lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
-
Zhi Xie
, Chen Wang , Li Li , Xianfeng Chen , Guanjing Wei , Yan Chi , Yanping Liang , Lizhen Lan , Jiqiong Hong und Lili Li
Abstract
Invasion and metastasis of melanoma are a series of complicated biological events regulated by multiple factors. The coregulation of many molecules involved in the development and progression of melanoma contributes to invasion and migration. mGluR1 is a metabotropic glutamate receptor that is overexpressed in melanocytes and is sufficient to induce melanoma. In our study, we found that mGluR1 was obviously increased in melanoma. Furthermore, we found that miR-129-5p could directly target and regulate mGluR1 mRNA, which was significantly reduced in A375 cells. Overexpression of miR-129-5p inhibited cell migration, invasion and clonal formation. lncRNA-AC130710 directly targeted and suppressed miR-129-5p in A375 cells. Downregulation of lncRNA-AC130710 suppressed the levels of mGluR1 mRNA by promoting miR-129-5p expression and further inhibiting migration, invasion and colony formation in A375 cells, which was associated with the activation of the PKCα-MAPK signaling pathway. Taken together, our study showed that the lncRNA-AC130710/miR-129-5p/mGluR1 axis plays an important role in the invasion and metastasis of melanoma.
1 Introduction
Malignant melanoma is a type of malignant tumor that originates from neural crest melanoma cells [1]. Although it accounts for only approximately 4% of all dermatological cancers, it contributes to more than 80% of deaths in skin cancer patients [2]. The invasion and metastasis of melanoma is a complex process with multiple stages and is affected by many factors that directly affect the melanoma prognosis for patients [3,4]. The coregulation of many molecules contributes to invasion and migration, which thereby participates in the development and progression of melanoma.
Metabotropic glutamate receptors (mGluRs) can mediate neuronal excitability and neurotransmitter release and have been extensively studied in the central nervous system. Certain cancers, such as melanoma, express various mGluR subtypes that might play a role in disease progression. Namkoong et al. and Lee et al. found abnormal expression of mGluR1 in human melanoma cell lines and tissue sections [5,6]. Suppression of mGluR1 and glutamate signaling can inhibit the progression of melanoma [5]. In our previous study, we also found that mGluR1 expression was elevated in melanoma. Therefore, we wanted to inhibit the invasion and metastasis of melanoma by regulating mGluR1.
lncRNAs are noncoding RNAs of the more than 200 nt in length and regulate various biological events [7–9]. Recently, studies have shown that there are multiple interactions between noncoding RNAs and coding RNAs, such as the lncRNA‒miRNA–mRNA regulatory network [10]. As a representative mechanism, lncRNAs can function as miRNA sponges [11]. For example, Wei et al. demonstrated that the lncRNA UCA1-miR-507-FOXM1 axis participates in melanoma cell proliferation and invasion by regulating the G0/G1 cell cycle [12]. Sun et al. showed that lncRNA MALAT1, as the competitive endogenous RNA sponge of miR-183, promoted the occurrence and development of melanoma by regulating the miR-183-ITGB1 axis [13]. Therefore, elucidating the regulatory network of lncRNA–miRNA–mRNA is critical to determine the specific role of each molecule in the metastasis and invasion of malignant melanoma [14,15]. Xu et al. determined that lncRNA-AC130710 plays an important role in regulating the invasion of gastric cancer cells by targeting miR-129-5p [16]. Previously, we predicted the interaction between miR-129-5p and mGluR1 by miRanda (www.microrna.org) and RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/).
Therefore, we wanted to explore whether lncRNA-AC130710 promoted melanoma invasion and metastasis by interacting with miR-129-5p to upregulate the expression of mGluR1.
2 Materials and methods
2.1 Cell culture
A375 cells, HEK-293T cells and a human primary melanocyte cell line were purchased from iCell Bioscience Inc. (Shanghai, China). A375 cells were cultured in DMEM with 10% fetal bovine serum (FBS, HyClone) and penicillin‒streptomycin (100 U/mL) at 37°C with 5% CO2. The human primary melanocyte cell line was cultured in a special medium for primary melanocytes (iCell Bioscience Inc.) with 0.5% FBS (HyClone), special culture additives for primary melanocyte cell lines (iCell Bioscience Inc.) and penicillin‒streptomycin (100 U/mL) at 37°C with 5% CO2. HEK-293T cells were cultured in DMEM with 10% FBS, 1% Glutamax, 1% NEAA and penicillin‒streptomycin (100 U/mL) at 37°C with 5% CO2.
2.2 Cell transfection
The miR-129-5p mimic, negative control (NC) mimic, three lncRNA-AC130710 siRNAs and one siRNA NC were synthesized by Sangon Biotech (Shanghai, China). The sequences were as follows: hsa-miR-129-5p-S, CUUUUUGCGGUCUGGGCUUGC; hsa-miR-129-5p-A, AAGCCCAGACCGCAAAAAGUU; mimic NC-S, UUGUACUACACAAAAGUACUG and mimic NC-A, GUACUUUUGUGUAGUACAAUU. The vectors used in our study included pcDNA3.1-lncRNA-AC130710 and pcDNA3.1 NC. A375 cells were transfected using Lipofectamine 2000 (Invitrogen, USA) for 24 h according to the manufacturer’s instructions.
