disassembling cellular apoptosis susceptibility protein/E-cadherin/β-catenin complex in human endometriosis. Am J Pathol. 2018;188(7):1597–607.10.1016/j.ajpath.2018.03.004Suche in Google Scholar PubMed

[42] Chatterjee K, Jana S, DasMahapatra P, Swarnakar S. EGFR-mediated matrix metalloproteinase-7 up-regulation promotes epithelial-mesenchymal transition via ERK1-AP1 axis during ovarian endometriosis progression. FASEB J. 2018;32(8):4560–72.10.1096/fj.201701382RRSuche in Google Scholar PubMed

[43] Rekker K, Tasa T, Saare M, Samuel K, Kadastik Ü, Karro H, et al. Differentially-expressed miRNAs in ectopic stromal cells contribute to endometriosis development: the plausible role of miR-139-5p and miR-375. Int J Mol Sci. 2018;19(12):3789.10.3390/ijms19123789Suche in Google Scholar PubMed PubMed Central

[44] Yu J, Tan Q, Deng B, Fang C, Qi D, Wang R. The microRNA-520a-3p inhibits proliferation, apoptosis and metastasis by targeting MAP3K2 in non-small cell lung cancer. Am J Cancer Res. 2015;5(2):802–11.Suche in Google Scholar

[45] Chen X, Gao J, Yu Y, Zhao Z, Pan Y. LncRNA FOXD3-AS1 promotes proliferation, invasion and migration of cutaneous malignant melanoma via regulating miR-325/MAP3K2. Biomed Pharmacotherapy = Biomed Pharmacotherapie. 2019;120:109438.10.1016/j.biopha.2019.109438Suche in Google Scholar PubMed

[46] Zhang X, Song H, Qiao S, Liu J, Xing T, Yan X, et al. MiR-17-5p and miR-20a promote chicken cell proliferation at least in part by upregulation of c-Myc via MAP3K2 targeting. Sci Rep. 2017;7(1):15852.10.1038/s41598-017-15626-9Suche in Google Scholar PubMed PubMed Central

Received: 2021-09-27
Revised: 2022-01-20
Accepted: 2022-02-07
Published Online: 2022-03-17

© 2022 Yiting Wan et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0448
Schlagwörter für diesen Artikel
endometriosis; hsa-miR-340-5p; MAP3K2; epithelial–mesenchymal transition; MAPK/ERK
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 3.10.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0448/html?lang=de
Button zum nach oben scrollen