Startseite LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
Artikel Open Access

LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis

  • Tiejun Ren EMAIL logo , Dingyi Wang , Jinjin Gu und Xiaozhen Hou
Veröffentlicht/Copyright: 14. Oktober 2022
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 17 Heft 1

Abstract

Esophageal squamous cell carcinoma (ESCC) is an aggressive malignant tumor with a poor prognosis. The dysregulation of long non-coding RNAs (lncRNAs) is closely related to the tumorigenesis and progression of ESCC. However, the effects of lncRNA small nucleolar RNA host gene 3 (lncRNA SNHG3) in ESCC are still unclear. Therefore, a series of experiments methods, such as quantitative real-time polymerase chain reaction, function gain/loss experiments, western blots, and animal xenograft tumor model, were employed to explore the biological function and molecular mechanism of SNHG3 in ESCC. As results, we first reported that SNHG3 was significantly up-regulated in ESCC tissues and cells. SNHG3 knockdown obviously inhibited cell proliferation, migration, invasion, and promoted apoptosis. Mechanism analysis revealed that SNHG3 sponged miR-151a-3p to regulate PFN2. Inhibition of miR-151a-3p and overexpression of PFN2 attenuated the positive effect of SNHG3 knockdown on suppressing tumor progression. Furthermore, the anti-tumor effects of SNHG3 knockdown were also observed in vivo. In summary, our results indicated that SNHG3 knockdown suppressed tumor development via the miR-151a-3p/PFN2 axis, and targeting SNHG3 may provide a new opportunity for ESCC patients.

Keywords: esophageal squamous cell carcinoma; lncRNA SNHG3; miR-151a-3p; PFN2

1 Introduction

According to GLOBOCAN 2018 statistics, there were approximately 18.1 million new cancer cases and 9.6 million cancer-related deaths worldwide in 2018. Esophageal cancer (EC) is the seventh most common type of cancer in the world (approximately 572,000 new cases) and the sixth leading cause of cancer-related deaths (approximately 509,000 deaths) [1]. EC mainly includes two histological types: esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC). ESCC mainly occurs in East Asia and Africa, while EAC is more widespread in many developed countries [2]. ESCC is an aggressive malignant tumor, and usually accounts for 80–90% of all EC cases. Chemotherapy, chemoradiation and esophagectomy are the main treatment strategies for ESCC [3,4]. Since most patients are in the advanced stage of the disease at the time of diagnosis, the prognosis is poor. The clinical prospects for ESCC patients remain bleak. The 5-year survival rate in developed countries is less than 20%, while it is less than 5% in many developing countries where account for majority of cases [5]. Therefore, a deeper understanding of the molecular mechanism of ESCC tumorigenesis and development is of great significance for exploring new strategies for the treatment of ESCC.

Long non-coding RNAs (lncRNAs) are a common type of non-coding RNAs, which are more than 200 nucleotides in length [6]. A series of studies suggested that lncRNA plays an important role in a variety of biological processes such as gene expression, chromatin modification, cancer occurrence and development, and their disorders are related to tumor growth, invasion, angiogenesis, metastasis, and chemotherapy resistance [7,8,9]. lncRNA not only directly regulates gene expression but also interacts with microRNA (miRNA) [10]. miRNAs are small non-coding RNAs with a length of 20–24 nucleotides. MiRNA can induce the degradation and translational repression of mRNA by interacting with complementary sequences in the 3′-untranslated region (3′-UTR) of target mRNA [11]. miRNAs are important post-transcriptional regulators implicated in a wide range of biological functions and diseases including cancer. The dysregulation of miRNA expression is closely related to the occurrence, progression, and metastasis of cancer [12,13].

Numerous of lncRNAs are dysregulated in ESCC, some among this may become the potential therapeutic or diagnostic targets and prognostic biomarkers [14]. The small nuclear protein RNA host gene 3 (SNHG3) is a novel type of lncRNA, which is abnormally expressed in a variety of tumors, including lung cancer, liver cancer, and colorectal cancer [15] SNHG3 mainly acts as a competitive endogenous RNA (ceRNA) to target tumor suppressor miRNA and competitively bind with miRNA, thereby regulating tumor biological processes [16]. For example, SNHG3, which was highly expressed in osteosarcoma patients, promoted the invasion and migration of osteosarcoma cells by up-regulating the expression of RAB22A via spongy miRNA-151a-3p [17]. SHNG3 promoted cell proliferation, colony formation, migration, and invasion by acting as the ceRNA of miR-326 in breast cancer [18]. Although the carcinogenic effects of SNHG3 have made progress in a series of cancer research, its function and regulation mechanism in ESCC are still unclear and need to be further explored.

In this study, we aimed to study the biological function and molecular mechanism of SNHG3 in ESCC. We found that SNHG3 was highly expressed in ESCC tissues and cells. In addition, SNHG3 knockdown inhibited the cell progression of ESCC both in vitro and in vivo. Mechanism research cleared that SNHG3 regulated the expression of PFN2 by targeting miR-151a-3p. These suggested that SNHG3 regulated the proliferation, apoptosis, invasion, and migration of ESCC cells by the miR-151a-3p/PFN2 axis.

2 Materials and methods

2.1 Samples

A total of 37 paired tumors and matched adjacent normal tissue specimens were collected from ESCC patients who had not received anti-tumor treatment in our hospital. The tissues were frozen in liquid nitrogen and stored at −80°C. This study had applied for the exemption of informed consent. This study was approved by the Ethics Committee of the Luoyang Central Hospital affiliated to Zhengzhou University (LWLL-2019-10-28).

2.2 Cell culture

Human normal esophageal epithelial cell line (HEEC) and ESCC cell lines (TE-1 and KYSE-150) were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). All cell lines were cultured with Roswell Park Memorial Institute-1640 medium (RPMI-1640, Hyclone) containing 10% FBS (Gibco, Rockville, MD, USA) and 1% penicillin + streptomycin (Sigma-Aldrich, St Louis, MO, USA) in a 37°C with 5% CO2 constant-temperature incubator.

