Home lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
Article Open Access

lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox

  • Can-Jie Guo , Qin Pan EMAIL logo and Xiong Ma EMAIL logo
Published/Copyright: April 4, 2022
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 17 Issue 1

Abstract

Long noncoding RNAs (lncRNAs) are key regulators of hepatic stellate cells (HSCs), yet the role of upregulated lncRNA-NONRATT013819.2 in activated HSCs remains uncertain. In this study, the effects of NONRATT013819.2 on proliferation, apoptosis, migration, and contraction of transforming growth factor (TGF)-β1-induced HSCs were investigated. The mechanisms of NONRATT013819.2 on the activated HSCs were explored by loss-of-function of NONRATT013819.2 and gain-of-function of the target gene. Here, TGF-β1 treatment resulted in a gradual increase in the expression of cytoskeleton markers (collagen, α-SMA, and TIMP1), NONRATT013819.2, miR24-3p, and lysyl oxidase (Lox) over time in HSCs. NONRATT013819.2 acted as a sponge of miR24-3p to competitively abolish the inhibition of the lox gene in HSCs. Silencing of NONRATT013819.2 suppressed the expression of cytoskeleton markers, proliferation, and the proportion of cells that entered the S-phase, and promoted apoptosis in TGF-β1-activated HSCs. These effects were reversed when lox overexpression was introduced simultaneously. Similarly, silencing of NONRATT013819.2 also blocked ECM reconstruction, while recused by lox overexpression in TGF-β1-activated HSCs. In conclusion, upregulation of NONRATT013819.2 promotes the myofibroblastic transition by competitively binding miR24-3p to release lox in HSCs. Therefore, targeted therapy of NONRATT013819.2 may have the potential for liver fibrosis.

Keywords: liver fibrosis; NONRATT013819.2/miR24-3p/lox; ECM reconstruction; cytoskeleton markers; proliferation; apoptosis; cell cycle

1 Introduction

Hepatic stellate cells (HSCs), which are located in the Disse gap between the hepatocyte plate and hepatic sinus, play an important role in the pathogenesis of liver fibrosis [1]. In normal liver, quiescent HSCs have weak relaxation and contraction. However, when there is liver damage, HSCs transition from a quiescent state to an activated state and the activated HSCs acquire the migratory, proliferative, and myofibroblast-like phenotype [2]. This myofibroblastic transition process leads to the accumulation of myofibroblasts, which contributes to the formation of liver fibrosis and the reconstruction of intrahepatic structures by secreting extracellular matrix (ECM) [3]. However, the mechanisms of HSC phenotypic transformation remain poorly understood.

Long noncoding RNAs (lncRNAs) are a novel class of ncRNAs with transcripts containing more than 200 nucleotides [4]. Current studies indicate that lncRNAs serve as activators or suppressors of HSCs to participate in the occurrence and development of myofibroblastic transition. For instance, lncRNA NEAT1-induced autophagy and activation of HSCs in mice [5]. To explore the differential expression profile of lncRNA during HSC myofibroblastic transition, we previously performed high-throughput sequencing in primary quiescent and activated HSC of rats. We found that the expression level of lncRNA NONRATT013819.2 was significantly upregulated more than fivefold in activated HSCs compared to the quiescent HSCs [6]. Meanwhile, the expression of NONRATT013819.2 was positively correlated with that of the lysyl oxidase (lox) gene, which is adjacent to each other at the chromosomal location [6]. However, whether NONRATT013819.2 and lox are involved in HSC myofibroblastic transition and the possible underlying mechanism remains unclear.

It is well known that miRNAs initiate the degradation of mRNA by binding to miRNA response elements (MREs) of mRNA with the attendant inhibition of the translation of target genes [7]. Numerous studies have found that the same MREs also exist on lncRNA and circRNA. Hence, different types of RNA containing MREs can “communicate” with one another simply by competing for the shared miRNAs, acting as ceRNAs, through the formation of lncRNA–miRNA–mRNA or circRNA–miRNA–mRNA ceRNA regulation networks [8]. This hypothesis is widely adopted when studying the role of lncRNA in disease pathogenesis. However, whether the relationship between NONRATT013819.2 and lox depends on ceRNA remains unclear.

In this study, we performed an overall analysis of the effects of NONRATT013819.2 on the biological properties of HSCs and investigated its mechanism. Our findings may improve the understanding of the myofibroblastic transition of HSCs and provide a novel therapeutic strategy against the activation and progression of liver fibrosis.

2 Materials and methods

2.1 Isolation, culture, and treatment of rat HSCs

Primary HSCs were isolated from three normal male Sprague–Dawley rats (weighing 400–500 g) by in situ perfusion and density gradient centrifugation using a modification of the methodology previously described by Friedman et al. [9]. Briefly, animals were anesthetized with ether and treated with 0.1 cc heparin sodium (1 mL/kg) via direct inferior vena cava injection immediately before perfusion. Subsequently, the serial infusion was carried out via rodent portal vein using D-Hank’s solution and then perfusion medium (Hank’s medium with 0.5 g/L collagenase IV and 1 g/L pronase E). Afterward, the isolated rat liver was cut into pieces and exposed to re-digestion using collagenase IV and DNase. Finally, the rat HSCs were isolated from cell suspension by density gradient centrifugation using 180 g/L Nycodenz (Sigma-Aldrich, St. Louis, MO, USA). Activation of HSCs was induced by the transforming growth factor (TGF)-β1 at a concentration of 10 ng/mL, and the cells were cultured for 0, 12, 24, 48, 72, and 96 h. All the materials for HSC isolation, culture, and identification were obtained from commercial sources. The rats received humane care according to the Guideline for the Care and Use of Laboratory Animals of the Chinese Academy of Sciences. Ethical approvals were obtained from the Ethics Committee of Renji Hospital, School of Medicine, Shanghai Jiao Tong University (Approval No. 82170615).