2.3 Real-time qPCR
Total RNA was extracted from cells using the TaKaRa MiniBEST Universal RNA Extraction Kit according to the manufacturer’s procedure. Then, cDNA was synthesized by using a miRNA 1st Strand cDNA Synthesis Kit (Vazyme) and Hifair®Ⅱ 1st Strand cDNA Synthesis SuperMix (YEASEN, Shanghai). After that, Hieff® qPCR SYBR Green Master Mix (YEASEN, Shanghai) was used to perform the RT-qPCR on an ABI QuantStudio™ 12K Flex according to the manufacturer’s procedure. The qPCR conditions were as follows: 95°C for 5 min followed by 40 cycles of 95°C for 10 s, 55–60°C for 20 s and 72°C for 20 s. The primers used were as follows: mGluR1, F: 5′–CCAACTTCAACGAGGCCAAA–3′, R: 5′–CATGCGGACAACATCAGAGG–3′; miR-129-5p, F: 5′–CGCTTTTTGCGGTCTGG–3′, R: 5′–CAGTGCGTGTCGTGGAGT–3′; lncRNA-AC130710: F: 5′–AGGACAGTCTCAAGGGGGTTA–3′, R: 5′–CTGCCTTCTCACATGGAACTC–3′; GAPDH: F, 5′–TCAAGAAGGTGGTGAAGCAGG–3′, R: 5′–TCAAAGGTGGAGGAGTGGGT–3′ and U6, F: 5′–GCTTCGGCAGCACATATACTAAAAT–3′, R: 5′–CGCTTCACGAATTTGCGTGTCAT–3′. The primers were obtained from Sangon Biotech (Shanghai, China). The levels of mGluR1 and lncRNA-AC130710 were normalized to that of GAPDH. The levels of miR-129-5p were normalized to that of U6. The relative expression levels of genes were calculated using the 2−ΔΔCt method.
2.4 Luciferase reporter assay
mGluR1-WT-pmirGLO, mGluR1-Mut-pmirGLO, lncRNA-AC130710-WT-pmirGLO and lncRNA-AC130710-Mut-pmirGLO plasmids were constructed by GenScript (Wuhan, China). Cells were seeded in 24-well plates and grown for 24 h before transfection. Lipofectamine 2000 (Invitrogen, USA) was used to cotransfect miR-129-5p mimics or the miR-NC and wild-type or mutant plasmids into cells. Transfected cells were harvested after 48 h and then analyzed using a Dual-Luciferase Reporter Assay System (Promega, USA).
2.5 Wound healing assay
A375 cells were transfected with miR-129-5p mimic, mimic NC, pcDNA3.1-lncRNA-AC130710, pcDNA3.1 NC, lncRNA-AC130710 siRNA or siRNA NC for 48 h, respectively. Then, these cells were seeded into six-well plates at a density of 3.5 × 105 cells per well at 37°C. A 10 μL pipette tip was used to make a straight scratch. The culture medium was discarded, and the cells were washed three times in PBS. Then, serum-free medium was added. An Olympus IX71 microscope was used to take images at 0, 24 and 48 h after scratching, and then the migration distances of the cells were calculated. Scratch width was subtracted from time 0 scratch widths at the same location to determine cell migration distance. Migration distances were averaged to determine overall migration.
2.6 Invasion assays
Cell invasive capacity was assessed by using a transwell chamber. Matrigel was diluted ten times with serum-free medium, and 50 µL was added to each transwell chamber, followed by incubation at 37°C for 30 min. Transfected cells were harvested and suspended in serum-free DMEM. Then, 300 μL of cell suspension (2 × 104/mL cells) was placed into the upper chamber, and 600 μL medium containing 10% FBS was added to the lower chamber. Cells were cultured at 37°C for 24 h. After 24 h, cells on the upper surface were removed with a cotton swab, while the invasive cells in the lower chamber were fixed with 4% paraformaldehyde and stained with crystal violet. The stained cells were counted in three randomly selected visual fields per well under an Olympus IX71 microscope.
2.7 Colony formation assay
Transfected cells were seeded into six-well plates at a density of 200 cells/well and cultured at 5% CO2 and 37°C for 2 weeks. Cells were washed with PBS, fixed with 4% paraformaldehyde for 10 min and stained with crystal violet. The colony number was then determined with an Olympus IX71 microscope. The assays were independently repeated three times.
2.8 Western blot analyses
Total cellular protein was quantified using a BCA protein assay kit (Thermo Fisher Scientific). Equal amounts of protein were separated by 12% SDS‒PAGE and transferred to a polyvinylidene fluoride membrane (Hybond, CA). The membranes were blocked and then incubated overnight at 4°C with antibodies against mGluR1, PKCα, MAPK42/44, p-MAPK42/44 and GAPDH (1:1,000, ABclonal). The membranes were incubated with secondary antibodies conjugated to horseradish peroxidase (1:5,000; Beyotime Biotechnology, China) at room temperature for 2 h. Protein bands were detected using an efficient enhanced chemiluminescence (ECL) kit (GE Healthcare, UK) and quantitated using Quantity One software (Bio-Rad Laboratories, UK). Band intensities were normalized to that of GAPDH.
2.9 Statistical analysis
All data are expressed as the mean ± standard deviation. Statistical analysis was carried out using SPSS 13.0. Comparisons among multiple groups were conducted using one-way analysis of variance; p < 0.05 was considered to indicate a statistically significant difference.
3 Results
3.1 Upregulated miR-129-5p suppresses mGluR1 expression in melanoma
mGluR1 is a metabotropic glutamate receptor, and mGluR1 expression in mouse melanocytes was determined to be sufficient to induce melanoma. Consistent with a previous study, our results showed that the expression of mGluR1 was significantly increased in A375 cells compared with the human primary melanocyte cell line (Figure 1a).