2.3 Cell transfection

SNHG3-targeted siRNA and shRNA (si-SNHG3 and sh-SNHG3), miR-151a-3p mimic (miR-151a-3p), miR-151a-3p inhibitor (anti-miR-151a-3p), SNHG3-overexpressed plasmid (pcDNA-SNHG3), PFN2-overexpressed plasmid (pcDNA-PFN2), and counterpart controls (si-NC, sh-NC, anti-NC, miR-NC, pcDNA-NC) were obtained from GenePharm (Shanghai, China). ESCC cells were added into a six-well plate with a density of 5 × 105/well. According to the manufacturer’s instructions, lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was performed to transfect cells with oligonucleotide sequences and/or plasmids when the cells reached 70–80% growth confluence. After 48 h of transfection, the transfected cells were collected for subsequent experiments. Quantitative real-time polymerase chain reaction (qRT-PCR) was applied to evaluate transfection efficiency. The targeting sequences for transfection are listed in Table A1.

2.4 qRT-PCR

TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was employed to extract total RNA from ESCC tissues or cells. According to the instructions, RNA was reverse transcribed to cDNA using Prime Script RT Reagent Kit (Takara, Tokyo, Japan). qRT-PCR was performed on the ABI 7500 real-time PCR system (Bio-Rad, Hercules, CA, USA) using VeriQuest Fast SYBR Green qPCR Master Mix (Thermo Fisher Scientific, USA). GAPDH and U6 were used as internal controls for mRNA and miRNA, respectively. The relative expression levels of SNHG3, miR-151a-3p, and PFN2 were calculated by the 2−ΔΔCt method. All experiments were performed three times. The primer sequences are listed in Table 1.

Table 1

The primer sequences used for RT-qPCR

Gene Primer sequence (5′–3′)
SNHG3 F:AAGCTGCCCTAGTGAACTGTAGGAAG
R:TAGTGAGGAATTGGAGTAACCGACA
miR-151a-3p F:ATAAGATCTGGCTGCAACCCGTGTTC
R:ATAGTCGACCTCAGTGGAGCATTCC
PFN2 F:CACAATGGACATCCGGACAA
R:TTCAGAGCATTACGCCAATA
GAPDH F:AATCCCATCACCATCTTCCA
R:TGGACTCCACGACGTACTCA
U6 F:CTCGCTTCGGCAGCACA
R:AACGCTTCACGAATTTGCGT

2.5 CCK-8 assay

According to the manufacturer’s protocol, the CCK-8 kit (Dojindo Laboratories, Kumamoto, Japan) was conducted to evaluate the cell proliferation. In short, the transfected cells were seeded into a 96-well plate with a density of 5 × 103 cell per well. At the point of cells cultured for 24, 48, and 72 h, 10 µL of CCK-8 solution was supplemented to each well. Next, the cells were continued to incubate for 4 h, and then, the absorbance values at 450 nm wavelength were measured to draw the cell growth curve.

2.6 Colony formation assay

The transfected cells (1,000 cell per well) were seeded in a six-well plate and cultured continuously for 2 weeks. The culture was terminated when visible cell colonies appeared. The medium was removed and the cells were washed twice with PBS. Then, the cells were fixed with methanol for 30 min and stained with 0.1% crystal violet at room temperature. Finally, an inverted microscope (Olympus Corp) was employed to image and count the colonies.

2.7 Flow cytometry (cell apoptosis)

Annexin V-FITC/PI Apoptosis Detection Kit (BD Pharmingen, San Diego, CA, USA) was performed to analyze cell apoptosis. Transfected cells were collected and resuspended with 1× binding buffer. According to the instructions, the cells were stained with Annexin V-FITC and PI for 15 min under dark conditions. Then, flow cytometry was employed to detect cell apoptosis and calculate the apoptosis rate. The apoptosis rate was the sum of early and late apoptosis.

2.8 Transwell

A 24-well transwell chamber (BD Biosciences, San Jose, CA, USA) pre-coated with or without Matrigel was conducted to measure cell invasion or migration. Concisely, the transfected cells were resuspended in serum-free medium. 200 μL of cell suspension containing 1 × 105 cells was added to the upper chamber. Then, 600 μL of RPMI 1640 medium containing 10% FBS was supplemented in the lower chamber to act as a chemotactic factor. After cells were cultured at 37°C for 48 h, the upper chamber cells were wiped off gently with a cotton swab. The lower chamber cells were fixed with 4% paraformaldehyde for 20 min and then stained with 0.1% crystal violet for 20 min at room temperature. Finally, the cells were washed with PBS and five fields were randomly selected for counting under an inverted microscope.

2.9 Western blot

ESCC tissues or cells were lysed by RIPA cell lysate (Solarbio, Beijing, China) at 4°C for 30 min to extract the total protein. Then, a BCA protein detection kit (Beyotime Biotechnology, Nantong, China) was used to evaluate the protein concentration. Then, the same amounts of proteins were separated by 10% SDS–PAGE and transferred to PVDF membrane (Millipore, Bedford, MA, USA). Next, the membrane was blocked in 5% skim milk for 2 h and incubated with the primary antibody overnight at 4°C. Subsequently, the membrane was washed with TBST buffer solution three times, 5 min each time. The membrane was incubated with HRP-coupled secondary antibody at room temperature for 1 h, and the membrane was washed again with TBST buffer solution three times, each time 5 min. Finally, the blot was visualized with ECL detection kit (Beyotime, Shanghai, China). GAPDH was used as an internal reference. ImageJ software was applied to analyze and quantify the gray value of the target band. The primary antibodies were as follows: anti-PFN2 (1:1,000, ab230673, Abcam), anti-bcl-2 (1:2,000, ab194583, Abcam), anti-cleaved-caspase-3 (1:500, ab2302, Abcam), anti-MMP9 (1:1,000, ab58803, Abcam), and anti-GAPDH (1:2,500, ab9485, Abcam). The secondary antibody was as follows: HRP-conjugated goat anti-rabbit IgG (1:50,000, ab205718, Abcam).

2.10 Dual luciferase reporter assay

The SNHG3 and PFN2 3′-UTR fragments with miR-151a-3p wild-type or mutant-type-binding sites were amplified and inserted into the pmirGLO luciferase vector (Promega, Madison, WI, USA), which named as WT-SNHG3, MUT-SNHG3, WT-PFN2, and MUT-PFN2, respectively. 293T cells were co-transfected with WT/MUT-SNHG3 or WT/MUT-PFN2 plasmid and miR-151a-3p/miR-NC mimic by lipofectamine 2000. After transfection for 48 h, the relative luciferase activity was evaluated using the dual luciferase reporter gene detection system (Promega). The activity of Renilla luciferase was used as normalization.

