Startseite lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
Artikel Open Access

lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma

  • Zhi Xie , Chen Wang , Li Li , Xianfeng Chen , Guanjing Wei , Yan Chi , Yanping Liang , Lizhen Lan , Jiqiong Hong und Lili Li EMAIL logo
Veröffentlicht/Copyright: 18. Oktober 2022
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 17 Heft 1

Abstract

Invasion and metastasis of melanoma are a series of complicated biological events regulated by multiple factors. The coregulation of many molecules involved in the development and progression of melanoma contributes to invasion and migration. mGluR1 is a metabotropic glutamate receptor that is overexpressed in melanocytes and is sufficient to induce melanoma. In our study, we found that mGluR1 was obviously increased in melanoma. Furthermore, we found that miR-129-5p could directly target and regulate mGluR1 mRNA, which was significantly reduced in A375 cells. Overexpression of miR-129-5p inhibited cell migration, invasion and clonal formation. lncRNA-AC130710 directly targeted and suppressed miR-129-5p in A375 cells. Downregulation of lncRNA-AC130710 suppressed the levels of mGluR1 mRNA by promoting miR-129-5p expression and further inhibiting migration, invasion and colony formation in A375 cells, which was associated with the activation of the PKCα-MAPK signaling pathway. Taken together, our study showed that the lncRNA-AC130710/miR-129-5p/mGluR1 axis plays an important role in the invasion and metastasis of melanoma.

Keywords: melanoma; lncRNA; mGluR1; migration; invasion

1 Introduction

Malignant melanoma is a type of malignant tumor that originates from neural crest melanoma cells [1]. Although it accounts for only approximately 4% of all dermatological cancers, it contributes to more than 80% of deaths in skin cancer patients [2]. The invasion and metastasis of melanoma is a complex process with multiple stages and is affected by many factors that directly affect the melanoma prognosis for patients [3,4]. The coregulation of many molecules contributes to invasion and migration, which thereby participates in the development and progression of melanoma.

Metabotropic glutamate receptors (mGluRs) can mediate neuronal excitability and neurotransmitter release and have been extensively studied in the central nervous system. Certain cancers, such as melanoma, express various mGluR subtypes that might play a role in disease progression. Namkoong et al. and Lee et al. found abnormal expression of mGluR1 in human melanoma cell lines and tissue sections [5,6]. Suppression of mGluR1 and glutamate signaling can inhibit the progression of melanoma [5]. In our previous study, we also found that mGluR1 expression was elevated in melanoma. Therefore, we wanted to inhibit the invasion and metastasis of melanoma by regulating mGluR1.

lncRNAs are noncoding RNAs of the more than 200 nt in length and regulate various biological events [7–9]. Recently, studies have shown that there are multiple interactions between noncoding RNAs and coding RNAs, such as the lncRNA‒miRNA–mRNA regulatory network [10]. As a representative mechanism, lncRNAs can function as miRNA sponges [11]. For example, Wei et al. demonstrated that the lncRNA UCA1-miR-507-FOXM1 axis participates in melanoma cell proliferation and invasion by regulating the G0/G1 cell cycle [12]. Sun et al. showed that lncRNA MALAT1, as the competitive endogenous RNA sponge of miR-183, promoted the occurrence and development of melanoma by regulating the miR-183-ITGB1 axis [13]. Therefore, elucidating the regulatory network of lncRNA–miRNA–mRNA is critical to determine the specific role of each molecule in the metastasis and invasion of malignant melanoma [14,15]. Xu et al. determined that lncRNA-AC130710 plays an important role in regulating the invasion of gastric cancer cells by targeting miR-129-5p [16]. Previously, we predicted the interaction between miR-129-5p and mGluR1 by miRanda (www.microrna.org) and RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/).

Therefore, we wanted to explore whether lncRNA-AC130710 promoted melanoma invasion and metastasis by interacting with miR-129-5p to upregulate the expression of mGluR1.

2 Materials and methods

2.1 Cell culture

A375 cells, HEK-293T cells and a human primary melanocyte cell line were purchased from iCell Bioscience Inc. (Shanghai, China). A375 cells were cultured in DMEM with 10% fetal bovine serum (FBS, HyClone) and penicillin‒streptomycin (100 U/mL) at 37°C with 5% CO2. The human primary melanocyte cell line was cultured in a special medium for primary melanocytes (iCell Bioscience Inc.) with 0.5% FBS (HyClone), special culture additives for primary melanocyte cell lines (iCell Bioscience Inc.) and penicillin‒streptomycin (100 U/mL) at 37°C with 5% CO2. HEK-293T cells were cultured in DMEM with 10% FBS, 1% Glutamax, 1% NEAA and penicillin‒streptomycin (100 U/mL) at 37°C with 5% CO2.