miR-129-5p directly target with mGluR1 in A375. (a) Relative mRNA expression of mGluR1 in A375 cells compared with human primary melanocytes cell line. (b) Relative mRNA expression of miR-129-5p in A375 cells compared with human primary melanocytes cell line. (c) Predicted complementary binding site of miR-129-5p in mGluR1 3′-UTR. (d) Relative luciferase activities were inhibited transfected with the reporter vector WT mGluR1, not with the reporter vector Mut mGluR1. (e) Relative mRNA expression of mGluR1 detected by qPCR in A375 cells were inhibited transfected with miR-129-5p mimic. (f) Relative expression of mGluR1 detected by Western blot in A375 cells were inhibited transfected with miR-129-5p mimic. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
Our previous study found that the level of miR-129-5p was obviously decreased in A375 cells compared with the human primary melanocyte cell line (Figure 1b), and we also found a targeting relationship between miR-129-5p and mGluR1. We used miRanda (www.microrna.org) and RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/) to predict the putative complementary binding sites of miR-129-5p and mGluR1 (Figure 1c).
Furthermore, we wanted to determine whether miR-129-5p directly targets mGluR1 using a luciferase reporter assay. As shown in Figure 1d, overexpression of miR-129-5p decreased the luciferase activity of the wild-type mGluR1 3′-UTR reporter in 293T cells. However, miR-129-5p mimics did not influence the luciferase activity of the reporter carrying the mutated mGluR1 3′-UTR.
Moreover, the addition of miR-129-5p resulted in significantly downregulated expression of mGluR1 in both the qPCR and Western blot results (Figure 1e and f).
3.2 Overexpression of miR-129-5p affects cell migration, cell invasion and colony formation in melanoma
We examined the effect of miR-129-5p on cell migration, cell invasion and colony formation in A375 cells (Figure 2). The results of the scratch assay showed that the relative migration distance was 5.32% at 24 h and 11.82% at 48 h in cells transfected with the miR-129-5p mimic, and the relative migration distance was 13.9% at 24 h and 30.11% at 48 h in control cells (Figure 2a). Overexpression of miR-129-5p significantly inhibited A375 cell migration by 61.72% at 24 h and 60.74% at 48 h compared with the control.

Effects of miR-129-5p overexpression on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with miR-129-5p. (b) Cell invasion was investigated in A375 cells transfected with miR-129-5p. (c) Colony formation of A375 cells transfected with miR-129-5p. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
We also examined the effect of miR-129-5p expression on the invasion of A375 cells (Figure 2b). The results of the invasion assay showed that overexpressed miR-129-5p inhibited A375 cell invasion by 70.29%, which showed obvious inhibition of melanoma cell invasion.
The effect of miR-129-5p on the proliferation capacity of tumor cells was also examined with the colony formation assay. When plated at a density of 200 cells/well, miR-129-5p mimic-transfected cells generated a lower rate of colony formation (15.83%) than control cells (45.67%) (Figure 2c). Overexpression of miR-129-5p significantly inhibited cell migration, cell invasion and colony formation in melanoma.
3.3 lncRNA-AC130710 increases in melanoma and inhibits miR-129-5p expression
Previous research has determined that lncRNA-AC130710 directly targets and suppresses miR-129-5p in gastric cancer. Here, we wanted to verify whether there is a relationship between lncRNA-AC130710 and miR-129-5p in melanoma. First, we determined the level of lncRNA-AC130710 in A375 cells and the human primary melanocyte cell line. We found that the level of lncRNA-AC130710 was significantly increased in A375 cells compared with the human primary melanocyte cell line (Figure 3a). We used miRanda and RNAhybrid to predict the putative complementary binding sites of lncRNA-AC130710 and miR-129-5p (Figure 3b).

lncRNA-AC130710 directly target with miR-129-5p in A375. (a) Relative expression of lncRNA-AC130710 in A375 cells compared with human primary melanocytes cell line. (b) Predicted complementary binding site of miR-129-5p in lncRNA-AC130710. (c) Relative luciferase activities were inhibited transfected with the reporter vector WT lncRNA-AC130710, not with the reporter vector Mut lncRNA-AC130710. (d) Construction of pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (e) Relative expression of miR-129-5p in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (f) Relative expression of lncRNA-AC130710 in A375 cells transfected with NC mimic and miR-129-5p mimic vectors. (g) Relative expression of mGluR1 in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (h) Relative expression of mGluR1 in A375 cells when modulation of miR-129-5p or lncRNA-AC130710 expression. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
We further determined whether lncRNA-AC130710 targets miR-129-5p using a luciferase reporter assay. As shown in Figure 3c, overexpression of miR-129-5p decreased the luciferase activity of the wild-type lncRNA-AC130710 3′-UTR reporter in 293T cells. However, miR-129-5p mimics did not influence the luciferase activity of the reporter carrying the mutated lncRNA-AC130710 3′-UTR.
We also constructed lncRNA-AC130710 overexpression plasmids (pcDNA3.1-lncRNA-AC130710) and interference plasmids (lncRNA-AC130710 siRNA) (Figure 3d). The results showed that transfection of pcDNA3.1-lncRNA-AC130710 significantly reduced the level of miR-129-5p; in contrast, transfection of lncRNA-AC130710 siRNA obviously increased the level of miR-129-5p in A375 cells (Figure 3e). We also investigated whether miR-129-5p affected the levels of lncRNA-AC130710. We found that transfection of the miR-129-5p mimic significantly decreased the level of lncRNA-AC130710, indicating that miR-129-5p affected the levels of lncRNA-AC130710 (Figure 3f).