2.11 Nude mouse tumorigenesis

The animal protocols were approved by the Ethics Committee of Luoyang Central Hospital affiliated to Zhengzhou University (LWLL-2019-10-28) and carried out in strict accordance with the Guide for the Care and Use of Laboratory Animals. Twelve 8–10-week-old female BALB/c nude mice (weight 16–22 g) were purchased from the Animal Research Center of the Chinese Academy of Sciences (Shanghai, China). Nude mice were adaptively fed under SPF conditions for 1 week and then randomly divided into two groups (n = 6): sh-NC group and sh-SNHG3 group. The TE-1 single cell suspension (3 × 106 cells) stably transfected with sh-NC or sh-SNHG3 were injected subcutaneously into the left back of nude mice with a disposable sterile syringe. The tumor growth was monitored every week and the tumor volume was calculated according to the following formula: volume (V) = 0.5 × length (L) × width2 (W 2). After 5 weeks, the mice were euthanized, and tumor tissues were collected and weighed. Finally, the expression levels of SNHG3, miR-151a-3p and PFN2 in tumor tissues were detected by qRT-PCR and western blot methods.

2.12 Statistical analysis

All experiments were repeated at least three times. All the data were represented as mean ± SD (standard deviation). GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA) was used to display the results and performed statistical analysis. Unpaired Student’s t-test or ANOVA was conducted to analyze the differences between two or more groups. P-value less than 0.05 was generally considered to be statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001).

  1. Ethical approval: This study was approved by the Ethics Committee of Luoyang Central Hospital affiliated to Zhengzhou University (LWLL-2019-10-28). And all experiments were conducted in accordance with relevant guidelines and regulations, which consistent with the Declaration of Helsinki regulations.

3 Results

3.1 SNHG3 is obviously enhanced in ESCC tissues and cells

First, the expression of SNHG3 in 37 pairs of tumor tissues and adjacent normal tissues was analyzed by qRT-PCR to verify the abundance of SNHG3 in ESCC. The results showed that the expression of SNHG3 was significantly upregulated in ESCC tissues (Figure 1a). Similarly, we also measured the expression of SNHG3 in HEEC and ESCC cell lines (TE-1 and KYSE-150). We noticed that SNHG3 was obviously increased in ESCC cells (Figure 1b). These results indicated that SNHG3 acted as a tumor-promoting factor in ESCC.

Figure 1 lncRNA SNHG3 was upregulated in ESCC tissues and cells. (a) qRT-PCR assay was used to detect the expression of SNHG3 in ESCC tissues and normal tissues. (b) qRT-PCR assay was performed to examine the expression of SNHG3 in ESCC cells and corresponding normal cells. ***P < 0.001.
Figure 1

lncRNA SNHG3 was upregulated in ESCC tissues and cells. (a) qRT-PCR assay was used to detect the expression of SNHG3 in ESCC tissues and normal tissues. (b) qRT-PCR assay was performed to examine the expression of SNHG3 in ESCC cells and corresponding normal cells. ***P < 0.001.

3.2 SNHG3 knockdown inhibited the progression of ESCC cells

To verify the effects of SNHG3 in ESCC cells, TE-1 and KYSE-150 cells were transfected with si-SNHG3 to knockdown the expression of SNHG3, and si-NC was used as a negative control. First, the transfection efficiency of siRNA was verified by qRT-PCR. The expression of SNHG3 in cells transfected with si-SNHG3 was remarkably reduced (Figure 2a), indicating that SNHG3 was successfully knockdown. Then, CCK-8 and colony formation experiments were performed to measure the cell proliferation. The results suggested that knockdown of SNHG3 significantly decreased the proliferation of TE-1 and KYSE-150 cells (Figure 2b and c). Next, flow cytometry was performed to analyze cell apoptosis. We found that knockdown of SNHG3 obviously promoted the apoptosis of ESCC cells (Figure 2d). Moreover, we conducted a transwell assay to analyze the cell migration and cell invasion. We observed that the migration (Figure 2e) and invasion (Figure 2f) ability of TE-1 and KYSE-150 cells were also notably inhibited after SNHG3 silencing. In addition, western blot was employed to evaluate the expression of apoptosis (bcl-2 and cleaved-caspase-3) and metastasis-related (MMP9) proteins. SNHG3 knockdown obviously suppressed the expression of bcl-2 and MMP9 but enhanced the cleaved-caspase-3 expression (Figure 2g). These results revealed that knockdown of SNHG3 repressed the malignant phenotype of ESCC cells.

Figure 2 lncRNA SNHG3 knockdown inhibited cell proliferation, migration, and metastasis. TE-1 and KYSE-150 cells were transfected with si-SNHG3 or si-NC. (a) The expression of SNHG3 in TE-1 and KYSE-150 cells were examined. (b) CCK-8 assay was performed for cell proliferation. (c) Colony formation assay was employed to analyze cell colony formation ability. (d) Flow cytometry was performed to evaluate cell apoptosis. (e and f) Transwell assay was carried out for cell migration (e) and invasion (f), scale bar = 10 μm. (g) Western blot assay was conducted to analyze the protein levels of bcl-2, cleaved-capsase-3, and MMP9. **P < 0.01, ***P < 0.001.
Figure 2

lncRNA SNHG3 knockdown inhibited cell proliferation, migration, and metastasis. TE-1 and KYSE-150 cells were transfected with si-SNHG3 or si-NC. (a) The expression of SNHG3 in TE-1 and KYSE-150 cells were examined. (b) CCK-8 assay was performed for cell proliferation. (c) Colony formation assay was employed to analyze cell colony formation ability. (d) Flow cytometry was performed to evaluate cell apoptosis. (e and f) Transwell assay was carried out for cell migration (e) and invasion (f), scale bar = 10 μm. (g) Western blot assay was conducted to analyze the protein levels of bcl-2, cleaved-capsase-3, and MMP9. **P < 0.01, ***P < 0.001.