2.2 Construction of vectors

The following steps were involved in the construction of a silencing vector of lncRNA NONRATT013819.2. First, we designed a specific siRNA sequence that complementarily binds to NONRATT013819.2. Then, a complementary shRNA-DNA sequence with a hairpin structure was obtained according to the siRNA sequence. Next, the shRNA-DNA sequences were cloned into the linear pSIH1-H1-copGFP shRNA vector (System Biosciences, Palo Alto, CA, USA) to obtain lncRNA NONRATT013819.2 silencing vector (tagged as pSIH1-shRNA-NONR). Meanwhile, an invalid siRNA sequence was used as a negative control (NC) and tagged as pSIH1-NC. Finally, DNA sequencing was used to confirm the constructed vectors (pSIH1-shRNA-NONR and pSIH1-NC). All the primers are shown in Table S1.

Construction of the overexpression vector of lox. The coding sequence of rat lox (NM_017061.2, 1808 bp) was amplified using PCR, which contained an EcoRI cutting site, Kozak sequence (5′-GCCACC-3′], and a BamHI cutting site. The product of PCR amplification was digested and cloned into a pcDH1-GFP lentiviral expression vector (System Biosciences). The recombinant vector was tagged pcDH1-lox and confirmed by DNA sequencing. Empty vectors were used as controls. All the primers are listed in Table S1.

2.3 Lentivirus packaging and infection

Transfection was carried out when the cells were in the logarithmic growth phase. Here, 2 µg recombinant vector (pSIH1-shRNA-NONR, pSIH1-NC, and pcDH1-lox) and 10 µg of pPACK™ Packaging Plasmid Mix (System Biosciences) were co-transfected into cells using diluted Lipofectamine 2000 (2 µL was diluted with 50 µL OPTI-MEM; Invitrogen, Carlsbad, CA, USA). After a 48-h culture, the supernatant was harvested and cleared by centrifugation at 5,000×g at 4°C for 5 min and then filtered by a 0.45 µm polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). The titer of the virus was determined by gradient dilution. Furthermore, the established lentiviruses with the sequences of shRNA-NONR, lox, and NC were tagged Lv-shRNA-NONR, Lv-lox, and Lv-NC, respectively.

Thereafter, HSCs cell line of lncRNA NONRATT013819.2 silencing and Lox overexpression were produced by lentiviral infection using the aforementioned packaged lentiviruses of Lv-shRNA-NONR and Lv-lox, respectively. The lentiviral infection was conducted when HSCs were in the logarithmic growth phase on six-well plates at 5 × 105 cells/well. The viral solution was added at a multiplicity of infection (MOI) of 10. Infection efficiency was assessed by GFP fluorescence after infection for 72 h by a fluorescence inverted microscope (IX71, Olympus, Japan).

2.4 Analysis of RT-qPCR

Total RNA was isolated using the TRIzol® Reagent (Invitrogen; Thermo Fisher Scientific). RT-qPCR was performed in triplicate for each sample. The relative amounts of NONRATT013819.2 and Lox were normalized against β-actin and miR24-3p against U6 snRNA. The fold change for each gene was calculated by the 2−ΔΔCt method. The primers used are shown in Table S1.

2.5 Western blotting

Total protein was extracted from the cells using the M-PER mammalian protein extraction reagent (Pierce, Rockford, IL, USA). Equal quantities of protein (20 µg per lane) estimated by the bicinchoninic acid protein assay kit (Pierce) were loaded onto 11% SDS-PAGE and transferred onto nitrocellulose membranes. The blots were probed with a monoclonal antibodies against human collagen I (1:200, Cat#ab138492, Abcam, UK), α-SMA (1:500, Cat#ab5694, Abcam), tissue inhibitor of metalloproteinase (TIMP)1 (1:600, Cat#ab211926, Abcam), Lox (1:250, Cat#ab174316, Abcam), and β-actin (1:1200, Cat#ab8226, Abcam), followed by secondary horseradish peroxidase-conjugated antirabbit antibody (1:10,000, Cat#ab97080, Abcam). After washing, the bands were detected by chemiluminescence and imaged with X-ray films. β-Actin was used as an endogenous reference for normalization.

2.6 Luciferase activity assay

The current study utilized Targetscan7.1 (http://www.targetscan.org/) to predict the binding site of miR24-3p on the 3′ untranslated region (UTR) of Lox mRNA, and the binding sites of miR24-3p on NONRATT013819.2. Primers that targeted the 3′ UTR of the lox gene were designed such that flanking XbaI restriction sites were introduced into the 228-bp PCR product containing the miR24-3p target site (5′-TGAGCC-3′]. The primer sequences of PCR are shown in Table S1. PCR product was digested with XbaI (Takara Bio) and cloned into the pGL3-promoter luciferase reporter vector (Promega, Madison, WI, USA) to generate the vector pGL3-wild type (wt)-Lox. The miR24-3p target site in the pGL3-wt-Lox vector was mutated from 5′-TGAGCC-3′ to 5′-GCGCTA-3′ to construct the mutated reporter vector, tagged as pGL3-mt-Lox, using a Site-Directed Mutagenesis Kit (Takara Bio). The products of the vectors were confirmed by DNA sequencing. Endotoxin-free DNA samples were prepared in all cases. The miR24-3p mimic, the miR24-3p inhibitor, and miR24-3p NC were all synthesized by Invitrogen (Thermo Fisher Scientific) and then co-transfected with pGL3-wt-Lox or pGL3-mt-Lox into 293 cells. The sequences are shown in Table S1. Luciferase activity was measured using the dual-luciferase reporter assay system (Promega) after transfection for 48 h. Moreover, the effect of NONRATT013819.2 depletion on the luciferase activity of miR24-3p mimics was also observed in activated HSCs.

2.7 Cell Counting kit-8 assay

The HSCs viability was examined using Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan). After viral infection of HSCs for 48 h, HSCs were induced by 10 ng/mL TGF-β1 for 72 h, and then, the cells were harvested for the assay. Each sample was set with six repeating wells. The HSCs were seeded in a 96-well plate at a density of 2 × 103 cells/well and cultured for 24 h. Then, 10 µL of CCK-8 reagent 8 was added to each well and cultured for another 12, 24, 48, and 72 h. Absorbance was measured at 450 nm on a microplate reader (Molecular Devices, Tokyo, Japan).