Moreover, modulation of lncRNA-AC130710 expression affected the level of mGluR1 mRNA. As shown in Figure 3g, transfection of pcDNA3.1-lncRNA-AC130710 significantly increased the expression of mGluR1, and lncRNA-AC130710 siRNA obviously decreased the expression of mGluR1 in A375 cells. Subsequently, we investigated the effect of the interaction between lncRNA-AC130710 and miR-129-5p on mGluR1 expression. When cells were transfected with miR-129-5p RNAi, the expression of mGluR1 was increased. Conversely, when cells were transfected with lncRNA-AC130710 RNAi, the expression of mGluR1 was decreased. However, when the levels of lncRNA-AC130710 and miR-129-5p were decreased or both increased, the effect on the expression level of mGluR1 was reversed, i.e., the expression level was almost the same as that in the control group. This indicated that the regulation between lncRNA-AC130710 and mGluR1 might be dependent on miR-129-5p (Figure 3h).
3.4 Modulation of lncRNA-AC130710 expression affects cell migration, cell invasion and colony formation in melanoma
We examined the effect of lncRNA-AC130710 on cell migration, cell invasion and colony formation in A375 cells (Figure 4). The results of the scratch assay showed that the relative migration distance was 26.29% at 24 h and 48.78% at 48 h in cells transfected with pcDNA3.1-lncRNA-AC130710; however, the relative migration distance was 4.75% at 24 h and 12.66% at 48 h in cells transfected with lncRNA-AC130710 siRNA. The relative migration distance was 8.89% at 24 h and 28.86% at 48 h in control cells (Figure 4a). Overexpression of lncRNA-AC130710 significantly promoted A375 cell migration by 66.15% at 24 h and 44.93% at 48 h compared with the control. Inhibition of lncRNA-AC130710 significantly inhibited A375 cell invasion by 46.64% at 24 h and 52.88% at 48 h compared with the control.

Effects of lncRNA-AC130710 on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (b) Cell invasion was investigated in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (c) Colony formation of A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
We also examined the effect of lncRNA-AC130710 expression on the invasion of A375 cells (Figure 4b). The results of the invasion assay show that overexpressed lncRNA-AC130710 promotes A375 cell invasion by 80.0%; however, suppressed lncRNA-AC130710 expression inhibits cell invasion by 59.61%.
The effect of lncRNA-AC130710 on the proliferation capacity of tumor cells was also examined with the colony formation assay. pcDNA3.1-lncRNA-AC130710-transfected cells generated a higher rate of colony formation (77.17%) than control cells (50.17%); however, lncRNA-AC130710 siRNA-transfected cells generated a lower rate of colony formation (29.17%) than control cells (Figure 4c).
Overexpression of lncRNA-AC130710 significantly promoted cell invasion, cell migration and colony formation in melanoma, while decreasing lncRNA-AC130710 expression obviously suppressed cell invasion, cell migration and colony formation.
Furthermore, we wanted to investigate whether the effects of lncRNA-AC130710 expression on cell invasion, cell migration and colony formation depend on mGluR1 levels. We constructed mGluR1 overexpression plasmids (pcDNA3.1-mGluR1) and transfected pcDNA3.1-mGluR1 and lncRNA-AC130710 RNAi into A375 cells. We found that even when mGluR1 was overexpressed, cell invasion, cell migration and colony formation in melanoma were also repressed when lncRNA-AC130710 expression was suppressed in cells (Figure 5a–c).

Effects of modulating lncRNA-AC130710 and mGluR1 expression on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. (b) Cell invasion was investigated in A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. (c) Colony formation of A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01).
3.5 Expression of miR-129-5p by downregulated lncRNA-AC130710 inactivates the PKCα-MAPK signaling pathway
We tested the activation of the PKCα-MAPK pathway to explore the potential underlying mechanisms of the lncRNA-AC130710/miR-129-5p/mGluR1 axis in A375 cells. The results showed that the expression of PKCα and p-MAPK was decreased in miR-129-5p mimic-transfected cells compared with NC mimic-transfected cells (Figure 6a).

Effect of miR-129-5p and lncRNA-AC130710 on PKCα-MAPK signal pathway. (a) Effect of miR-129-5p overexpression on PKCα-MAPK signal pathway in A375 cells. (b) Effect of lncRNA-AC130710 overexpression and lncRNA-AC130710 silencing on PKCα-MAPK signal pathway in A375 cells. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
Moreover, transfection with pcDNA3.1-lncRNA-AC130710 increased the expression of PKCα and p-MAPK in A375 cells, and transfection with lncRNA-AC130710 siRNA decreased the levels of PKCα and p-MAPK (Figure 6b).
The results indicated that overexpression of miR-129-5p inactivated the PKCα-MAPK pathway. Expression of lncRNA-AC130710 suppressed the regulatory role of miR-129-5p, thereby inactivating the PKCα-MAPK pathway and further promoting cell invasion, cell migration and colony formation in melanoma.
4 Discussion
In our study, we found that miR-129-5p suppressed invasion and migration of melanoma cancer cells through targeting mGluR1 transcripts. By suppressing miR-129-5p, lncRNA-AC130710 was capable of promoting metastasis, which was associated with the activation of PKCa-MAPK signal pathway.
In recent years, the glutamate signaling pathway has been reported to be related to tumorigenesis [17]. Glutamate receptors constitute two main groups. One group is comprised of ionotropic receptors, which form ion channels, and the opening and closing of these channels are regulated by glutamate. Methyl-d-aspartate receptor (NMDAR) is a subtype with strong voltage dependence and high Ca2+ permeability. The other type is mGluRs, which belongs to the superfamily of G-protein coupled receptors [18]. mGluR1 is a metabotropic glutamate receptor. Lee et al. demonstrated that the expression of mGluR1 in mouse melanocytes was sufficient to induce melanoma [19]. Blocking the activity of GluR1 with an antagonist has been shown to significantly inhibit the invasion and motility of melanoma cells [20]. Previous studies and our results have shown that the expression of mGluR1 is obviously upregulated in melanoma cells [20]. Inhibition of mGluR1 expression can suppress the development of melanoma, including proliferation, cell invasion and cell migration.