3.3 SNHG3 is the sponge of miR-151a-3p in ESCC cells

It is widely known that lncRNAs prevent the binding of miRNA and target mRNA by acting as a sponge or ceRNA for miRNAs in cells. Therefore, to explore the potential mechanism of SNHG3 in ESCC tumorigenesis, the target miRNA of SNHG3 was predicted by StarBase. We found that SNHG3 and miR-151a-3p have complementary sequences (Figure 3a). Then, we conducted a dual luciferase reporter gene assay to verify the credibility of the binding relationship. The results demonstrated that the overexpression of miR-151a-3p only significantly reduced the luciferase activity in SNHG3-WT-transfected cells (Figure 3b), indicating that SNHG3 directly targeted miR-151a-3p. In addition, compared with normal tissues and cells, miR-151a-3p was clearly decreased in ESCC tissues (Figure 3c) and cells (Figure 3d). Furthermore, knockdown of SNHG3 eminently increased the expression of miR-151a-3p in ESCC cells. On the contrary, overexpression of SNHG3 remarkably inhibited the expression of miR-151a-3p (Figure 3e). Overall, these results cleared that miR-151a-3p was a direct target of SNHG3, and SNHG3 natively regulated the expression of miR-151a-3p.

Figure 3 LncRNA SNHG3 directly targeted miR-151a-3p in ESCC cells. (a) The complementary sequences between SNHG3 and miR-151a-3p were exhibited. (b) The interaction between SNHG3 and miR-151a-3p was estimated by dual luciferase reporter assay. (c and d) The expression of miR-151a-3p in tissues and cells was determined. (e) The expression of miR-151a-3p in cells transfected with si-NC/si-SNHG3 or pcDNA-NC/pcDNA-SNHG3. *P < 0.05, **P < 0.01, ***P < 0.001.
Figure 3

LncRNA SNHG3 directly targeted miR-151a-3p in ESCC cells. (a) The complementary sequences between SNHG3 and miR-151a-3p were exhibited. (b) The interaction between SNHG3 and miR-151a-3p was estimated by dual luciferase reporter assay. (c and d) The expression of miR-151a-3p in tissues and cells was determined. (e) The expression of miR-151a-3p in cells transfected with si-NC/si-SNHG3 or pcDNA-NC/pcDNA-SNHG3. *P < 0.05, **P < 0.01, ***P < 0.001.

3.4 Inhibition of miR-151a-3p partially reverse the anti-tumor effects of SNHG3 knockdown

Next, to investigate whether miR-151a-3p is involved in the regulating mechanism of SNHG3, we introduced miR-151a-3p inhibitors to transfect cells. The transfection efficiency of miR-151a-3p inhibitor was evaluated by qRT-PCR. We observed that the expression of miR-151a-3p was significantly reduced in the cells transfected with anti-miR-151a-3p (Figure 4a). Then, TE-1 and KYSE-150 cells were transfected with si-NC, si-SNHG3, si-SNHG3 + anti-NC, or si-SNHG3 + anti-miR-151a-3p, respectively, and the cell proliferation, apoptosis, migration, and invasion were evaluated. The results of CCK-8 and colony formation showed that suppression of miR-151a-3p attenuated the inhibitory effects of SNHG3 knockdown on cell proliferation (Figure 4b–d). Flow cytometry results illustrated that inhibiting the expression of miR-151a-3p reduced the increase of apoptosis caused by SNHG3 knockdown (Figure 4e). Furthermore, the inhibitory effect of SNHG3 knockdown on the migration and invasion was also weakened due to the suppression of miR-151a-3p expression (Figure 4f and g). Similarly, inhibition of miR-151a-3p also reversed the decrease of bcl-2 and MMP9 and the increase of cleaved-caspase-3 caused by SNHG3 knockdown (Figure 4h and i). Taken together, these results confirmed that SNHG3 inhibited cell progression by targeting miR-151a-3p in ESCC.

Figure 4 Inhibition of miR-151a-3p ameliorated the effects of lncRNA SNHG3 knockdown on ESCC cell proliferation and metastasis. (a) The expression of miR-151a-3p in TE-1 and KYSE-150 cells transfected with anti-NC or anti-miR-151a-3p. CCK-8 assay was performed for cell proliferation in TE-1 (b) and KYSE-150 cells (c). (d) Colony formation assay was used to analyze cell colony formation ability in ESCC cells. (e) Flow cytometry was employed to evaluate cell apoptosis. Transwell assay was carried out for cell migration (f) and invasion (g). Western blot assay was used to detect the protein levels of bcl-2, cleaved-capsase-3, and MMP9 in TE-1 (h) and KYSE-150 (i) cells. (b–i) TE-1 and KYSE-150 cells were transfected with si-NC, si-lncRNA SNHG3, si-SNHG3 + anti-NC, or si-SNHG3 + anti-miR-151a-3p. *P < 0.05, **P < 0.01, ***P < 0.001.
Figure 4

Inhibition of miR-151a-3p ameliorated the effects of lncRNA SNHG3 knockdown on ESCC cell proliferation and metastasis. (a) The expression of miR-151a-3p in TE-1 and KYSE-150 cells transfected with anti-NC or anti-miR-151a-3p. CCK-8 assay was performed for cell proliferation in TE-1 (b) and KYSE-150 cells (c). (d) Colony formation assay was used to analyze cell colony formation ability in ESCC cells. (e) Flow cytometry was employed to evaluate cell apoptosis. Transwell assay was carried out for cell migration (f) and invasion (g). Western blot assay was used to detect the protein levels of bcl-2, cleaved-capsase-3, and MMP9 in TE-1 (h) and KYSE-150 (i) cells. (b–i) TE-1 and KYSE-150 cells were transfected with si-NC, si-lncRNA SNHG3, si-SNHG3 + anti-NC, or si-SNHG3 + anti-miR-151a-3p. *P < 0.05, **P < 0.01, ***P < 0.001.