2.8 Flow cytometry

The cell cycle distributions and apoptosis rates of HSCs were measured by flow cytometry on fluorescence-activated cell sorting (FACS) Calibur (BD Biosciences, Franklin Lakes, NJ, USA) as previously described [10]. After viral infection of HSCs for 48 h, HSCs were induced by 10 ng/mL TGF-β1 for 72 h, and then, the cells were harvested for assay. Freshly isolated HSCs were fixed and then stained with propidium iodide followed by FACS analysis.

2.9 Gel contracture experiment

After viral infection of HSCs for 48 h, HSCs were induced by 10 ng/mL TGF-β1 for 72 h, and then, the cells were harvested for contraction assay on collagen gel. Rat-tail collagen (4 g/L; BD Biosciences) was preplated in 12-well plates and cultured for 1 h at 37°C to allow for gelatinization. Next, HSCs were plated on top of the gel (the density of cells and volume of gel were 1 × 106 cells/well and 50 μL, respectively) and co-cultured for 48 h. Experiments were terminated by adding 53% ethanol. Finally, gels were imaged, and the collagen gel contraction was observed based on the area of the gels.

2.10 Immunofluorescence staining

The α-SMA expression of HSCs was evaluated by immunofluorescence (IF) staining. HSCs were harvested and washed with phosphate-buffered solution and then fixed in 4% paraformaldehyde. Next, HSCs were permeabilized with 0.5% Triton X-100 and blocked by 5% bovine serum albumin. Then, HSCs were incubated with monoclonal antibodies specific for α-SMA (1:100; Sigma-Aldrich, St. Louis, MO, USA) at 4°C for overnight followed by incubation with the secondary antibody. Finally, HSCs were observed under confocal laser scanning microscopy.

2.11 Cell invasion experiments

The cell invasion experiments were performed using the QCMTM 24-well Fluorimetric Cell Invasion Assay kit (ECM554, Chemicon International, USA) according to the manufacturer’s instructions using the Transwell system. The invading cells were stained with 4′,6-diamidino-2-phenylindole, and their number was determined by fluorescence and reported as the relative fluorescence units.

2.12 Statistical analysis

All the results are expressed as mean ± standard deviation (SD). Statistical analysis was performed using an independent Student’s t-test for comparison of two groups and one-way ANOVA following Tukey’s test for multiple comparisons. In both cases, differences of P < 0.05 were considered statistically significant.

3 Results

3.1 Activation of HSCs in vitro

To obtain activated HSCs, 10 ng/mL TGF-β1 was used to induce HSCs and changes in the indicators at different time points were observed. After induction by 10 ng/mL TGF-β1 for 72 h, the expression of fibroblast activation markers (collagen I, α-SMA, and TIMP1) in HSCs were detected by western blotting. As a result, the protein expression of collagen I, α-SMA, and TIMP1 increased with induction time (Figure 1a–d). The protein expression of collagen I and α-SMA peaked at 72 h followed by a decrease at 96 h (Figure 1a, b, and d). TIMP1 protein expression peaked at 96 h, but there was no difference from 72 h (Figure 1c and d). These results showed that 10 ng/mL TGF-β1 induction for 72 h is the optimal induction condition for HSC activation. Thus, these induction conditions were used for further studies.

Figure 1 Activation of HSCs induced by TGF-β1. HSCs were induced by 10 ng/mL TGF-β1 for 0–96 h, and HSCs at different time points were collected to extract total protein. The gray statistics of western blotting of HSCs activation markers of collagen I (a), α-SMA (b), and TIMP1 (c). (d) Gel image of collagen I, α-SMA, TIMP1, and Lox of western blotting. (e) Relative expression of NONRATT013819.2 using RT-qPCR. (f) Relative expression of lox using RT-qPCR. (g) The gray statistics of western blotting of lox in HSCs. (h) Venn diagram of miRNAs targeted by lox and NONRATT013819.2, only miR24-3p is shared by both. (i) Relative expression of miR24-3p using RT-qPCR. *P < 0.05, *P < 0.01 vs control group (0 h induction group).
Figure 1

Activation of HSCs induced by TGF-β1. HSCs were induced by 10 ng/mL TGF-β1 for 0–96 h, and HSCs at different time points were collected to extract total protein. The gray statistics of western blotting of HSCs activation markers of collagen I (a), α-SMA (b), and TIMP1 (c). (d) Gel image of collagen I, α-SMA, TIMP1, and Lox of western blotting. (e) Relative expression of NONRATT013819.2 using RT-qPCR. (f) Relative expression of lox using RT-qPCR. (g) The gray statistics of western blotting of lox in HSCs. (h) Venn diagram of miRNAs targeted by lox and NONRATT013819.2, only miR24-3p is shared by both. (i) Relative expression of miR24-3p using RT-qPCR. *P < 0.05, *P < 0.01 vs control group (0 h induction group).

3.2 lncRNA NONRATT013819.2, miR24-3p, and lox expressions were upregulated in activated HSCs

Next, we detected the expression of NONRATT013819.2 in activated HSCs. RT-qPCR showed that the NONRATT013819.2 expression was increased over time and peaked at 96 h (Figure 1e). This increase in activated HSCs is consistent with RNA sequencing data in our previous study [6]. Since we previously revealed a positive correlation between the expression levels of NONRATT013819.2 and lox, we detected the expression of lox. Interestingly, we found that the mRNA expression of lox had no obvious change in the activated HSCs (Figure 1f), but the protein expression was completely consistent with the changing trend of NONRATT013819.2 (Figure 1d and g). This prompted us to speculate that ceRNA interactions contain NONRATT013819.2 and lox. By utilizing Targetscan7.1 (http://www.targetscan.org/), we predicted a unique miRNA that could target both NONRATT013819.2 and lox, namely, miR24-3p (Figure 1h). The results showed that the expression of miR24-3p was also increased over time and peaked at 72 h (Figure 1i). Therefore, NONRATT013819.2, miR24-3p, and lox expressions were upregulated in activated HSCs. This unusual phenomenon allows us to continue exploring the relationships among them in activated HSC.