2.2 Cell transfection

The miR-129-5p mimic, negative control (NC) mimic, three lncRNA-AC130710 siRNAs and one siRNA NC were synthesized by Sangon Biotech (Shanghai, China). The sequences were as follows: hsa-miR-129-5p-S, CUUUUUGCGGUCUGGGCUUGC; hsa-miR-129-5p-A, AAGCCCAGACCGCAAAAAGUU; mimic NC-S, UUGUACUACACAAAAGUACUG and mimic NC-A, GUACUUUUGUGUAGUACAAUU. The vectors used in our study included pcDNA3.1-lncRNA-AC130710 and pcDNA3.1 NC. A375 cells were transfected using Lipofectamine 2000 (Invitrogen, USA) for 24 h according to the manufacturer’s instructions.

2.3 Real-time qPCR

Total RNA was extracted from cells using the TaKaRa MiniBEST Universal RNA Extraction Kit according to the manufacturer’s procedure. Then, cDNA was synthesized by using a miRNA 1st Strand cDNA Synthesis Kit (Vazyme) and Hifair®Ⅱ 1st Strand cDNA Synthesis SuperMix (YEASEN, Shanghai). After that, Hieff® qPCR SYBR Green Master Mix (YEASEN, Shanghai) was used to perform the RT-qPCR on an ABI QuantStudio™ 12K Flex according to the manufacturer’s procedure. The qPCR conditions were as follows: 95°C for 5 min followed by 40 cycles of 95°C for 10 s, 55–60°C for 20 s and 72°C for 20 s. The primers used were as follows: mGluR1, F: 5′–CCAACTTCAACGAGGCCAAA–3′, R: 5′–CATGCGGACAACATCAGAGG–3′; miR-129-5p, F: 5′–CGCTTTTTGCGGTCTGG–3′, R: 5′–CAGTGCGTGTCGTGGAGT–3′; lncRNA-AC130710: F: 5′–AGGACAGTCTCAAGGGGGTTA–3′, R: 5′–CTGCCTTCTCACATGGAACTC–3′; GAPDH: F, 5′–TCAAGAAGGTGGTGAAGCAGG–3′, R: 5′–TCAAAGGTGGAGGAGTGGGT–3′ and U6, F: 5′–GCTTCGGCAGCACATATACTAAAAT–3′, R: 5′–CGCTTCACGAATTTGCGTGTCAT–3′. The primers were obtained from Sangon Biotech (Shanghai, China). The levels of mGluR1 and lncRNA-AC130710 were normalized to that of GAPDH. The levels of miR-129-5p were normalized to that of U6. The relative expression levels of genes were calculated using the 2−ΔΔCt method.

2.4 Luciferase reporter assay

mGluR1-WT-pmirGLO, mGluR1-Mut-pmirGLO, lncRNA-AC130710-WT-pmirGLO and lncRNA-AC130710-Mut-pmirGLO plasmids were constructed by GenScript (Wuhan, China). Cells were seeded in 24-well plates and grown for 24 h before transfection. Lipofectamine 2000 (Invitrogen, USA) was used to cotransfect miR-129-5p mimics or the miR-NC and wild-type or mutant plasmids into cells. Transfected cells were harvested after 48 h and then analyzed using a Dual-Luciferase Reporter Assay System (Promega, USA).

2.5 Wound healing assay

A375 cells were transfected with miR-129-5p mimic, mimic NC, pcDNA3.1-lncRNA-AC130710, pcDNA3.1 NC, lncRNA-AC130710 siRNA or siRNA NC for 48 h, respectively. Then, these cells were seeded into six-well plates at a density of 3.5 × 105 cells per well at 37°C. A 10 μL pipette tip was used to make a straight scratch. The culture medium was discarded, and the cells were washed three times in PBS. Then, serum-free medium was added. An Olympus IX71 microscope was used to take images at 0, 24 and 48 h after scratching, and then the migration distances of the cells were calculated. Scratch width was subtracted from time 0 scratch widths at the same location to determine cell migration distance. Migration distances were averaged to determine overall migration.

2.6 Invasion assays

Cell invasive capacity was assessed by using a transwell chamber. Matrigel was diluted ten times with serum-free medium, and 50 µL was added to each transwell chamber, followed by incubation at 37°C for 30 min. Transfected cells were harvested and suspended in serum-free DMEM. Then, 300 μL of cell suspension (2 × 104/mL cells) was placed into the upper chamber, and 600 μL medium containing 10% FBS was added to the lower chamber. Cells were cultured at 37°C for 24 h. After 24 h, cells on the upper surface were removed with a cotton swab, while the invasive cells in the lower chamber were fixed with 4% paraformaldehyde and stained with crystal violet. The stained cells were counted in three randomly selected visual fields per well under an Olympus IX71 microscope.

2.7 Colony formation assay

Transfected cells were seeded into six-well plates at a density of 200 cells/well and cultured at 5% CO2 and 37°C for 2 weeks. Cells were washed with PBS, fixed with 4% paraformaldehyde for 10 min and stained with crystal violet. The colony number was then determined with an Olympus IX71 microscope. The assays were independently repeated three times.