3.5 PFN2 is a target of miR-151a-3p

To further explore the downstream mechanism of miR-151a-3p, we predicted that PFN2 had the binding sites of miR-151a-3p by bioinformatics analysis (Figure 5a). Overexpression of miR-151a-3p only significantly reduced the luciferase activity in PFN2-WT-transfected cells (Figure 5b). In addition, we found that both mRNA and protein levels of PFN2 were distinctly increased in ESCC tissues (Figure 5c and d). A similar PFN2 expression trend was observed in ESCC cells (Figure 5e). Next, the protein expression of PFN2 in the cells transfected with miR-151a-3p mimics or inhibitors was detected. As expected, overexpression of miR-151a-3p suppressed PFN2 expression. In contrast, inhibition of miR-151a-3p promoted the expression of PFN2 (Figure 5f and g). Meanwhile, we also measured the protein expression of PFN2 in cells transfected with si-NC, si-SNHG3, si-SNHG3 + anti-NC, or si-SNHG3 + anti-miR-151a-3p. We found that SNHG3 knockdown restrained the expression of PFN2, while inhibition of miR-151a-3p relieved the inhibitory effect on PFN2 of SNHG3 knockdown (Figure 5h and i). These results proved that SNHG3 positively regulated the expression of PFN2 by sponging miR-151a-3p.

Figure 5 PFN2 was a downstream target of miR-151a-3p. (a) The potential binding sites between miR-151a-3p and PFN2. (b) The combination between miR-151a-3p and PFN2 was verified by dual luciferase reporter assay. (c) The mRNA levels of PFN2 in tumor tissues and non-tumor tissues. (d) The protein levels of PFN2 in tumor tissues and non-tumor tissues. (e) The protein levels of PFN2 in TE-1 and KYSE-150 cells. (f and g) The protein levels of PFN2 in ESCC cells transfected with miR-NC, miR-151a-3p, anti-NC or anti-miR-151a-3p were measured. (h and i) After ESCC cells were transfected with si-NC, si-SNHG3, si-SNHG3 + anti-NC, or si-SNHG3 + anti-miR-151a-3p, the protein levels of PFN2 were measured. *P < 0.05, **P < 0.01, ***P < 0.001.
Figure 5

PFN2 was a downstream target of miR-151a-3p. (a) The potential binding sites between miR-151a-3p and PFN2. (b) The combination between miR-151a-3p and PFN2 was verified by dual luciferase reporter assay. (c) The mRNA levels of PFN2 in tumor tissues and non-tumor tissues. (d) The protein levels of PFN2 in tumor tissues and non-tumor tissues. (e) The protein levels of PFN2 in TE-1 and KYSE-150 cells. (f and g) The protein levels of PFN2 in ESCC cells transfected with miR-NC, miR-151a-3p, anti-NC or anti-miR-151a-3p were measured. (h and i) After ESCC cells were transfected with si-NC, si-SNHG3, si-SNHG3 + anti-NC, or si-SNHG3 + anti-miR-151a-3p, the protein levels of PFN2 were measured. *P < 0.05, **P < 0.01, ***P < 0.001.

3.6 Overexpression of PFN2 attenuates the anti-tumor effect of SNHG3 knockdown

Similarly, we conducted a rescue experiment to verify whether PFN2 was involved in the regulating mechanism of the SNHG3/miR-151a-3p axis. The protein expression level of PFN2 was significantly increased in cells transfected with the pcDNA-PFN2 overexpression plasmid (Figure 6a). TE-1 and KYSE-150 cells were transfected with si-NC, si-SNHG3, si-SNHG3 + pcDNA, or si-SNHG3 + pcDNA-PFN2, respectively. And then the cell proliferation, apoptosis, migration, and invasion were analyzed. The results manifested that overexpression of PFN2 attenuated the anti-proliferative effect of SNHG3 knockdown in ESCC cells (Figure 6b–d). Overexpression of PFN2 also inhibited the anti-apoptotic effect of SNHG3 knockdown (Figure 6e). Furthermore, overexpression of PFN2 weakened the anti-migrative and anti-invasive ability of SNHG3 knockdown in ESCC cells (Figure 6f and g). In addition, overexpression of PFN2 reduced the inhibitory effect of SNHG3 knockdown on bcl-2 and MMP9 and the promotion of cleaved-caspase-3 (Figure 6h and i). These results revealed that SNHG3 regulated the progression of ESCC cells via the miR-151a-3p/PFN2 axis.

Figure 6 PFN2 overexpression abolished the effects of lncRNA SNHG3 knockdown on cell proliferation and metastasis. (a) The protein level of PFN2 in cells transfected with pcDNA-vector or pcDNA-PFN2 was measured. (b and c) CCK-8 assay was performed for cell proliferation in TE-1 and KYSE-150 cells. (d) Colony formation assay was used to analyze cell colony formation ability in ESCC cells. (e) Flow cytometry was employed to evaluate cell apoptosis. Transwell assay was carried out for cell migration (f) and invasion (g). (h and i) Western blot assay was used to detect the protein levels of bcl-2, cleaved-capsase-3, and MMP9 in TE-1 and KYSE-150 cells. (b–i) TE-1 and KYSE-150 cells were transfected with si-NC, si-SNHG3, si-SNHG3 + pcDNA-NC, or si-SNHG3 + pcDNA-PFN2. *P < 0.05, **P < 0.01, ***P < 0.001.
Figure 6

PFN2 overexpression abolished the effects of lncRNA SNHG3 knockdown on cell proliferation and metastasis. (a) The protein level of PFN2 in cells transfected with pcDNA-vector or pcDNA-PFN2 was measured. (b and c) CCK-8 assay was performed for cell proliferation in TE-1 and KYSE-150 cells. (d) Colony formation assay was used to analyze cell colony formation ability in ESCC cells. (e) Flow cytometry was employed to evaluate cell apoptosis. Transwell assay was carried out for cell migration (f) and invasion (g). (h and i) Western blot assay was used to detect the protein levels of bcl-2, cleaved-capsase-3, and MMP9 in TE-1 and KYSE-150 cells. (b–i) TE-1 and KYSE-150 cells were transfected with si-NC, si-SNHG3, si-SNHG3 + pcDNA-NC, or si-SNHG3 + pcDNA-PFN2. *P < 0.05, **P < 0.01, ***P < 0.001.

3.7 SNHG3 knockdown inhibits tumor growth in vivo

Finally, nude mouse xenograft tumor model was conducted to evaluate the effects of SNHG3 in vivo. We found that the tumor weight and volume of the sh-SNHG3 group were obviously decreased when compared with the sh-NC group (Figure 7a and b). SNHG3 knockdown obviously suppressed tumor growth. Meanwhile, the expression of SNHG3, miR-151a-3p, and PFN2 was examined by qRT-PCR in tumor tissues. The results showed that the expression of SNHG3 and PFN2 was significantly down-regulated, and the expression of miR-151a-3p was distinctly up-regulated in the sh-SNHG3 group (Figure 7c). Moreover, western blot results demonstrated that the protein expression of PFN2 was notably reduced in the sh-SNHG3 group (Figure 7d). These data cleared that knockdown of SNHG3 repressed the development of ESCC in vivo, which was consistent with its biological function in vitro.