3.3 NONRATT013819.2 weakened the suppression effect of miR24-3p on lox in a ceRNA manner

Examination of the homology between miR24-3p and lox mRNA sequences showed that the six-base seed region 5′-GUAGCC-3′ is in the 3′ UTR according to the online software TargetScan (http://www.targetscan.org) (Figure 2a). Thus, an inhibitory effect of miR24-3p was inferred. Dual-luciferase assay showed that luciferase activity in the HSCs of miR24-3p mimics and miR24-3p inhibitor co-transfected with pGL3-wt-Lox was significantly lower or higher than that of pGL3-wt-Lox alone transfected group, respectively (Figure 2b). As expected, this effect could be abolished by a partial mutation in the 3′ UTR of lox mRNA (pGL3-mt-Lox group) (Figure 2b). These results confirmed the direct interaction between miR24-3p and lox.

Figure 2 lncRNA NONRATT013819.2 competitively binds miR24-3p to reduce the binding inhibition of miR24-3p on lox. (a) The binding sites of miR24-3p and lox gene in the 3′ UTR, which were predicted with TargetScan software. (b) Dual-luciferase assay verified the interaction of miR24-3p and lox. The relative activity of luciferase in each group was detected at 48 h after co-transfection. (c) The analysis of binding site between NONRATT013819.2 sequence and miR24-3p. (d) In TGF-β1-activated HSCs, the effect of silencing NONRATT013819.2 on the interaction of miR24-3p with lox was detected by dual-luciferase assay. The relative activity of luciferase in each group was detected at 48 h after co-transfection. The results were expressed as the mean ± SD from three independent experiments, *P < 0.05, **P < 0.01.
Figure 2

lncRNA NONRATT013819.2 competitively binds miR24-3p to reduce the binding inhibition of miR24-3p on lox. (a) The binding sites of miR24-3p and lox gene in the 3′ UTR, which were predicted with TargetScan software. (b) Dual-luciferase assay verified the interaction of miR24-3p and lox. The relative activity of luciferase in each group was detected at 48 h after co-transfection. (c) The analysis of binding site between NONRATT013819.2 sequence and miR24-3p. (d) In TGF-β1-activated HSCs, the effect of silencing NONRATT013819.2 on the interaction of miR24-3p with lox was detected by dual-luciferase assay. The relative activity of luciferase in each group was detected at 48 h after co-transfection. The results were expressed as the mean ± SD from three independent experiments, *P < 0.05, **P < 0.01.

In addition, there were also multiple miR24-3p seed regions in the NONRATT013819.2 sequence and the positions were relatively concentrated (Figure 2c). To investigate the effect of NONRATT013819.2 depletion on the luciferase activity of miR24-3p, we co-transfected with pshRNA-NONR and miR24-3p mimics. Compared with miR24-3p mimics co-transfected with pGL3-wt-Lox group, the intracellular luciferase activity of pshRNA-NONR and miR24-3p mimics co-transfected group was significantly decreased (Figure 2d). However, when miR24-3p mimics were replaced by miR24-3p NC, the aforementioned difference disappeared (Figure 2d). These results implied that there are interactions between NONRATT013819.2 and miR24-3p.

Importantly, these results suggested that silencing of NONRATT013819.2 exacerbated the suppressive effects of miR24-3p on lox. In addition, according to the results, silencing of NONRATT013819.2 may be responsible for the inhibitory effects of miR24-3p on lox.

3.4 Lentiviral pathway-mediated silence of NONRATT013819.2 and lox overexpression

To explore the function of NONRATT013819.2 and lox on HSCs, we constructed the lentiviruses of NONRATT013819.2 silence, lox overexpression, and control. Next, the packaged lentiviruses were tagged Lv-shRNA-NONR, Lv-lox, and Lv-NC. The proportion of cells with GFP expression was not less than 90%, indicating that the efficiency of lentiviral infection was sufficient for further studies (Figure 3a). Compared with blank HSCs (HSC) and Lv-NC group, NONRATT013819.2 expression was significantly downregulated in the Lv-shRNA-NONR group, suggesting that the silencing efficiency was high (Figure 3b). Western blot showed that protein expression of Lox in the Lv-shRNA-NONR group was significantly decreased compared to blank HSCs group or Lv-NC group, but it was significantly upregulated in the Lv-lox group, indicating the high efficiency (Figure 3c).

Figure 3 Lentiviral pathway-mediated silencing of NONRATT013819.2 and overexpression of lox gene in HSCs. (a) The lentivirus-mediated NONRATT013819.2 silencing was demonstrated by GFP green fluorescent protein (MOI = 10). (b) RT-qPCR was used to detect the relative amount of NONRATT013819.2. (c) Western blotting was used to detect the relative protein expression of Lox. *P < 0.05, **P < 0.01.
Figure 3

Lentiviral pathway-mediated silencing of NONRATT013819.2 and overexpression of lox gene in HSCs. (a) The lentivirus-mediated NONRATT013819.2 silencing was demonstrated by GFP green fluorescent protein (MOI = 10). (b) RT-qPCR was used to detect the relative amount of NONRATT013819.2. (c) Western blotting was used to detect the relative protein expression of Lox. *P < 0.05, **P < 0.01.

3.5 Silencing NONRATT013819.2 inhibited biological function in TGF-β1-activated HSCs by miR24-3p/Lox

Further, we assessed changes in the biological functions after silencing NONRATT013819.2 or overexpressing Lox in TGF-β1-activated HSCs. We found that TGF-β1 induction significantly increased the proliferation of HSCs (Figure 4a) and the proportion of cells that entered the S-phase (Figure 4b) and inhibited apoptosis in HSCs (Figure 4c). However, silencing NONRATT013819.2 reversed the aforementioned effects (Figure 4). These results suggested that silencing NONRATT013819.2 blocked the activation effects of TGF-β1 on HSCs. Moreover, TGF-β1-induced HSCs activation being dependent on NONRATT013819.2 was confirmed at the molecular level. As shown in Figure 5a, silencing NONRATT013819.2 inhibited the TGF-β1-induced increase in protein expressions of collagen I, α-SMA, and TIMP1. Thus, TGF-β1-induced myofibroblast transition of HSCs is in a NONRATT013819.2-dependent manner.