2.8 Western blot analyses

Total cellular protein was quantified using a BCA protein assay kit (Thermo Fisher Scientific). Equal amounts of protein were separated by 12% SDS‒PAGE and transferred to a polyvinylidene fluoride membrane (Hybond, CA). The membranes were blocked and then incubated overnight at 4°C with antibodies against mGluR1, PKCα, MAPK42/44, p-MAPK42/44 and GAPDH (1:1,000, ABclonal). The membranes were incubated with secondary antibodies conjugated to horseradish peroxidase (1:5,000; Beyotime Biotechnology, China) at room temperature for 2 h. Protein bands were detected using an efficient enhanced chemiluminescence (ECL) kit (GE Healthcare, UK) and quantitated using Quantity One software (Bio-Rad Laboratories, UK). Band intensities were normalized to that of GAPDH.

2.9 Statistical analysis

All data are expressed as the mean ± standard deviation. Statistical analysis was carried out using SPSS 13.0. Comparisons among multiple groups were conducted using one-way analysis of variance; p < 0.05 was considered to indicate a statistically significant difference.

3 Results

3.1 Upregulated miR-129-5p suppresses mGluR1 expression in melanoma

mGluR1 is a metabotropic glutamate receptor, and mGluR1 expression in mouse melanocytes was determined to be sufficient to induce melanoma. Consistent with a previous study, our results showed that the expression of mGluR1 was significantly increased in A375 cells compared with the human primary melanocyte cell line (Figure 1a).

Figure 1 miR-129-5p directly target with mGluR1 in A375. (a) Relative mRNA expression of mGluR1 in A375 cells compared with human primary melanocytes cell line. (b) Relative mRNA expression of miR-129-5p in A375 cells compared with human primary melanocytes cell line. (c) Predicted complementary binding site of miR-129-5p in mGluR1 3′-UTR. (d) Relative luciferase activities were inhibited transfected with the reporter vector WT mGluR1, not with the reporter vector Mut mGluR1. (e) Relative mRNA expression of mGluR1 detected by qPCR in A375 cells were inhibited transfected with miR-129-5p mimic. (f) Relative expression of mGluR1 detected by Western blot in A375 cells were inhibited transfected with miR-129-5p mimic. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
Figure 1

miR-129-5p directly target with mGluR1 in A375. (a) Relative mRNA expression of mGluR1 in A375 cells compared with human primary melanocytes cell line. (b) Relative mRNA expression of miR-129-5p in A375 cells compared with human primary melanocytes cell line. (c) Predicted complementary binding site of miR-129-5p in mGluR1 3′-UTR. (d) Relative luciferase activities were inhibited transfected with the reporter vector WT mGluR1, not with the reporter vector Mut mGluR1. (e) Relative mRNA expression of mGluR1 detected by qPCR in A375 cells were inhibited transfected with miR-129-5p mimic. (f) Relative expression of mGluR1 detected by Western blot in A375 cells were inhibited transfected with miR-129-5p mimic. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).

Our previous study found that the level of miR-129-5p was obviously decreased in A375 cells compared with the human primary melanocyte cell line (Figure 1b), and we also found a targeting relationship between miR-129-5p and mGluR1. We used miRanda (www.microrna.org) and RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/) to predict the putative complementary binding sites of miR-129-5p and mGluR1 (Figure 1c).

Furthermore, we wanted to determine whether miR-129-5p directly targets mGluR1 using a luciferase reporter assay. As shown in Figure 1d, overexpression of miR-129-5p decreased the luciferase activity of the wild-type mGluR1 3′-UTR reporter in 293T cells. However, miR-129-5p mimics did not influence the luciferase activity of the reporter carrying the mutated mGluR1 3′-UTR.

Moreover, the addition of miR-129-5p resulted in significantly downregulated expression of mGluR1 in both the qPCR and Western blot results (Figure 1e and f).

3.2 Overexpression of miR-129-5p affects cell migration, cell invasion and colony formation in melanoma

We examined the effect of miR-129-5p on cell migration, cell invasion and colony formation in A375 cells (Figure 2). The results of the scratch assay showed that the relative migration distance was 5.32% at 24 h and 11.82% at 48 h in cells transfected with the miR-129-5p mimic, and the relative migration distance was 13.9% at 24 h and 30.11% at 48 h in control cells (Figure 2a). Overexpression of miR-129-5p significantly inhibited A375 cell migration by 61.72% at 24 h and 60.74% at 48 h compared with the control.

Figure 2 Effects of miR-129-5p overexpression on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with miR-129-5p. (b) Cell invasion was investigated in A375 cells transfected with miR-129-5p. (c) Colony formation of A375 cells transfected with miR-129-5p. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
Figure 2

Effects of miR-129-5p overexpression on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with miR-129-5p. (b) Cell invasion was investigated in A375 cells transfected with miR-129-5p. (c) Colony formation of A375 cells transfected with miR-129-5p. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).

We also examined the effect of miR-129-5p expression on the invasion of A375 cells (Figure 2b). The results of the invasion assay showed that overexpressed miR-129-5p inhibited A375 cell invasion by 70.29%, which showed obvious inhibition of melanoma cell invasion.