Figure 7 Knockdown of lncRNA SNHG3 suppressed cell growth in vivo. (a) Tumor volume was measured every week. (b) Tumor weight was examined after 5 weeks. (c) The levels of SNHG3, miR-151a-3p, and PFN2 mRNA in the collected tumors were detected by qRT-PCR. (d) The protein level of PFN2 was measured by western blot. **P < 0.01, ***P < 0.001.
Figure 7

Knockdown of lncRNA SNHG3 suppressed cell growth in vivo. (a) Tumor volume was measured every week. (b) Tumor weight was examined after 5 weeks. (c) The levels of SNHG3, miR-151a-3p, and PFN2 mRNA in the collected tumors were detected by qRT-PCR. (d) The protein level of PFN2 was measured by western blot. **P < 0.01, ***P < 0.001.

4 Discussion

The evolution of ESCC is a multi-step process that gradually developed from low-grade dysplasia, high-grade dysplasia, carcinoma in situ to invasive tumors, and metastases [19]. Extensive dysregulated lncRNAs have been observed in ESCC tumor tissues, which are closely related to the tumorigenesis and progression of ESCC [20]. The differential expression of lncRNAs has been confirmed in various types of malignant tumors in regulating tumor occurrence and progression, indicating that they have potential effects on carcinogenesis and anti-carcinoma [21,22]. For example, LOC146880 is conspicuously up-regulated and regulates the expression of FSCN1 by sponge miR-328-5p in ESCC tissues and cell lines, thereby activating the MAPK signaling pathway to accelerate ESCC progression [23]. lncRNA MTX2-6 is eminently down-regulated and exerts a tumor suppressor effect via miR-574-5p/SMAD4 axis in ESCC [24].

SNHG3 is a novel type of lncRNA. A lot number of studies have confirmed that SNHG3 has carcinogenic effects in a variety of malignant tumors and promotes the malignant progression of tumor cells, such as lung cancer, liver cancer, gastric cancer, and breast cancer [10,15,18,25]. SNHG3 may represent a valuable prognostic biomarker and therapeutic target for a variety of cancers. However, there have not been enough studies to report the role of SNHG3 in ESCC, and its related mechanism is still unclear. In this study, we explored the function and regulating mechanism of SNHG3 in ESCC. We first reported that SNHG3 was highly expressed in ESCC tissues and cells. The cell proliferation, migration, and invasion were obviously suppressed after SNHG3 knockdown in ESCC cells, while cell apoptosis was remarkably promoted. In addition, we found that SNHG3 knockdown restrained the expression of bcl-2 and MMP9 but facilitated the expression of cleaved-caspase-3.

It is reported that lncRNA interferes with the expression of targeted mRNA by acting as a molecular sponge of miRNA and regulates cellular processes, such as proliferation, migration, invasion, and apoptosis, thus serving as an oncogene or anti-oncogene in ESCC [26,27]. For example, lncRNA MNX1-AS1 acts as a ceRNA of miR-34a to up-regulate SIRT1 expression, accordingly promoting the progression of ESCC [28]. Exosome-derived ZFAS1 promotes the occurrence and development of ESCC tumors via the miR-124/STAT3 axis [29]. In our study, we found that miR-151a-3p was a direct target of SNHG3 and its expression was negatively regulated by SNHG3.

Intriguingly, miR-151a-3p seems to have dual roles in tumors, embodied in two aspects of tumor suppression and promotion. It has been reported that miR-151a-3p is highly expressed in nasopharyngeal carcinoma cells and effectively combines with the 3′-UTR of p53 to block the expression of tumor suppressor gene p53, as a result of promoting the proliferation, migration, and invasion of nasopharyngeal carcinoma cells [30]. Contrary to this, miR-151a-3p is expressed lower in osteosarcoma tissues, and the promotion of SNHG3 on the progression of osteosarcoma can be reversed by regulating the expression of RAB22A [17]. However, the role of miR-151a-3p in ESCC has not been fully explained. We found that the expression of miR-151a-3p was clearly downregulated in ESCC. Furthermore, the results of the rescue experiment demonstrated that miR-151a-3p inhibition reversed the anti-tumor regulation of SNHG3 knockdown on tumor progression. Overall, these illustrated that miR-151a-3p acted as a tumor suppressor in ESCC and participated in the potential mechanism of SNHG3 in ESCC cells.

Finally, we further investigated the downstream mechanism of miR-151a-3p. We confirmed that PFN2 was the target mRNA of miR-151a-3p. The gain-/loss-of-function experiments confirmed that SNHG3 positively regulated the expression of PFN2 by sponging miR-151a-3p. PFN2 is a member of the profilins family, which is a 12–15 kDa actin-binding protein found in eukaryotes [31]. In recent years, it has been reported that the profilin family is associated with a variety of tumor progression, including lung cancer, ESCC, and head and neck squamous cell carcinoma [32,33,34] As previously mentioned, PFN2 is highly expressed in ESCC and has the biological effect of promoting cell migration and invasion [35]. As reported, we also found a distinct increase in the expression of PFN2 in ESCC tissues and cells. In addition, functional assays testified that PFN2 overexpression attenuated the positive effects of SNHG3 knockdown. Moreover, knockdown of SNHG3 suppressed the tumor growth in a nude mouse xenograft model.

5 Conclusion

In summary, our results revealed that SNHG3 knockdown inhibited the proliferation and metastasis of ESCC cells. SNHG3 regulated the expression of PFN2 by targeting miR-151a-3p. The mechanism analysis confirmed that SNHG3 regulated the tumor development of ESCC via miR-151a-3p/PFN2 axis. These may provide a potential therapeutic target for ESCC.

tel: +86-379-63892005

  1. Funding information: This study was supported by Medical Science and Technology Program of Henan Province (Joint Project) [No. 2018020908].