Figure 4 Silencing NONRATT013819.2 inhibited biological functions in TGF-β1-activated HSCs by miR24-3p/lox. (a) HSCs proliferation was analyzed using CCK-8 kits, and the OD value was observed at 450 nm. (b) The cell cycle of HSCs was detected by flow cytometry after silencing of NONRATT013819.2 or overexpression lox. Y-axis represents cell number. X-axis represents the DNA content dictated by the channel of FL2-A. Dp stands for Diploid. Both G1 and G2 are annotated in red, this is because the annotation of G1 and G2 is automatically defined by FACS Calibur without the confusion of cells in each phase. The * indicates comparison with group HSC; the # indicates comparison with group HSC + Lv-shRNA-NONR + TGF-β1. (c) The apoptosis HSCs was detected by flow cytometry after silencing NONRATT013819.2 or overexpression lox. The lower and upper right quadrants indicated the proportion of apoptotic cells in the early and late stages, respectively. The apoptosis rate between groups was the sum of the early and late apoptosis rates. The results were expressed as the mean ± SD from three independent experiments, # and *P < 0.05, **P < 0.01.
Figure 4

Silencing NONRATT013819.2 inhibited biological functions in TGF-β1-activated HSCs by miR24-3p/lox. (a) HSCs proliferation was analyzed using CCK-8 kits, and the OD value was observed at 450 nm. (b) The cell cycle of HSCs was detected by flow cytometry after silencing of NONRATT013819.2 or overexpression lox. Y-axis represents cell number. X-axis represents the DNA content dictated by the channel of FL2-A. Dp stands for Diploid. Both G1 and G2 are annotated in red, this is because the annotation of G1 and G2 is automatically defined by FACS Calibur without the confusion of cells in each phase. The * indicates comparison with group HSC; the # indicates comparison with group HSC + Lv-shRNA-NONR + TGF-β1. (c) The apoptosis HSCs was detected by flow cytometry after silencing NONRATT013819.2 or overexpression lox. The lower and upper right quadrants indicated the proportion of apoptotic cells in the early and late stages, respectively. The apoptosis rate between groups was the sum of the early and late apoptosis rates. The results were expressed as the mean ± SD from three independent experiments, # and *P < 0.05, **P < 0.01.

Figure 5 Silencing NONRATT013819.2 inhibited biological functions in TGF-β1-activated HSCs by miR24-3p/Lox. (a) The expression of activated characteristic proteins of collagen I, α-SMA, and TIMP1 was detected by western blotting. (b) The relative concentrations of NONRATT013819.2 and miR24-3p and Lox protein expression in each group of HSCs. The quantitative detection of NONRATT013819.2 and Lox was normalized by β-actin, and miR24-3p was normalized by U6. The results were expressed as the mean ± SD from three independent experiments, *P < 0.05, **P < 0.01.
Figure 5

Silencing NONRATT013819.2 inhibited biological functions in TGF-β1-activated HSCs by miR24-3p/Lox. (a) The expression of activated characteristic proteins of collagen I, α-SMA, and TIMP1 was detected by western blotting. (b) The relative concentrations of NONRATT013819.2 and miR24-3p and Lox protein expression in each group of HSCs. The quantitative detection of NONRATT013819.2 and Lox was normalized by β-actin, and miR24-3p was normalized by U6. The results were expressed as the mean ± SD from three independent experiments, *P < 0.05, **P < 0.01.

Subsequently, we investigated the mechanism of NONRATT013819.2-dependent myofibroblast transition of HSCs. We found that compared with NONRATT013819.2 silencing group, overexpression of Lox prominently reversed the inhibitory effects of NONRATT013819.2 silencing on protein expressions of collagen I, α-SMA, and TIMP1 (Figure 5a). These suggest that Lox is involved in the NONRATT013819.2-associated regulatory activation of HSCs. As shown in Figure 5b, silencing NONRATT013819.2 resulted in a decline in the expressions of NONRATT013819.2 and lox, whereas overexpression of lox significantly restored the expression of Lox in TGF-β1-induced HSCs. However, we observed that neither deletion of NONRATT013819.2 nor overexpression of lox altered the expression of miR24-3p (Figure 5b). This is consistent with the aforementioned results. Therefore, we hypothesized that this might be because NONRATT013819.2 only competitively binds to miR24-3p in a miRNA-sponge manner to weaken the inhibitory ability of miR24-3p to the target gene, lox, but NONRATT013819.2 does not degrade miR24-3p.

3.6 Silencing NONRATT013819.2 inhibited ECM reconstruction through Lox

As mentioned previously, silencing NONRATT013819.2 and overexpression of lox affected the protein expressions of collagen I, α-SMA, and TIMP1, which play an important role in ECM reconstruction. Therefore, we then verify whether NONRATT013819.2 could change ECM reconstruction through Lox in TGF-β1-induced HSCs. The gel contraction results showed that the diameter of gels was significantly reduced in the TGF-β1-induced group, but significantly dilated after NONRATT013819.2 silencing, suggesting that silencing NONRATT013819.2 suppressed surface tension of HSCs (Figure 6a). In contrast, overexpression of lox exaggerated gel contraction characterized by the obviously concave surface of the gels (Figure 6a). Moreover, rescue experiments showed that silencing NONRATT013819.2 while overexpressing lox partially abolished gel changes caused by treatment alone (Figure 6a). Similarly, the invasion of HSCs was significantly enhanced by TGF-β1, while silencing NONRATT013819.2 inhibited this enhancement, which also could be restored by overexpression of lox (Figure 6b). We also detected the protein expression of α-SMA in HSCs using IF. As shown in Figure 6c, silencing NONRATT013819.2 suppressed the increased trend in α-SMA protein expression in HSCs induced by TGF-β1, which was reversed by overexpression of lox. Taken together, silencing NONRATT013819.2 inhibited ECM reconstruction of HSCs induced by TGF-β1 through regulating lox.

Figure 6 Silencing NONRATT013819.2 inhibited ECM reconstruction through Lox. (a) Contraction of hydrated collagen gels induced in HSCs. (b) The migration of HSCs was detected by the Transwell method. (c) Immunofluorescence staining of α-SMA protein in HSCs. The results were expressed as the mean ± SD from three independent experiments, *P < 0.05, **P < 0.01.
Figure 6

Silencing NONRATT013819.2 inhibited ECM reconstruction through Lox. (a) Contraction of hydrated collagen gels induced in HSCs. (b) The migration of HSCs was detected by the Transwell method. (c) Immunofluorescence staining of α-SMA protein in HSCs. The results were expressed as the mean ± SD from three independent experiments, *P < 0.05, **P < 0.01.