The effect of miR-129-5p on the proliferation capacity of tumor cells was also examined with the colony formation assay. When plated at a density of 200 cells/well, miR-129-5p mimic-transfected cells generated a lower rate of colony formation (15.83%) than control cells (45.67%) (Figure 2c). Overexpression of miR-129-5p significantly inhibited cell migration, cell invasion and colony formation in melanoma.

3.3 lncRNA-AC130710 increases in melanoma and inhibits miR-129-5p expression

Previous research has determined that lncRNA-AC130710 directly targets and suppresses miR-129-5p in gastric cancer. Here, we wanted to verify whether there is a relationship between lncRNA-AC130710 and miR-129-5p in melanoma. First, we determined the level of lncRNA-AC130710 in A375 cells and the human primary melanocyte cell line. We found that the level of lncRNA-AC130710 was significantly increased in A375 cells compared with the human primary melanocyte cell line (Figure 3a). We used miRanda and RNAhybrid to predict the putative complementary binding sites of lncRNA-AC130710 and miR-129-5p (Figure 3b).

Figure 3 lncRNA-AC130710 directly target with miR-129-5p in A375. (a) Relative expression of lncRNA-AC130710 in A375 cells compared with human primary melanocytes cell line. (b) Predicted complementary binding site of miR-129-5p in lncRNA-AC130710. (c) Relative luciferase activities were inhibited transfected with the reporter vector WT lncRNA-AC130710, not with the reporter vector Mut lncRNA-AC130710. (d) Construction of pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (e) Relative expression of miR-129-5p in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (f) Relative expression of lncRNA-AC130710 in A375 cells transfected with NC mimic and miR-129-5p mimic vectors. (g) Relative expression of mGluR1 in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (h) Relative expression of mGluR1 in A375 cells when modulation of miR-129-5p or lncRNA-AC130710 expression. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
Figure 3

lncRNA-AC130710 directly target with miR-129-5p in A375. (a) Relative expression of lncRNA-AC130710 in A375 cells compared with human primary melanocytes cell line. (b) Predicted complementary binding site of miR-129-5p in lncRNA-AC130710. (c) Relative luciferase activities were inhibited transfected with the reporter vector WT lncRNA-AC130710, not with the reporter vector Mut lncRNA-AC130710. (d) Construction of pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (e) Relative expression of miR-129-5p in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (f) Relative expression of lncRNA-AC130710 in A375 cells transfected with NC mimic and miR-129-5p mimic vectors. (g) Relative expression of mGluR1 in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (h) Relative expression of mGluR1 in A375 cells when modulation of miR-129-5p or lncRNA-AC130710 expression. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).

We further determined whether lncRNA-AC130710 targets miR-129-5p using a luciferase reporter assay. As shown in Figure 3c, overexpression of miR-129-5p decreased the luciferase activity of the wild-type lncRNA-AC130710 3′-UTR reporter in 293T cells. However, miR-129-5p mimics did not influence the luciferase activity of the reporter carrying the mutated lncRNA-AC130710 3′-UTR.

We also constructed lncRNA-AC130710 overexpression plasmids (pcDNA3.1-lncRNA-AC130710) and interference plasmids (lncRNA-AC130710 siRNA) (Figure 3d). The results showed that transfection of pcDNA3.1-lncRNA-AC130710 significantly reduced the level of miR-129-5p; in contrast, transfection of lncRNA-AC130710 siRNA obviously increased the level of miR-129-5p in A375 cells (Figure 3e). We also investigated whether miR-129-5p affected the levels of lncRNA-AC130710. We found that transfection of the miR-129-5p mimic significantly decreased the level of lncRNA-AC130710, indicating that miR-129-5p affected the levels of lncRNA-AC130710 (Figure 3f).

Moreover, modulation of lncRNA-AC130710 expression affected the level of mGluR1 mRNA. As shown in Figure 3g, transfection of pcDNA3.1-lncRNA-AC130710 significantly increased the expression of mGluR1, and lncRNA-AC130710 siRNA obviously decreased the expression of mGluR1 in A375 cells. Subsequently, we investigated the effect of the interaction between lncRNA-AC130710 and miR-129-5p on mGluR1 expression. When cells were transfected with miR-129-5p RNAi, the expression of mGluR1 was increased. Conversely, when cells were transfected with lncRNA-AC130710 RNAi, the expression of mGluR1 was decreased. However, when the levels of lncRNA-AC130710 and miR-129-5p were decreased or both increased, the effect on the expression level of mGluR1 was reversed, i.e., the expression level was almost the same as that in the control group. This indicated that the regulation between lncRNA-AC130710 and mGluR1 might be dependent on miR-129-5p (Figure 3h).

3.4 Modulation of lncRNA-AC130710 expression affects cell migration, cell invasion and colony formation in melanoma

We examined the effect of lncRNA-AC130710 on cell migration, cell invasion and colony formation in A375 cells (Figure 4). The results of the scratch assay showed that the relative migration distance was 26.29% at 24 h and 48.78% at 48 h in cells transfected with pcDNA3.1-lncRNA-AC130710; however, the relative migration distance was 4.75% at 24 h and 12.66% at 48 h in cells transfected with lncRNA-AC130710 siRNA. The relative migration distance was 8.89% at 24 h and 28.86% at 48 h in control cells (Figure 4a). Overexpression of lncRNA-AC130710 significantly promoted A375 cell migration by 66.15% at 24 h and 44.93% at 48 h compared with the control. Inhibition of lncRNA-AC130710 significantly inhibited A375 cell invasion by 46.64% at 24 h and 52.88% at 48 h compared with the control.