  2. Author contributions: Tiejun Ren conceived and designed the study. Dingyi Wang and Jinjin Gu acquired the data. Dingyi Wang, Jinjin Gu, Xiaozhen Hou, and Tiejun Ren analyzed and interpreted the data. Dingyi Wang and Jinjin Gu wrote the original draft. Tiejun Ren acquired the funding, reviewed, and edited the article. All authors reviewed the results and approved the final version of the article.

  3. Conflict of interest: The authors have no conflicts of interest to declare.

  4. Data availability statement: The data used to support the findings of this study are available from the corresponding author upon request.

Appendix A

Table A1

The targeting sequences for SNHG3

Targeting sequence
si-SNHG3 5′-GGGCACTTCGTAAGGTTTAAA-3′
si-NC 5′-AACCATCACTTACAAGAAACC-3′
sh-SNHG3 5′-GGGAUCAUCUAGAAGGUAATT-3′
Anti-miR-151a-3p 5′-CUAGACUGAAGCUCCUUGAGG-3′
Anti-NC 5′-UUCUCCGAACGUGUCACGUTT-3′

References

[1] Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424. 10.3322/caac.21492.Suche in Google Scholar PubMed

[2] Huang TX, Fu L. The immune landscape of esophageal cancer. Cancer Commun (Lond). 2019;39(1):79. 10.1186/s40880-019-0427-z.Suche in Google Scholar PubMed PubMed Central

[3] Hayano K, Ohira G, Hirata A, Aoyagi T, Imanishi S, Tochigi T, et al. Imaging biomarkers for the treatment of esophageal cancer. World J Gastroenterol. 2019;25(24):3021–9. 10.3748/wjg.v25.i24.3021.Suche in Google Scholar PubMed PubMed Central

[4] Lin L, Lin DC. Biological significance of tumor heterogeneity in esophageal squamous cell carcinoma. Cancers (Basel). 2019;11(8):1156. 10.3390/cancers11081156.Suche in Google Scholar PubMed PubMed Central

[5] Codipilly DC, Qin Y, Dawsey SM, Kisiel J, Topazian M, Ahlquist D, et al. Screening for esophageal squamous cell carcinoma: Recent advances. Gastrointest Endosc. 2018;88(3):413–26. 10.1016/j.gie.2018.04.2352.Suche in Google Scholar PubMed PubMed Central

[6] Shen WJ, Zhang F, Zhao X, Xu J. LncRNAs and esophageal squamous cell carcinoma – implications for pathogenesis and drug development. J Cancer. 2016;7(10):1258–64. 10.7150/jca.14869.Suche in Google Scholar PubMed PubMed Central

[7] Cossu AM, Mosca L, Zappavigna S, Misso G, Bocchetti M, De Micco F, et al. Long Non-coding RNAs as important biomarkers in laryngeal cancer and other head and neck tumours. Int J Mol Sci. 2019;20(14):3444. 10.3390/ijms20143444.Suche in Google Scholar PubMed PubMed Central

[8] Feng Q, Zhang H, Yao D, Chen WD, Wang YD. Emerging role of non-coding RNAs in esophageal squamous cell carcinoma. Int J Mol Sci. 2019;21(1):258. 10.3390/ijms21010258.Suche in Google Scholar PubMed PubMed Central

[9] Liang Y, Chen X, Wu Y, Li J, Zhang S, Wang K, et al. LncRNA CASC9 promotes esophageal squamous cell carcinoma metastasis through upregulating LAMC2 expression by interacting with the CREB-binding protein. Cell Death Differ. 2018;25(11):1980–95. 10.1038/s41418-018-0084-9.Suche in Google Scholar PubMed PubMed Central

[10] Zhao S, Gao X, Zhong C, Li Y, Wang M, Zang S. SNHG3 knockdown suppresses proliferation, migration and invasion, and promotes apoptosis in non-small cell lung cancer through regulating miR-216a/ZEB1 axis. Onco Targets Ther. 2020;13:11327–36. 10.2147/ott.S263637.Suche in Google Scholar PubMed PubMed Central

[11] Ali Syeda Z, Langden SSS, Munkhzul C, Lee M, Song SJ. Regulatory mechanism of MicroRNA expression in cancer. Int J Mol Sci. 2020;21(5):1723. 10.3390/ijms21051723.Suche in Google Scholar PubMed PubMed Central

[12] Chen PS, Lin SC, Tsai SJ. Complexity in regulating microRNA biogenesis in cancer. Exp Biol Med (Maywood). 2020;245(5):395–401. 10.1177/1535370220907314.Suche in Google Scholar PubMed PubMed Central

[13] Dragomir M, Mafra ACP, Dias SMG, Vasilescu C, Calin GA. Using microRNA networks to understand cancer. Int J Mol Sci. 2018;19(7):1871. 10.3390/ijms19071871.Suche in Google Scholar PubMed PubMed Central

[14] Wu Y, Hu L, Liang Y, Li J, Wang K, Chen X, et al. Up-regulation of lncRNA CASC9 promotes esophageal squamous cell carcinoma growth by negatively regulating PDCD4 expression through EZH2. Mol Cancer. 2017;16(1):150. 10.1186/s12943-017-0715-7.Suche in Google Scholar PubMed PubMed Central

[15] Xuan Y, Wang Y. Long non-coding RNA SNHG3 promotes progression of gastric cancer by regulating neighboring MED18 gene methylation. Cell Death Dis. 2019;10(10):694. 10.1038/s41419-019-1940-3.Suche in Google Scholar PubMed PubMed Central

[16] Xu B, Mei J, Ji W, Bian Z, Jiao J, Sun J, et al. LncRNA SNHG3, a potential oncogene in human cancers. Cancer Cell Int. 2020;20(1):536. 10.1186/s12935-020-01608-x.Suche in Google Scholar PubMed PubMed Central

[17] Zheng S, Jiang F, Ge D, Tang J, Chen H, Yang J, et al. LncRNA SNHG3/miRNA-151a-3p/RAB22A axis regulates invasion and migration of osteosarcoma. Biomed Pharmacother. 2019;112:108695. 10.1016/j.biopha.2019.108695.Suche in Google Scholar PubMed

[18] Zhang H, Wei N, Zhang W, Shen L, Ding R, Li Q, et al. lncRNA SNHG3 promotes breast cancer progression by acting as a miR‑326 sponge. Oncol Rep. 2020;44(4):1502–10. 10.3892/or.2020.7690.Suche in Google Scholar PubMed PubMed Central