4 Discussion

HSCs go through myofibroblast transdifferentiation to acquire a migratory, myofibroblast-like phenotype is the key step in liver fibrosis. This is a multifactorial process involving excessive proliferation, apoptotic resistance, dysregulated metabolism, and remodeling of ECM [11]. All these fibrosis-inducing pathophysiological disorders demonstrate an intimate association with abnormality in various kinds of ncRNAs (e.g., miRNA, lncRNA, and circRNA) [12]. Dramatically, differential expression of lncRNAs (e.g., ATB, MALAT1, LFAR1, AS1, p21, SCARNA10, and NONRATT013819.2) usually precedes the change in the ncRNA network, which further contributes to the progression of liver fibrogenesis [6,13,14,15]. Among them, NONRATT013819.2 has been reported to have significant upregulation during HSC-to-myofibroblast transdifferentiation [6]. In this study, we proved that silencing of NONRATT013819.2 could block myofibroblastic transition of HSCs, characterized by inhibition of proliferation; the proportion of HSCs that entered S-phase; protein expressions of collagen I, α-SMA, and TIMP1; and the promotion of apoptosis, through miR24-3p/lox axis.

In our study, on the basis of bioinformatics predictions and the results of dual-luciferase assays, we were convinced that NONRATT013819.2 interacted with miR24-3p via base complementary pairing to further regulate the lox expression in a ceRNA mechanism. CeRNA means that it can competitively abolish the inhibitory effects of miRNA on a target gene and then regulates the expression of the target gene. Therefore, in the present study, the silencing of NONRATT013819.2 was uncovered to be responsible for the inactivation of miR24-3p function on lox. Unusually, expressions of NONRATT013819.2, miR24-3p, and lox were upregulated in the TGF-β1-induced HSCs. Also, either silencing NONRATT013819.2 or overexpression of lox could not alter miR24-3p expression. The reason may lie in the fact that the sequestering of miR24-3p by NONRATT013819.2 inevitably reduces the interactions between the miR24-3p and lox, which may affect the levels of free miR24-3p instead of its overall content in HSCs due to NONRATT013819.2 only sponges, but does not affect the synthesis and degradation of miR24-3p.

Growing evidence indicates that ECM composition is a critical determinant of multiple phenotypes of HSCs (i.e., proliferation, apoptosis, migration, and contraction), which are largely based on interactions between collagen and cell adhesion molecules [16]. For instance, the pathophysiological disorder of contraction of hydrated collagen gel underlies portal hypertension during the progression of liver fibrosis/cirrhosis [17]. Furthermore, an interaction of ECM (including collagens I/III, fibronectin, α-SMA, etc.) and myofibroblasts has been proved to exert important effects on the phenotypes and functions of myofibroblasts [18]. Myofibroblasts with activated phenotype induced the excessive deposition and altered the composition of ECM, which further promoted the fibrosis-inducing characteristics of myofibroblasts [18]. Therefore, in our study, increased protein expressions of collagen I, α-SMA, and TIMP1, and gel contraction were considered to be a feature of myofibroblastic transition of the HSCs.

Recently, Lox and Lox-like (LoxL) isoforms 1–3 have been shown to be involved in liver fibrosis [19]. In Cav-1−/− or periostin−/− mice with CCl4 exposure, the hepatic expression of Lox is upregulated with the exacerbation of fibrosis [19,20,21]. In contrast, administration of Lox inhibitor, β-aminopropionitrile, suppressed the accumulation of cross-linked collagens and the stiffness of collagen fibril in the ECM, accelerating fibrosis reversal after CCl4 withdrawal [22,23]. Mechanistically, activation of Lox family proteins (i.e., Lox and LoxLs) mediates the deoxypyridinoline and pyridinoline crosslinks in collagen, and the increase in collagen crosslinking promotes its stabilization and contributes to the irreversibility of fibrosis [24,25]. In addition, Lox and LoxLs are responsible for the tropoelastin crosslinking and polymerization of elastin that forms fibrosis-related elastic fibers [26]. Therefore, Lox promotes liver fibrosis and prevents spontaneous reversal via collagen. This conclusion is supported by our results. In the present study, overexpression of Lox synergistically promoted the activation of TGF-β1 on HSCs, characterized by increased protein expressions of collagen I, α-SMA, and TIMP1, and these effects were reversed by silencing NONRATT013819.2. Consequently, the promoting role of NONRATT013819.2 in the myofibroblastic transition of HSCs is mediated by Lox/collagen.

Numerous studies have shown that miR24-3p is involved in a wide range of human diseases, including those associated with abnormal collagen synthesis. The miR24-3p has been demonstrated to be significantly upregulated in HCV-positive hepatocellular carcinoma as compared to the control [27]. Yang et al. proved that overexpression of miR24-3p regulated collagen synthesis and skin barrier [28]. In addition, overexpression of miR24-3p elevated the protein expression of collagen type II to weaken cartilage degradation induced by IL-1β [29]. In this study, a significant increase in collagen I was observed to be accompanied by abnormal upregulation of miR24-3p, suggesting an association between them. Based on the aforementioned ceRNA theory, we concluded that NONRATT013819.2 and miR24-3p competitively binding to lox is the possible mechanism of collagen I responding to TGF-β1 induction.

In conclusion, TGF-β1-induced activation of HSCs resulted in expression of NONRATT013819.2 and lox was upregulated, and proteins of myofibroblast markers also accumulated, which may contribute to increased proliferation, apoptosis resistance, migration, and contraction of activated HSCs. NONRATT013819.2 exerts the aforementioned effects by eliminating the inhibition of lox expression by miR24-3p. Thus, NONRATT013819.2/miR24-3p/Lox signaling is a novel pathway involved in the myofibroblastic transition of HSCs, and we proposed a possible NONRATT013819.2-targeting strategy for the management of myofibroblastic transition and even the treatment of liver fibrosis.

tel: +86-18918020021
tel: +8621-63200874, fax: +8621-63200874

Acknowledgements

Not applicable.