Figure 4 Effects of lncRNA-AC130710 on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (b) Cell invasion was investigated in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (c) Colony formation of A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
Figure 4

Effects of lncRNA-AC130710 on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (b) Cell invasion was investigated in A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. (c) Colony formation of A375 cells transfected with pcDNA3.1-lncRNA-AC130710 and lncRNA-AC130710 siRNA vectors. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).

We also examined the effect of lncRNA-AC130710 expression on the invasion of A375 cells (Figure 4b). The results of the invasion assay show that overexpressed lncRNA-AC130710 promotes A375 cell invasion by 80.0%; however, suppressed lncRNA-AC130710 expression inhibits cell invasion by 59.61%.

The effect of lncRNA-AC130710 on the proliferation capacity of tumor cells was also examined with the colony formation assay. pcDNA3.1-lncRNA-AC130710-transfected cells generated a higher rate of colony formation (77.17%) than control cells (50.17%); however, lncRNA-AC130710 siRNA-transfected cells generated a lower rate of colony formation (29.17%) than control cells (Figure 4c).

Overexpression of lncRNA-AC130710 significantly promoted cell invasion, cell migration and colony formation in melanoma, while decreasing lncRNA-AC130710 expression obviously suppressed cell invasion, cell migration and colony formation.

Furthermore, we wanted to investigate whether the effects of lncRNA-AC130710 expression on cell invasion, cell migration and colony formation depend on mGluR1 levels. We constructed mGluR1 overexpression plasmids (pcDNA3.1-mGluR1) and transfected pcDNA3.1-mGluR1 and lncRNA-AC130710 RNAi into A375 cells. We found that even when mGluR1 was overexpressed, cell invasion, cell migration and colony formation in melanoma were also repressed when lncRNA-AC130710 expression was suppressed in cells (Figure 5a–c).

Figure 5 Effects of modulating lncRNA-AC130710 and mGluR1 expression on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. (b) Cell invasion was investigated in A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. (c) Colony formation of A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01).
Figure 5

Effects of modulating lncRNA-AC130710 and mGluR1 expression on the migration, invasion and clonal formation of A375 cells. (a) Cell migration was investigated by wound healing scratch assay in A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. (b) Cell invasion was investigated in A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. (c) Colony formation of A375 cells transfected with pcDNA3.1-mGluR1 and lncRNA-AC130710 siRNA vectors. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01).

3.5 Expression of miR-129-5p by downregulated lncRNA-AC130710 inactivates the PKCα-MAPK signaling pathway

We tested the activation of the PKCα-MAPK pathway to explore the potential underlying mechanisms of the lncRNA-AC130710/miR-129-5p/mGluR1 axis in A375 cells. The results showed that the expression of PKCα and p-MAPK was decreased in miR-129-5p mimic-transfected cells compared with NC mimic-transfected cells (Figure 6a).

Figure 6 Effect of miR-129-5p and lncRNA-AC130710 on PKCα-MAPK signal pathway. (a) Effect of miR-129-5p overexpression on PKCα-MAPK signal pathway in A375 cells. (b) Effect of lncRNA-AC130710 overexpression and lncRNA-AC130710 silencing on PKCα-MAPK signal pathway in A375 cells. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).
Figure 6

Effect of miR-129-5p and lncRNA-AC130710 on PKCα-MAPK signal pathway. (a) Effect of miR-129-5p overexpression on PKCα-MAPK signal pathway in A375 cells. (b) Effect of lncRNA-AC130710 overexpression and lncRNA-AC130710 silencing on PKCα-MAPK signal pathway in A375 cells. Data are presented as means ± SD (n = 3; *p < 0.05, **p < 0.01, ***p < 0.001).

Moreover, transfection with pcDNA3.1-lncRNA-AC130710 increased the expression of PKCα and p-MAPK in A375 cells, and transfection with lncRNA-AC130710 siRNA decreased the levels of PKCα and p-MAPK (Figure 6b).

The results indicated that overexpression of miR-129-5p inactivated the PKCα-MAPK pathway. Expression of lncRNA-AC130710 suppressed the regulatory role of miR-129-5p, thereby inactivating the PKCα-MAPK pathway and further promoting cell invasion, cell migration and colony formation in melanoma.

4 Discussion

In our study, we found that miR-129-5p suppressed invasion and migration of melanoma cancer cells through targeting mGluR1 transcripts. By suppressing miR-129-5p, lncRNA-AC130710 was capable of promoting metastasis, which was associated with the activation of PKCa-MAPK signal pathway.