[19] Yan T, Cui H, Zhou Y, Yang B, Kong P, Zhang Y, et al. Author correction: Multi-region sequencing unveils novel actionable targets and spatial heterogeneity in esophageal squamous cell carcinoma. Nat Commun. 2020;11(1):5870. 10.1038/s41467-020-19641-9.Suche in Google Scholar PubMed PubMed Central

[20] Sugihara H, Ishimoto T, Miyake K, Izumi D, Baba Y, Yoshida N, et al. Noncoding RNA expression aberration is associated with cancer progression and is a potential biomarker in esophageal squamous cell carcinoma. Int J Mol Sci. 2015;16(11):27824–34. 10.3390/ijms161126060.Suche in Google Scholar PubMed PubMed Central

[21] Sun DE, Ye SY. Emerging roles of long noncoding RNA regulator of reprogramming in cancer treatment. Cancer Manag Res. 2020;12:6103–12. 10.2147/cmar.S253042.Suche in Google Scholar

[22] Zhang S, Li J, Gao H, Tong Y, Li P, Wang Y, et al. lncRNA profiles enable prognosis prediction and subtyping for esophageal squamous cell carcinoma. Front Cell Dev Biol. 2021;9:656554. 10.3389/fcell.2021.656554.Suche in Google Scholar PubMed PubMed Central

[23] Tang J, Xu H, Liu Q, Zheng J, Pan C, Li Z, et al. LncRNA LOC146880 promotes esophageal squamous cell carcinoma progression via miR-328-5p/FSCN1/MAPK axis. Aging (Albany NY). 2021;13(10):14198–218. 10.18632/aging.203037.Suche in Google Scholar PubMed PubMed Central

[24] Li J, Han X, Gu Y, Wu J, Song J, Shi Z, et al. LncRNA MTX2-6 suppresses cell proliferation by acting as ceRNA of miR-574-5p to accumulate SMAD4 in esophageal squamous cell carcinoma. Front Cell Dev Biol. 2021;9:654746. 10.3389/fcell.2021.654746.Suche in Google Scholar PubMed PubMed Central

[25] Wu J, Liu L, Jin H, Li Q, Wang S, Peng B. LncSNHG3/miR-139-5p/BMI1 axis regulates proliferation, migration, and invasion in hepatocellular carcinoma. Onco Targets Ther. 2019;12:6623–38. 10.2147/ott.S196630.Suche in Google Scholar

[26] Li HM, Yu YK, Liu Q, Wei XF, Zhang J, Zhang RX, et al. LncRNA SNHG1 regulates the progression of esophageal squamous cell cancer by the miR-204/HOXC8 axis. Onco Targets Ther. 2020;13:757–67. 10.2147/ott.S224550.Suche in Google Scholar

[27] Ye Z, Fang J, Wang Z, Wang L, Li B, Liu T, et al. Bioinformatics-based analysis of the lncRNA-miRNA-mRNA and TF regulatory networks reveals functional genes in esophageal squamous cell carcinoma. Biosci Rep. 2020;40(8):BSR20201727. 10.1042/bsr20201727.Suche in Google Scholar PubMed PubMed Central

[28] Chu J, Li H, Xing Y, Jia J, Sheng J, Yang L, et al. LncRNA MNX1-AS1 promotes progression of esophageal squamous cell carcinoma by regulating miR-34a/SIRT1 axis. Biomed Pharmacother. 2019;116:109029. 10.1016/j.biopha.2019.109029.Suche in Google Scholar PubMed

[29] Li Z, Qin X, Bian W, Li Y, Shan B, Yao Z, et al. Exosomal lncRNA ZFAS1 regulates esophageal squamous cell carcinoma cell proliferation, invasion, migration and apoptosis via microRNA-124/STAT3 axis. J Exp Clin Cancer Res. 2019;38(1):477. 10.1186/s13046-019-1473-8.Suche in Google Scholar PubMed PubMed Central

[30] Liu H, Cheng Y, Xu Y, Xu H, Lin Z, Fan J, et al. The inhibition of tumor protein p53 by microRNA-151a-3p induced cell proliferation, migration and invasion in nasopharyngeal carcinoma. Biosci Rep. 2019;39(10):BSR20191357. 10.1042/bsr20191357.Suche in Google Scholar

[31] Pandey DK, Chaudhary B. Evolutionary expansion and structural functionalism of the ancient family of profilin proteins. Gene. 2017;626:70–86. 10.1016/j.gene.2017.05.024.Suche in Google Scholar PubMed

[32] Cao Q, Liu Y, Wu Y, Hu C, Sun L, Wang J, et al. Profilin 2 promotes growth, metastasis, and angiogenesis of small cell lung cancer through cancer-derived exosomes. Aging (Albany NY). 2020;12(24):25981–99. 10.18632/aging.202213.Suche in Google Scholar PubMed PubMed Central

[33] Zhang Q, Pan X, You D. Overexpression of long non-coding RNA SBF2-AS1 promotes cell progression in esophageal squamous cell carcinoma (ESCC) by repressing miR-494 to up-regulate PFN2 expression. Biol Open. 2020;30:bio.048793. 10.1242/bio.048793.Suche in Google Scholar PubMed

[34] Zhou K, Chen J, Wu J, Xu Y, Wu Q, Yue J, et al. Profilin 2 promotes proliferation and metastasis of head and neck cancer cells by regulating PI3K/AKT/β-catenin signaling pathway. Oncol Res. 2019;27(9):1079–88. 10.3727/096504019x15579146061957.Suche in Google Scholar PubMed PubMed Central

[35] Cui XB, Zhang SM, Xu YX, Dang HW, Liu CX, Wang LH, et al. PFN2, a novel marker of unfavorable prognosis, is a potential therapeutic target involved in esophageal squamous cell carcinoma. J Transl Med. 2016;14(1):137. 10.1186/s12967-016-0884-y.Suche in Google Scholar PubMed PubMed Central

Received: 2022-02-08
Revised: 2022-07-12
Accepted: 2022-08-08
Published Online: 2022-10-14

© 2022 Tiejun Ren et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0548
Schlagwörter für diesen Artikel
esophageal squamous cell carcinoma; lncRNA SNHG3; miR-151a-3p; PFN2
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 10.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0548/html
Button zum nach oben scrollen