  1. Funding information: This work was supported by the National Natural Science Foundation of China [81570544; 82170615].

  2. Conflict of interest: The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

  3. Data availability statement: The data used to support the findings of this study are available from the corresponding author upon request.

Appendix

Table A1

Primers used in used in this study

Gene Function Number gene primer (5′ → 3′)
NONRATT013819.2 RT-qPCR F: TCCTTCGCGGGATCTGAGT
R: CCCGGCTCGTCCCTTCT
Lox RT-qPCR F: GTTGAGTCCCGGATGTTATGA
R: AGCTGGGGTTTACACTGACCT
β-actin RT-qPCR F: TGTACGTAGCCATCCAGGC
R: AACCCTCATAGATGGGCACAGTG
miR-24-3p RT-qPCR F: GTGCTCGCTTCGGCAGCACAT
R: GACAAGGACGACTTGACTCGGT
U6 RT-qPCR F: GCTTCGGCAGCACATATACTAAAAT
R: CGCTTCACGAATTTGCGTGTCAT
Lox PCR for lentiviral vector F: GGAATTCGCCACCATGCGTTTCGCCTGGACC
R: CGGGATCCCTAATACGGTGAAATGGTGCAG
Lox PCR for luciferase vector F: GCTCTAGAAAGAAGCTCACTTCCCAAAGG
R: GCTCTAGATTCATAAAGCAACATGAATAAG
NONRATT013819.2 siRNA siRNA GTAGTGAGTTCACTTTCAC
NONRATT013819.2 siRNA shRNA-DNA GTAGTGAGTTCACTTTCACCTTCCTGTCAGA
GTAGTGAGTTCAC
NC-siRNA siRNA GTACACTATTAGTCGTCTG
NC-siRNA shRNA-DNA GTACACTATTAGTCGTCTGCTTCCTGTCAGA
CAGACGACTAATAGTGTAC
miR-24-3p mimic Luciferase assay CCCAGUGUUCAGACUACCUGUUCtt
miR-24-3p inhibitor Luciferase assay GAACAGGUAGUCUGAACACUGGGtt
miR-24-3p NC Luciferase assay CCCAGUGUUCAGACUACCUGUUCtt

F: forward primer; R: reverse primer. Annealing temperature of NONRATT013819.2, Lox, β-actin miR-24-3p, and U6 was 60°C for RT-qPCR.

References

[1] Dewidar B, Meyer C, Dooley S, Meindl-Beinker AN. Tgf-beta in hepatic stellate cell activation and liver fibrogenesis-updated 2019. Cells. 2019;8(11):1419. 10.3390/cells8111419.Search in Google Scholar

[2] Zhang QD, Xu MY, Cai XB, Qu Y, Li ZH, Lu LG. Myofibroblastic transformation of rat hepatic stellate cells: The role of notch signaling and epithelial-mesenchymal transition regulation. Eur Rev Med Pharmacol Sci. 2015;19(21):4130–8.Search in Google Scholar

[3] Huang YH, Chen MH, Guo QL, Chen ZX, Chen QD, Wang XZ. Interleukin-10 induces senescence of activated hepatic stellate cells via stat3-p53 pathway to attenuate liver fibrosis. Cell Signal. 2020;66:109445. 10.1016/j.cellsig.2019.109445.Search in Google Scholar

[4] Ma Z, Wang YY, Xin HW, Wang L, Arfuso F, Dharmarajan A, et al. The expanding roles of long non-coding rnas in the regulation of cancer stem cells. Int J Biochem Cell Biol. 2019;108:17–20. 10.1016/j.biocel.2019.01.003.Search in Google Scholar

[5] Kong Y, Huang T, Zhang H, Zhang Q, Ren J, Guo X, et al. The lncrna neat1/mir-29b/atg9a axis regulates igfbprp1-induced autophagy and activation of mouse hepatic stellate cells. Life Sci. 2019;237:116902. 10.1016/j.lfs.2019.116902.Search in Google Scholar

[6] Guo CJ, Xiao X, Sheng L, Chen L, Zhong W, Li H, et al. Rna sequencing and bioinformatics analysis implicate the regulatory role of a long noncoding rna-mrna network in hepatic stellate cell activation. Cell Physiol Biochem. 2017;42(5):2030–42. 10.1159/000479898.Search in Google Scholar

[7] Tay Y, Rinn J, Pandolfi PP. The multilayered complexity of cerna crosstalk and competition. Nature. 2014;505(7483):344–52. 10.1038/nature12986.Search in Google Scholar

[8] Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A cerna hypothesis: The rosetta stone of a hidden rna language? Cell. 2011;146(3):353–8. 10.1016/j.cell.2011.07.014.Search in Google Scholar

[9] Friedman SL, Roll FJ, Boyles J, Arenson DM, Bissell DM. Maintenance of differentiated phenotype of cultured rat hepatic lipocytes by basement membrane matrix. J Biol Chem. 1989;264(18):10756–62.10.1016/S0021-9258(18)81686-6Search in Google Scholar

[10] Guo CJ, Pan Q, Jiang B, Chen GY, Li DG. Effects of upregulated expression of microrna-16 on biological properties of culture-activated hepatic stellate cells. Apoptosis. 2009;14(11):1331–40. 10.1007/s10495-009-0401-3.Search in Google Scholar PubMed

[11] Moran-Salvador E, Garcia-Macia M, Sivaharan A, Sabater L, Zaki MYW, Oakley F, et al. Fibrogenic activity of mecp2 is regulated by phosphorylation in hepatic stellate cells. Gastroenterology. 2019;157(5):1398–412 e9. 10.1053/j.gastro.2019.07.029.Search in Google Scholar PubMed PubMed Central

[12] Koduru SV, Leberfinger AN, Kawasawa YI, Mahajan M, Gusani NJ, Sanyal AJ, et al. Non-coding rnas in various stages of liver disease leading to hepatocellular carcinoma: Differential expression of mirnas, pirnas, lncrnas, circrnas, and sno/mt-rnas. Sci Rep. 2018;8(1):7967. 10.1038/s41598-018-26360-1.Search in Google Scholar PubMed PubMed Central