Furthermore, we found that miR-129-5p directly targeted and regulated mGluR1. Our results show that miR-129-5p was significantly reduced in melanoma. In addition, the dual luciferase assay verified that miR-129-5p targets mGluR1 and inhibits the expression of mGluR1. Overexpression of miR-129-5p inhibited tumor cell characteristics such as cell migration, cell invasion and clonal formation. Our results demonstrated that inhibiting melanoma can be achieved by regulating miR-129-5p.
LncRNAs function as miRNA sponges to suppress miRNA targeting of mRNAs and the degradation mediated by miRNAs [21,22]. For example, Chen et al. determined that lncRNA FOXD3-AS1 promotes proliferation, invasion and migration of cutaneous malignant melanoma by regulating the miR-325/MAP3K2 axis [23]. Wu et al. indicated that lncRNA MEG3 might inhibit the tumor growth, tumor metastasis and formation of melanoma by modulating the miR-21/E-cadherin axis [24]. Although many studies have described multiple lncRNAs related to melanoma, the involvement of lncRNAs in melanoma tumorigenesis and progression has not been fully studied [25]. A previous study showed that lncRNA-AC130710 directly targets and suppresses miR-129-5p in gastric cancer [16]. LncRNAs target miRNAs through their own miRNA reaction elements at binding sites, further suppressing miRNA targeting of mRNAs and the degradation mediated by miRNAs [26]. In our study, we found that lncRNA-AC130710 has the complementary binding sites miR129-5p, and the dual luciferase experiment also confirmed their relationship. Furthermore, the expression of lnRNA-AC130710 was determined to be significantly increased in melanoma cells. Overexpression of lncRNA-AC130710 reduced the level of miR-129-5p, while downregulation of lncRNA-AC130710 increased the level of miR-129-5p. This result indicated that there is indeed an interactive relationship between them. We also found that overexpression of miR-129-5p significantly decreased the level of lncRNA-AC130710, indicating that miR-129-5p also affected the levels of lncRNA-AC130710. Furthermore, overexpression of lncRNA-AC130710 upregulated mGluR1, while downregulation of lncRNA-AC130710 induced a reduction in mGluR1 expression, demonstrating that the expression of lncRNA-AC130710 suppressed miR-129-5p, a tentative negative regulator of mGluR1 transcripts, and promoted mGluR1 expression increases in melanoma. The regulation between lncRNA-AC130710 and mGluR1 might be dependent on miR-129-5p.
We also demonstrated the effects of modulation of lncRNA-AC130710 expression on cell invasion, cell migration and colony formation in melanoma. We found that overexpression of lncRNA-AC130710 significantly promotes cell invasion, cell migration and colony formation in melanoma, while decreasing lncRNA-AC130710 expression obviously suppresses cell invasion, cell migration and colony formation. Expression of lncRNA-AC130710 suppressed miR-129-5p, a tentative negative regulator of mGluR1 transcripts, which was sufficient to inhibit cell invasion, migration and colony formation in melanoma.
Even after overexpression of mGluR1, cell invasion, cell migration and colony formation in melanoma were also repressed when lncRNA-AC130710 expression was suppressed in cells. These results further demonstrate that miR-129-5p suppressed the migration and invasion of A375 cells by decreasing the expression of mGluR1. However, lncRNA-AC130710 promoted the level of mGluR1 mRNA and the migration and invasion of cells by negatively regulating miR-129-5p.
Activation of NMDAR and mGluR leads to an increase in the activities of PKCα [27]. Inhibiting the expression of mGluR induced the decreased expression or activity of PKCα. The MAPK cascade is considered to be one of the main signaling pathways activated by PKCα [28]. Activation of the MAPK cascade plays a crucial role in many signaling pathways related to cell proliferation. Inhibition of the MAPK cascade can suppress the cell migration and invasion of tumor cells. Our results showed that the expression of lncRNA-AC130710 promoted PKCα activity and MAPK phosphorylation by suppressing miR-129-5p in melanoma, while the downregulation of lncRNA-AC130710 increased miR-129-5p expression and reduced PKCα expression and MAPK phosphorylation. Our study demonstrated that lncRNA-AC130710 promotes cell migration and invasion by suppressing miR-129-5p, which is associated with the activation of the PKCα-MAPK signaling pathway.
5 Conclusion
Taken together, our study showed that the lncRNA-AC130710/miR-129-5p/mGluR1 axis plays an important role in the invasion and metastasis of melanoma cell lines.
Acknowledgments
Not applicable.
-
Funding information: This work was supported by funding from Guangxi Natural Science Foundation (No. 2019GXNSFBA185018), Self-Funded Scientific Research Project of Guangxi Zhuang Autonomous Region Health Committee (No. Z20210931) and National Natural Science Foundation of China (No. 81960562).
-
Author contributions: L.L.L. conceived and wrote the article. X.Z., W.C., L.L. and L.L.L. reviewed and edited the manuscript. All authors participated in literature search, data collection and figure design. All authors read and approved the manuscript.
-
Conflict of interest: The authors declare that they have no conflict of interest.