In recent years, the glutamate signaling pathway has been reported to be related to tumorigenesis [17]. Glutamate receptors constitute two main groups. One group is comprised of ionotropic receptors, which form ion channels, and the opening and closing of these channels are regulated by glutamate. Methyl-d-aspartate receptor (NMDAR) is a subtype with strong voltage dependence and high Ca2+ permeability. The other type is mGluRs, which belongs to the superfamily of G-protein coupled receptors [18]. mGluR1 is a metabotropic glutamate receptor. Lee et al. demonstrated that the expression of mGluR1 in mouse melanocytes was sufficient to induce melanoma [19]. Blocking the activity of GluR1 with an antagonist has been shown to significantly inhibit the invasion and motility of melanoma cells [20]. Previous studies and our results have shown that the expression of mGluR1 is obviously upregulated in melanoma cells [20]. Inhibition of mGluR1 expression can suppress the development of melanoma, including proliferation, cell invasion and cell migration.

Furthermore, we found that miR-129-5p directly targeted and regulated mGluR1. Our results show that miR-129-5p was significantly reduced in melanoma. In addition, the dual luciferase assay verified that miR-129-5p targets mGluR1 and inhibits the expression of mGluR1. Overexpression of miR-129-5p inhibited tumor cell characteristics such as cell migration, cell invasion and clonal formation. Our results demonstrated that inhibiting melanoma can be achieved by regulating miR-129-5p.

LncRNAs function as miRNA sponges to suppress miRNA targeting of mRNAs and the degradation mediated by miRNAs [21,22]. For example, Chen et al. determined that lncRNA FOXD3-AS1 promotes proliferation, invasion and migration of cutaneous malignant melanoma by regulating the miR-325/MAP3K2 axis [23]. Wu et al. indicated that lncRNA MEG3 might inhibit the tumor growth, tumor metastasis and formation of melanoma by modulating the miR-21/E-cadherin axis [24]. Although many studies have described multiple lncRNAs related to melanoma, the involvement of lncRNAs in melanoma tumorigenesis and progression has not been fully studied [25]. A previous study showed that lncRNA-AC130710 directly targets and suppresses miR-129-5p in gastric cancer [16]. LncRNAs target miRNAs through their own miRNA reaction elements at binding sites, further suppressing miRNA targeting of mRNAs and the degradation mediated by miRNAs [26]. In our study, we found that lncRNA-AC130710 has the complementary binding sites miR129-5p, and the dual luciferase experiment also confirmed their relationship. Furthermore, the expression of lnRNA-AC130710 was determined to be significantly increased in melanoma cells. Overexpression of lncRNA-AC130710 reduced the level of miR-129-5p, while downregulation of lncRNA-AC130710 increased the level of miR-129-5p. This result indicated that there is indeed an interactive relationship between them. We also found that overexpression of miR-129-5p significantly decreased the level of lncRNA-AC130710, indicating that miR-129-5p also affected the levels of lncRNA-AC130710. Furthermore, overexpression of lncRNA-AC130710 upregulated mGluR1, while downregulation of lncRNA-AC130710 induced a reduction in mGluR1 expression, demonstrating that the expression of lncRNA-AC130710 suppressed miR-129-5p, a tentative negative regulator of mGluR1 transcripts, and promoted mGluR1 expression increases in melanoma. The regulation between lncRNA-AC130710 and mGluR1 might be dependent on miR-129-5p.

We also demonstrated the effects of modulation of lncRNA-AC130710 expression on cell invasion, cell migration and colony formation in melanoma. We found that overexpression of lncRNA-AC130710 significantly promotes cell invasion, cell migration and colony formation in melanoma, while decreasing lncRNA-AC130710 expression obviously suppresses cell invasion, cell migration and colony formation. Expression of lncRNA-AC130710 suppressed miR-129-5p, a tentative negative regulator of mGluR1 transcripts, which was sufficient to inhibit cell invasion, migration and colony formation in melanoma.

Even after overexpression of mGluR1, cell invasion, cell migration and colony formation in melanoma were also repressed when lncRNA-AC130710 expression was suppressed in cells. These results further demonstrate that miR-129-5p suppressed the migration and invasion of A375 cells by decreasing the expression of mGluR1. However, lncRNA-AC130710 promoted the level of mGluR1 mRNA and the migration and invasion of cells by negatively regulating miR-129-5p.

Activation of NMDAR and mGluR leads to an increase in the activities of PKCα [27]. Inhibiting the expression of mGluR induced the decreased expression or activity of PKCα. The MAPK cascade is considered to be one of the main signaling pathways activated by PKCα [28]. Activation of the MAPK cascade plays a crucial role in many signaling pathways related to cell proliferation. Inhibition of the MAPK cascade can suppress the cell migration and invasion of tumor cells. Our results showed that the expression of lncRNA-AC130710 promoted PKCα activity and MAPK phosphorylation by suppressing miR-129-5p in melanoma, while the downregulation of lncRNA-AC130710 increased miR-129-5p expression and reduced PKCα expression and MAPK phosphorylation. Our study demonstrated that lncRNA-AC130710 promotes cell migration and invasion by suppressing miR-129-5p, which is associated with the activation of the PKCα-MAPK signaling pathway.