[13] Peng H, Wan LY, Liang JJ, Zhang YQ, Ai WB, Wu JF. The roles of lncrna in hepatic fibrosis. Cell Biosci. 2018;8:63. 10.1186/s13578-018-0259-6.Search in Google Scholar PubMed PubMed Central

[14] Zhang K, Han Y, Hu Z, Zhang Z, Shao S, Yao Q, et al. Scarna10, a nuclear-retained long non-coding rna, promotes liver fibrosis and serves as a potential biomarker. Theranostics. 2019;9(12):3622–38. 10.7150/thno.32935.Search in Google Scholar PubMed PubMed Central

[15] Zhang K, Han X, Zhang Z, Zheng L, Hu Z, Yao Q, et al. The liver-enriched lnc-lfar1 promotes liver fibrosis by activating tgfbeta and notch pathways. Nat Commun. 2017;8(1):144. 10.1038/s41467-017-00204-4.Search in Google Scholar PubMed PubMed Central

[16] Puente A, Fortea JI, Cabezas J, Arias Loste MT, Iruzubieta P, Llerena S, et al. Loxl2-a new target in antifibrogenic therapy? Int J Mol Sci. 2019;20(7):1634. 10.3390/ijms20071634.Search in Google Scholar PubMed PubMed Central

[17] Guo CJ, Pan Q, Xiong H, Qiao YQ, Bian ZL, Zhong W, et al. Dynamic expression of mir-126* and its effects on proliferation and contraction of hepatic stellate cells. FEBS Lett. 2013;587(23):3792–801. 10.1016/j.febslet.2013.09.047.Search in Google Scholar PubMed

[18] Novo E, Cannito S, Morello E, Paternostro C, Bocca C, Miglietta A, et al. Hepatic myofibroblasts and fibrogenic progression of chronic liver diseases. Histol Histopathol. 2015;30(9):1011–32. 10.14670/HH-11-623.Search in Google Scholar PubMed

[19] Ji DG, Zhang Y, Yao SM, Zhai XJ, Zhang LR, Zhang YZ, et al. Cav-1 deficiency promotes liver fibrosis in carbon tetrachloride (ccl4)-induced mice by regulation of oxidative stress and inflammation responses. Biomed Pharmacother. 2018;102:26–33. 10.1016/j.biopha.2018.03.016.Search in Google Scholar PubMed

[20] Hall C, Ehrlich L, Meng F, Invernizzi P, Bernuzzi F, Lairmore TC, et al. Inhibition of microrna-24 increases liver fibrosis by enhanced menin expression in mdr2(-/-) mice. J Surg Res. 2017;217:160–69. 10.1016/j.jss.2017.05.020.Search in Google Scholar PubMed PubMed Central

[21] Kumar P, Smith T, Raeman R, Chopyk DM, Brink H, Liu Y, et al. Periostin promotes liver fibrogenesis by activating lysyl oxidase in hepatic stellate cells. J Biol Chem. 2018;293(33):12781–92. 10.1074/jbc.RA117.001601.Search in Google Scholar PubMed PubMed Central

[22] Liu SB, Ikenaga N, Peng ZW, Sverdlov DY, Greenstein A, Smith V, et al. Lysyl oxidase activity contributes to collagen stabilization during liver fibrosis progression and limits spontaneous fibrosis reversal in mice. FASEB J. 2016;30(4):1599–609. 10.1096/fj.14-268425.Search in Google Scholar PubMed

[23] Iwasaki A, Sakai K, Moriya K, Sasaki T, Keene DR, Akhtar R, et al. Molecular mechanism responsible for fibronectin-controlled alterations in matrix stiffness in advanced chronic liver fibrogenesis. J Biol Chem. 2016;291(1):72–88. 10.1074/jbc.M115.691519.Search in Google Scholar PubMed PubMed Central

[24] van der Slot AJ, Zuurmond AM, van den Bogaerdt AJ, Ulrich MM, Middelkoop E, Boers W, et al. Increased formation of pyridinoline cross-links due to higher telopeptide lysyl hydroxylase levels is a general fibrotic phenomenon. Matrix Biol. 2004;23(4):251–7. 10.1016/j.matbio.2004.06.001.Search in Google Scholar PubMed

[25] Zhang Y, Ghazwani M, Li J, Sun M, Stolz DB, He F, et al. Mir-29b inhibits collagen maturation in hepatic stellate cells through down-regulating the expression of hsp47 and lysyl oxidase. Biochem Biophys Res Commun. 2014;446(4):940–4. 10.1016/j.bbrc.2014.03.037.Search in Google Scholar PubMed PubMed Central

[26] Kanta J. Elastin in the liver. Front Physiol. 2016;7:491. 10.3389/fphys.2016.00491.Search in Google Scholar PubMed PubMed Central

[27] Oksuz Z, Serin MS, Kaplan E, Dogen A, Tezcan S, Aslan G, et al. Serum micrornas; mir-30c-5p, mir-223-3p, mir-302c-3p and mir-17-5p could be used as novel non-invasive biomarkers for hcv-positive cirrhosis and hepatocellular carcinoma. Mol Biol Rep. 2015;42(3):713–20. 10.1007/s11033-014-3819-9.Search in Google Scholar PubMed

[28] Yang Z, Duan X, Wang X, Li D, Xu Q, Xiang S, et al. The effect of q-switched 1064-nm dymium-doped yttrium aluminum garnet laser on the skin barrier and collagen synthesis through mir-24-3p. Lasers Med Sci. 2021;37:205–14. 10.1007/s10103-020-03214-9.Search in Google Scholar PubMed PubMed Central

[29] Xu J, Qian X, Ding R. Mir-24-3p attenuates il-1beta-induced chondrocyte injury associated with osteoarthritis by targeting bcl2l12. J Orthop Surg Res. 2021;16(1):371. 10.1186/s13018-021-02378-6.Search in Google Scholar PubMed PubMed Central

Received: 2021-09-22
Revised: 2022-02-06
Accepted: 2022-02-22
Published Online: 2022-04-04

© 2022 Can-Jie Guo et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0460
Keywords for this article
liver fibrosis; NONRATT013819.2/miR24-3p/lox; ECM reconstruction; cytoskeleton markers; proliferation; apoptosis; cell cycle
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 10.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0460/html
Scroll to top button