-
Data availability statement: The dataset generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] MacKie RM, Hauschild A, Eggermont AM. Epidemiology of invasive cutaneous melanoma. Ann Oncol. 2009;20(Suppl 6):vi1–7.10.1093/annonc/mdp252Suche in Google Scholar PubMed PubMed Central
[2] Rastrelli M, Tropea S, Rossi CR, Alaibac M. Melanoma: epidemiology, risk factors, pathogenesis, diagnosis and classification. In Vivo. 2014;28(6):1005–11.Suche in Google Scholar
[3] Aladowicz E, Ferro L, Vitali GC, Venditti E, Fornasari L, Lanfrancone L. Molecular networks in melanoma invasion and metastasis. Future Oncol. 2013;9(5):713–26.10.2217/fon.13.9Suche in Google Scholar PubMed
[4] Liu Y, Ao X, Zhou X, Du C, Kuang S. The regulation of PBXs and their emerging role in cancer. J Cell Mol Med. 2022;26(5):1363–79.10.1111/jcmm.17196Suche in Google Scholar PubMed PubMed Central
[5] Namkoong J, Shin SS, Lee HJ, Marin YE, Wall BA, Goydos JS, et al. Metabotropic glutamate receptor 1 and glutamate signaling in human melanoma. Cancer Res. 2007;67(5):2298–305.10.1158/0008-5472.CAN-06-3665Suche in Google Scholar PubMed
[6] Lee HJ, Wall BA, Wangari-Talbot J, Shin SS, Rosenberg S, Chan JL, et al. Glutamatergic pathway targeting in melanoma: single-agent and combinatorial therapies. Clin Cancer Res. 2011;17(22):7080–92.10.1158/1078-0432.CCR-11-0098Suche in Google Scholar PubMed PubMed Central
[7] Chen LL. Linking long noncoding RNA localization and function. Trends Biochem Sci. 2016;41(9):761–72.10.1016/j.tibs.2016.07.003Suche in Google Scholar PubMed
[8] Liu Y, Ao X, Yu W, Zhang Y, Wang J. Biogenesis, functions, and clinical implications of circular RNAs in non-small cell lung cancer. Molecular therapy. Nucleic Acids. 2022;27:50–72.10.1016/j.omtn.2021.11.013Suche in Google Scholar PubMed PubMed Central
[9] Zhang Y, Zhao Y, Liu Y, Wang M, Yu W, Zhang L. Exploring the regulatory roles of circular RNAs in Alzheimer’s disease. Transl Neurodegener. 2020;9(1):35.10.1186/s40035-020-00216-zSuche in Google Scholar PubMed PubMed Central
[10] Guil S, Esteller M. RNA–RNA interactions in gene regulation: the coding and noncoding players. Trends Biochem Sci. 2015;40(5):248–56.10.1016/j.tibs.2015.03.001Suche in Google Scholar PubMed
[11] Hombach S, Kretz M. Non-coding RNAs: classification, biology and functioning. Adv Exp Med Biol. 2016;937:3–17.10.1007/978-3-319-42059-2_1Suche in Google Scholar PubMed
[12] Wei Y, Sun Q, Zhao L, Wu J, Chen X, Wang Y, et al. LncRNA UCA1-miR-507-FOXM1 axis is involved in cell proliferation, invasion and G0/G1 cell cycle arrest in melanoma. Med Oncol. 2016;33(8):88.10.1007/s12032-016-0804-2Suche in Google Scholar PubMed
[13] Sun Y, Cheng H, Wang G, Yu G, Zhang D, Wang Y, et al. Deregulation of miR-183 promotes melanoma development via lncRNA MALAT1 regulation and ITGB1 signal activation. Oncotarget. 2017;8(2):3509–18.10.18632/oncotarget.13862Suche in Google Scholar PubMed PubMed Central
[14] Wang LX, Wan C, Dong ZB, Wang BH, Liu HY, Li Y. Integrative analysis of long noncoding RNA (lncRNA), microRNA (miRNA) and mRNA expression and construction of a competing endogenous RNA (ceRNA) network in metastatic melanoma. Med Sci Monitor Int Med J Exp Clin Res. 2019;25:2896–907.10.12659/MSM.913881Suche in Google Scholar PubMed PubMed Central
[15] Yu X, Zheng H, Tse G, Chan MT, Wu WK. Long non-coding RNAs in melanoma. Cell Prolif. 2018;51(4):e12457.10.1111/cpr.12457Suche in Google Scholar PubMed PubMed Central
[16] Xu C, Shao Y, Xia T, Yang Y, Dai J, Luo L, et al. lncRNA-AC130710 targeting by miR-129-5p is upregulated in gastric cancer and associates with poor prognosis. Tumour Biol. 2014;35(10):9701–6.10.1007/s13277-014-2274-5Suche in Google Scholar PubMed
[17] Pei Z, Lee KC, Khan A, Erisnor G, Wang HY. Pathway analysis of glutamate-mediated, calcium-related signaling in glioma progression. Biochem Pharmacol. 2020;176:113814.10.1016/j.bcp.2020.113814Suche in Google Scholar PubMed PubMed Central
[18] Stepulak A, Rola R, Polberg K, Ikonomidou C. Glutamate and its receptors in cancer. J Neural Transm. 2014;121(8):933–44.10.1007/s00702-014-1182-6Suche in Google Scholar PubMed PubMed Central
[19] Lee HJ, Wall BA, Wangari-Talbot J, Chen S. Regulation of mGluR1 expression in human melanocytes and melanoma cells. Biochim Biophys Acta. 2012;1819(11–12):1123–31.10.1016/j.bbagrm.2012.06.005Suche in Google Scholar PubMed PubMed Central
[20] Song Z, He CD, Liu J, Sun C, Lu P, Li L, et al. Blocking glutamate-mediated signalling inhibits human melanoma growth and migration. Exp Dermatol. 2012;21(12):926–31.10.1111/exd.12048Suche in Google Scholar PubMed
[21] Zhang Y, Zhang L, Wang Y, Ding H, Xue S, Qi H, et al. MicroRNAs or long noncoding RNAs in diagnosis and prognosis of coronary artery disease. Aging Dis. 2019;10(2):353–66.10.14336/AD.2018.0617Suche in Google Scholar PubMed PubMed Central
[22] Zhang Y, Zhao Y, Ao X, Yu W, Zhang L, Wang Y, et al. The role of non-coding RNAs in Alzheimer’s disease: from regulated mechanism to therapeutic targets and diagnostic biomarkers. Front Aging Neurosci. 2021;13:654978.10.3389/fnagi.2021.654978Suche in Google Scholar PubMed PubMed Central
[23] Chen X, Gao J, Yu Y, Zhao Z, Pan Y. LncRNA FOXD3-AS1 promotes proliferation, invasion and migration of cutaneous malignant melanoma via regulating miR-325/MAP3K2. Biomed Pharmacother = Biomed Pharmacother. 2019;120:109438.10.1016/j.biopha.2019.109438Suche in Google Scholar PubMed
[24] Wu L, Zhu L, Li Y, Zheng Z, Lin X, Yang C. LncRNA MEG3 promotes melanoma growth, metastasis and formation through modulating miR-21/E-cadherin axis. Cancer Cell Int. 2020;20:12.10.1186/s12935-019-1087-4Suche in Google Scholar PubMed PubMed Central
[25] Li R, Zhang L, Jia L, Duan Y, Li Y, Bao L, et al. Long non-coding RNA BANCR promotes proliferation in malignant melanoma by regulating MAPK pathway activation. PLoS One. 2014;9(6):e100893.10.1371/journal.pone.0100893Suche in Google Scholar PubMed PubMed Central
[26] Liu Y, Ao X, Wang Y, Li X, Wang J. Long non-coding RNA in gastric cancer: mechanisms and clinical implications for drug resistance. Front Oncol. 2022;12:841411.10.3389/fonc.2022.841411Suche in Google Scholar PubMed PubMed Central
[27] Moriguchi S, Han F, Shioda N, Yamamoto Y, Nakajima T, Nakagawasai O, et al. Nefiracetam activation of CaM kinase II and protein kinase C mediated by NMDA and metabotropic glutamate receptors in olfactory bulbectomized mice. J Neurochem. 2009;110(1):170–81.10.1111/j.1471-4159.2009.06122.xSuche in Google Scholar PubMed
[28] Anfuso CD, Giurdanella G, Motta C, Muriana S, Lupo G, Ragusa N, et al. PKCalpha-MAPK/ERK-phospholipase A2 signaling is required for human melanoma-enhanced brain endothelial cell proliferation and motility. Microvasc Res. 2009;78(3):338–57.10.1016/j.mvr.2009.09.001Suche in Google Scholar PubMed
© 2022 Zhi Xie et al., published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Artikel in diesem Heft
- Research Articles
- AMBRA1 attenuates the proliferation of uveal melanoma cells
- A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
- Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
- Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
- Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
- Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
- Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
- The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
- Gene signature to predict prognostic survival of hepatocellular carcinoma
- Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
- Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
- Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
- Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
- Pericentric inversion of chromosome 6 and male fertility problems
- Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
- Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
- Expression of DNM3 is associated with good outcome in colorectal cancer
- Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
- CRRT influences PICCO measurements in febrile critically ill patients
- SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
- lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
- circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
- Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
- GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
- A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
- Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
- Association between preventable risk factors and metabolic syndrome
- miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
- Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
- Quercitrin protects human bronchial epithelial cells from oxidative damage
- Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
- circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
- Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
- Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
- Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
- LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
- Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
- Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
- Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
- Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
- Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
- miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
- Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
- circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
- miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
- hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
- circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
- TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
- Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
- Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
- circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
- Human amniotic fluid as a source of stem cells
- lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
- NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
- Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
- Risk factors for adverse drug reactions associated with clopidogrel therapy
- Serum zinc associated with immunity and inflammatory markers in Covid-19
- The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
- LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
- Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
- Moscatilin suppresses the inflammation from macrophages and T cells
- Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
- Epithelial-mesenchymal transition-related genes in coronary artery disease