5 Conclusion

Taken together, our study showed that the lncRNA-AC130710/miR-129-5p/mGluR1 axis plays an important role in the invasion and metastasis of melanoma cell lines.

# These authors contribute equally to this work.

tel: +8618777190925

Acknowledgments

Not applicable.

  1. Funding information: This work was supported by funding from Guangxi Natural Science Foundation (No. 2019GXNSFBA185018), Self-Funded Scientific Research Project of Guangxi Zhuang Autonomous Region Health Committee (No. Z20210931) and National Natural Science Foundation of China (No. 81960562).

  2. Author contributions: L.L.L. conceived and wrote the article. X.Z., W.C., L.L. and L.L.L. reviewed and edited the manuscript. All authors participated in literature search, data collection and figure design. All authors read and approved the manuscript.

  3. Conflict of interest: The authors declare that they have no conflict of interest.

  4. Data availability statement: The dataset generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] MacKie RM, Hauschild A, Eggermont AM. Epidemiology of invasive cutaneous melanoma. Ann Oncol. 2009;20(Suppl 6):vi1–7.10.1093/annonc/mdp252Suche in Google Scholar PubMed PubMed Central

[2] Rastrelli M, Tropea S, Rossi CR, Alaibac M. Melanoma: epidemiology, risk factors, pathogenesis, diagnosis and classification. In Vivo. 2014;28(6):1005–11.Suche in Google Scholar

[3] Aladowicz E, Ferro L, Vitali GC, Venditti E, Fornasari L, Lanfrancone L. Molecular networks in melanoma invasion and metastasis. Future Oncol. 2013;9(5):713–26.10.2217/fon.13.9Suche in Google Scholar PubMed

[4] Liu Y, Ao X, Zhou X, Du C, Kuang S. The regulation of PBXs and their emerging role in cancer. J Cell Mol Med. 2022;26(5):1363–79.10.1111/jcmm.17196Suche in Google Scholar PubMed PubMed Central

[5] Namkoong J, Shin SS, Lee HJ, Marin YE, Wall BA, Goydos JS, et al. Metabotropic glutamate receptor 1 and glutamate signaling in human melanoma. Cancer Res. 2007;67(5):2298–305.10.1158/0008-5472.CAN-06-3665Suche in Google Scholar PubMed

[6] Lee HJ, Wall BA, Wangari-Talbot J, Shin SS, Rosenberg S, Chan JL, et al. Glutamatergic pathway targeting in melanoma: single-agent and combinatorial therapies. Clin Cancer Res. 2011;17(22):7080–92.10.1158/1078-0432.CCR-11-0098Suche in Google Scholar PubMed PubMed Central

[7] Chen LL. Linking long noncoding RNA localization and function. Trends Biochem Sci. 2016;41(9):761–72.10.1016/j.tibs.2016.07.003Suche in Google Scholar PubMed

[8] Liu Y, Ao X, Yu W, Zhang Y, Wang J. Biogenesis, functions, and clinical implications of circular RNAs in non-small cell lung cancer. Molecular therapy. Nucleic Acids. 2022;27:50–72.10.1016/j.omtn.2021.11.013Suche in Google Scholar PubMed PubMed Central

[9] Zhang Y, Zhao Y, Liu Y, Wang M, Yu W, Zhang L. Exploring the regulatory roles of circular RNAs in Alzheimer’s disease. Transl Neurodegener. 2020;9(1):35.10.1186/s40035-020-00216-zSuche in Google Scholar PubMed PubMed Central

[10] Guil S, Esteller M. RNA–RNA interactions in gene regulation: the coding and noncoding players. Trends Biochem Sci. 2015;40(5):248–56.10.1016/j.tibs.2015.03.001Suche in Google Scholar PubMed

[11] Hombach S, Kretz M. Non-coding RNAs: classification, biology and functioning. Adv Exp Med Biol. 2016;937:3–17.10.1007/978-3-319-42059-2_1Suche in Google Scholar PubMed

[12] Wei Y, Sun Q, Zhao L, Wu J, Chen X, Wang Y, et al. LncRNA UCA1-miR-507-FOXM1 axis is involved in cell proliferation, invasion and G0/G1 cell cycle arrest in melanoma. Med Oncol. 2016;33(8):88.10.1007/s12032-016-0804-2Suche in Google Scholar PubMed

[13] Sun Y, Cheng H, Wang G, Yu G, Zhang D, Wang Y, et al. Deregulation of miR-183 promotes melanoma development via lncRNA MALAT1 regulation and ITGB1 signal activation. Oncotarget. 2017;8(2):3509–18.10.18632/oncotarget.13862Suche in Google Scholar PubMed PubMed Central

[14] Wang LX, Wan C, Dong ZB, Wang BH, Liu HY, Li Y. Integrative analysis of long noncoding RNA (lncRNA), microRNA (miRNA) and mRNA expression and construction of a competing endogenous RNA (ceRNA) network in metastatic melanoma. Med Sci Monitor Int Med J Exp Clin Res. 2019;25:2896–907.10.12659/MSM.913881Suche in Google Scholar PubMed PubMed Central

[15] Yu X, Zheng H, Tse G, Chan MT, Wu WK. Long non-coding RNAs in melanoma. Cell Prolif. 2018;51(4):e12457.10.1111/cpr.12457Suche in Google Scholar PubMed PubMed Central

[16] Xu C, Shao Y, Xia T, Yang Y, Dai J, Luo L, et al. lncRNA-AC130710 targeting by miR-129-5p is upregulated in gastric cancer and associates with poor prognosis. Tumour Biol. 2014;35(10):9701–6.10.1007/s13277-014-2274-5Suche in Google Scholar PubMed

[17] Pei Z, Lee KC, Khan A, Erisnor G, Wang HY. Pathway analysis of glutamate-mediated, calcium-related signaling in glioma progression. Biochem Pharmacol. 2020;176:113814.10.1016/j.bcp.2020.113814Suche in Google Scholar PubMed PubMed Central

[18] Stepulak A, Rola R, Polberg K, Ikonomidou C. Glutamate and its receptors in cancer. J Neural Transm. 2014;121(8):933–44.10.1007/s00702-014-1182-6Suche in Google Scholar PubMed PubMed Central

[19] Lee HJ, Wall BA, Wangari-Talbot J, Chen S. Regulation of mGluR1 expression in human melanocytes and melanoma cells. Biochim Biophys Acta. 2012;1819(11–12):1123–31.10.1016/j.bbagrm.2012.06.005Suche in Google Scholar PubMed PubMed Central

[20] Song Z, He CD, Liu J, Sun C, Lu P, Li L, et al. Blocking glutamate-mediated signalling inhibits human melanoma growth and migration. Exp Dermatol. 2012;21(12):926–31.10.1111/exd.12048Suche in Google Scholar PubMed

[21] Zhang Y, Zhang L, Wang Y, Ding H, Xue S, Qi H, et al. MicroRNAs or long noncoding RNAs in diagnosis and prognosis of coronary artery disease. Aging Dis. 2019;10(2):353–66.10.14336/AD.2018.0617Suche in Google Scholar PubMed PubMed Central

[22] Zhang Y, Zhao Y, Ao X, Yu W, Zhang L, Wang Y, et al. The role of non-coding RNAs in Alzheimer’s disease: from regulated mechanism to therapeutic targets and diagnostic biomarkers. Front Aging Neurosci. 2021;13:654978.10.3389/fnagi.2021.654978Suche in Google Scholar PubMed PubMed Central

[23] Chen X, Gao J, Yu Y, Zhao Z, Pan Y. LncRNA FOXD3-AS1 promotes proliferation, invasion and migration of cutaneous malignant melanoma via regulating miR-325/MAP3K2. Biomed Pharmacother = Biomed Pharmacother. 2019;120:109438.10.1016/j.biopha.2019.109438Suche in Google Scholar PubMed

[24] Wu L, Zhu L, Li Y, Zheng Z, Lin X, Yang C. LncRNA MEG3 promotes melanoma growth, metastasis and formation through modulating miR-21/E-cadherin axis. Cancer Cell Int. 2020;20:12.10.1186/s12935-019-1087-4Suche in Google Scholar PubMed PubMed Central

[25] Li R, Zhang L, Jia L, Duan Y, Li Y, Bao L, et al. Long non-coding RNA BANCR promotes proliferation in malignant melanoma by regulating MAPK pathway activation. PLoS One. 2014;9(6):e100893.10.1371/journal.pone.0100893Suche in Google Scholar PubMed PubMed Central

[26] Liu Y, Ao X, Wang Y, Li X, Wang J. Long non-coding RNA in gastric cancer: mechanisms and clinical implications for drug resistance. Front Oncol. 2022;12:841411.10.3389/fonc.2022.841411Suche in Google Scholar PubMed PubMed Central

[27] Moriguchi S, Han F, Shioda N, Yamamoto Y, Nakajima T, Nakagawasai O, et al. Nefiracetam activation of CaM kinase II and protein kinase C mediated by NMDA and metabotropic glutamate receptors in olfactory bulbectomized mice. J Neurochem. 2009;110(1):170–81.10.1111/j.1471-4159.2009.06122.xSuche in Google Scholar PubMed

[28] Anfuso CD, Giurdanella G, Motta C, Muriana S, Lupo G, Ragusa N, et al. PKCalpha-MAPK/ERK-phospholipase A2 signaling is required for human melanoma-enhanced brain endothelial cell proliferation and motility. Microvasc Res. 2009;78(3):338–57.10.1016/j.mvr.2009.09.001Suche in Google Scholar PubMed

Received: 2022-04-14
Revised: 2022-09-22
Accepted: 2022-10-01
Published Online: 2022-10-18

© 2022 Zhi Xie et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0587
Schlagwörter für diesen Artikel
melanoma; lncRNA; mGluR1; migration; invasion
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 18.11.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0587/html
Button zum nach oben scrollen