- The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
- Repeated partial splenic artery embolization for hypersplenism improves platelet count
- Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
- Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
- miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
- The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
- Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
- Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
- A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
- Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
- MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
- miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
- Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
- circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
- Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
- Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
- Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
- Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
- Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
- β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
- Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
- In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
- Potential biomarkers for inflammatory response in acute lung injury
- A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
- Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
- ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
- Risk prediction of cardiovascular disease using machine learning classifiers
- Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
- Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
- Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
- Protective effects of glaucocalyxin A on the airway of asthmatic mice
- Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
- Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
- Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
- Identification of osteoporosis based on gene biomarkers using support vector machine
- Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
- miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
- Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
- LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
- The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
- Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
- Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
- lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
- Protective effect of ghrelin on intestinal I/R injury in rats
- In vivo knee kinematics of an innovative prosthesis design
- Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
- lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
- Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
- LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
- Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
- SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
- Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
- Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
- Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
- Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
- Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
- Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
- TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
- Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
- NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
- The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
- miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
- Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
- lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
- Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
- lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
- circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
- LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
- Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
- lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
- SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
- Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
- Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
- Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
- Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
- Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
- Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
- Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
- The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
- Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
- HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
- Meta-analysis of early-life antibiotic use and allergic rhinitis
- Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
- HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
- Amino acid profiles in the tissue and serum of patients with liver cancer
- Pain in critically ill COVID-19 patients: An Italian retrospective study
- Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
- Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
- Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
- The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
- Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
- SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
- The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
- TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
- Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
- Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
- The incidence of bronchiectasis in chronic obstructive pulmonary disease
- Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
- Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
- Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
- lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
- Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
- lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
- DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
- Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
- MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
- Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
- circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
- EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
- Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
- miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
- Review Articles
- Current management of cancer pain in Italy: Expert opinion paper
- Hearing loss and brain disorders: A review of multiple pathologies
- The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
- Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
- Interleukin-35 in autoimmune dermatoses: Current concepts
- Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
- Advantages of ketamine in pediatric anesthesia
- Congenital adrenal hyperplasia. Role of dentist in early diagnosis
- Migraine management: Non-pharmacological points for patients and health care professionals
- Atherogenic index of plasma and coronary artery disease: A systematic review
- Physiological and modulatory role of thioredoxins in the cellular function
- Case Reports
- Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
- A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
- Unusual neurological manifestations of bilateral medial medullary infarction: A case report
- Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
- A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
- A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
- Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
- Fungal infection mimicking COVID-19 infection – A case report
- Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
- Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
- Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
- Trismus during tracheal extubation as a complication of general anaesthesia – A case report
- Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
- Two case reports of skin vasculitis following the COVID-19 immunization
- Ureteroiliac fistula after oncological surgery: Case report and review of the literature
- Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
- Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
- Commentary
- Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
- Rapid Communication
- COVID-19 fear, post-traumatic stress, growth, and the role of resilience
- Erratum
- Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
- Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
- Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
- Retraction
- Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
- Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
- Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Artikel in diesem Heft
- Research Articles
- AMBRA1 attenuates the proliferation of uveal melanoma cells
- A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
- Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
- Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
- Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
- Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
- Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
- The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
- Gene signature to predict prognostic survival of hepatocellular carcinoma
- Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
- Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
- Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
- Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
- Pericentric inversion of chromosome 6 and male fertility problems
- Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
- Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
- Expression of DNM3 is associated with good outcome in colorectal cancer
- Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
- CRRT influences PICCO measurements in febrile critically ill patients
- SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
- lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
- circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
- Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
- GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
- A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
- Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
- Association between preventable risk factors and metabolic syndrome
- miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
- Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
- Quercitrin protects human bronchial epithelial cells from oxidative damage
- Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
- circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
- Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
- Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
- Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
- LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
- Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
- Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
- Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
- Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
- Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
- miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
- Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
- circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
- miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
- hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
- circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
- TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
- Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
- Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
- circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
- Human amniotic fluid as a source of stem cells
- lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
- NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
- Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
- Risk factors for adverse drug reactions associated with clopidogrel therapy
- Serum zinc associated with immunity and inflammatory markers in Covid-19
- The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
- LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
- Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
- Moscatilin suppresses the inflammation from macrophages and T cells
- Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
- Epithelial-mesenchymal transition-related genes in coronary artery disease
- The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
- Repeated partial splenic artery embolization for hypersplenism improves platelet count
- Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
- Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
- miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
- The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
- Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
- Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
- A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
- Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
- MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
- miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
- Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
- circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
- Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
- Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
- Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
- Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
- Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
- β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
- Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
- In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
- Potential biomarkers for inflammatory response in acute lung injury
- A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
- Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
- ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
- Risk prediction of cardiovascular disease using machine learning classifiers
- Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
- Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
- Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
- Protective effects of glaucocalyxin A on the airway of asthmatic mice
- Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
- Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
- Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
- Identification of osteoporosis based on gene biomarkers using support vector machine
- Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
- miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
- Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
- LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
- The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
- Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
- Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
- lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
- Protective effect of ghrelin on intestinal I/R injury in rats
- In vivo knee kinematics of an innovative prosthesis design
- Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
- lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
- Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
- LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
- Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
- SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
- Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
- Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
- Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
- Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
- Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
- Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
- TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
- Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
- NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
- The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
- miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
- Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
- lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
- Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
- lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
- circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
- LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
- Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
- lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
- SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
- Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
- Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
- Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
- Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
- Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
- Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
- Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
- The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
- Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
- HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
- Meta-analysis of early-life antibiotic use and allergic rhinitis
- Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
- HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
- Amino acid profiles in the tissue and serum of patients with liver cancer
- Pain in critically ill COVID-19 patients: An Italian retrospective study
- Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
- Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
- Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
- The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
- Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
- SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
- The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
- TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
- Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
- Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
- The incidence of bronchiectasis in chronic obstructive pulmonary disease
- Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
- Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
- Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
- lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
- Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
- lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
- DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
- Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
- MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
- Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
- circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
- EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
- Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
- miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
- Review Articles
- Current management of cancer pain in Italy: Expert opinion paper
- Hearing loss and brain disorders: A review of multiple pathologies
- The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
- Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
- Interleukin-35 in autoimmune dermatoses: Current concepts
- Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
- Advantages of ketamine in pediatric anesthesia
- Congenital adrenal hyperplasia. Role of dentist in early diagnosis
- Migraine management: Non-pharmacological points for patients and health care professionals
- Atherogenic index of plasma and coronary artery disease: A systematic review
- Physiological and modulatory role of thioredoxins in the cellular function
- Case Reports
- Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
- A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
- Unusual neurological manifestations of bilateral medial medullary infarction: A case report
- Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
- A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
- A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
- Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
- Fungal infection mimicking COVID-19 infection – A case report
- Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
- Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
- Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
- Trismus during tracheal extubation as a complication of general anaesthesia – A case report
- Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
- Two case reports of skin vasculitis following the COVID-19 immunization
- Ureteroiliac fistula after oncological surgery: Case report and review of the literature
- Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
- Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
- Commentary
- Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
- Rapid Communication
- COVID-19 fear, post-traumatic stress, growth, and the role of resilience
- Erratum
- Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
- Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
- Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
- Retraction
- Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
- Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
- Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy