Startseite Medizin TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
Artikel Open Access

TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway

  • Maoling Zhu EMAIL logo , Bowen Shi , Chunguang Li und Shuchang Xu EMAIL logo
Veröffentlicht/Copyright: 2. Dezember 2022
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 17 Heft 1

Abstract

Ten–eleven translocation 3 (TET3) participates in tumorigenesis and malignant transformation by mediating DNA demethylation and specific gene activation in malignances. This study aims to elucidate its molecular function and regulatory mechanism in esophageal squamous cell carcinoma (ESCC). Stable ESCC cells that infected with TET3 overexpression (OE) and knockdown lentiviral vector had been established. The biological behaviors and molecular mechanism of TET3 were demonstrated by cell biology experiments in vitro and in vivo. Tissues from patients with ESCC were used to demonstrate the clinical value of TET3. Our findings revealed that TET3 is highly expressed in ESCC tissues and related to poor prognosis of patients with ESCC. OE of TET3 presented a significant effect on proliferation, metastatic potential, and spheroid formation of ESCC cells by activating the PI3K/AKT/GSK3β/β-catenin axis. Knockdown of TET3 could remarkably reverse these malignant phenotypes. Patients with ESCC with high TET3 expression resulted in a shorter overall survival (OS) and disease-free survival. Based on the multivariate analysis, TET3 could be an independent favorable factor for predicting OS and recurrence. The high expression of TET3 not only aggravates malignant behaviors in vitro and in vivo but also becomes a novel biomarker for clinical monitoring and individualized precision treatment for patients with ESCC.

Keywords: ten–eleven translocation 3; esophageal squamous cell carcinoma; PI3K/AKT/GSK3β/β-catenin pathway; prognosis

1 Introduction

Esophageal cancer (EC) is a malignant tumor derived from epithelial cells, in which incidence and mortality are seventh and sixth, respectively, in global human cancers [1]. Due to the insidious onset of EC, a considerable number of patients with EC have developed to advanced stages at their first diagnosis. Postoperative metastasis and recurrence are the key factors seriously restricting the prognosis and long-term survival of patients with EC [2,3,4,5]. Histologically, EC can be divided into esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma, among which ESCC is currently the main histological type in China and western countries [6]. Up to now, surgery is still the first choice for clinical radical treatment of ESCC in combination with adjuvant therapy [7,8]. Despite the continuous improvement in the clinical early diagnosis and combined treatment of EC, the prognosis is still far from satisfactorily [9]. Elucidating the underlying mechanism will undoubtedly benefits the clinical prevention and targeted therapies of ESCC.

The formation, evolution, Infiltration and metastasis of ESCC are complex biological processes involving multi-molecular participation and mutual regulation, among which epigenetic variation and modification might play a crucial role [10]. Ten–eleven translocation (TET) family members are newly identified DNA demethylases including TET1, TET2, and TET3. The main biological function of TETs is converting 5-methylcytosine to generate 5-hydroxymethylcytosine, thereby mediating DNA demethylation and specific gene activation [11]. Dysregulation of TETs in several malignant tumors has been reported, including breast cancer [12], hepatocellular carcinoma [13], melanoma [14], glioma [15], renal cell carcinoma [16], and colorectal cancer [17]. Although accumulating evidence has shown that TETs are associated with tumorigenesis and progression, the specific mechanism remains highly mysterious.

In this present study, we confirmed that TET3 was overexpressed in ESCC. Further studies identified that PI3K/AKT/GSK3β/β-catenin pathway drives ESCC through TET3 regulation for stem cell-like maintenance and survival. TET3 has the potential to become a new biomarker or a therapeutic target for ESCC.

2 Materials and methods

2.1 Patients and collection of tissue samples

ESCC tissue samples and paired para-cancerous tissue samples (n = 62) were enrolled from patients, which were pathologically diagnosed as primary ESCC and received surgical resection from March 2013 to January 2014 at Changhai Hospital, Navy Military Medical University (Shanghai, China). All of the patients did not receive preoperative adjuvant therapy including radiotherapy, chemotherapy, or biotherapy. The extraction of total RNA from ESCC tissues was carried out by conventional steps and detected by using the quantitative real-time PCR (RT-qPCR) assay. The extraction of total protein from 7 pairs of ESCC tissues was conducted and detected by using the western blot assay. All clinical samples were pathologically confirmed by two independent pathologists and was followed up until January 2019.

2.2 Immunohistochemistry (IHC)

We adopted IHC to evaluate the protein expression of TET3 in ESCC tissues. The embedded tissues were cut into 4-µm-thick serial sections. The information of antibodies is listed as follows: anti-TET3 antibody (dilution, 1:300; ab153724; Abcam; UK), anti-EpCAM antibody (dilution, 1:500; ab221552; Abcam), anti-β-catenin antibody (dilution, 1:500; ab32572; Abcam), anti-p-AKT (T308) antibody (dilution, 1:100; ab38449; Abcam), anti-p-AKT (S473) antibody (dilution, 1:100; ab81283; Abcam), anti-p-GSK3β (Tyr216 + Tyr279) antibody (dilution, 1:200; ab68476; Abcam), anti-p-GSK3β (Ser9) antibody (dilution, 1:200; ab75814; Abcam), anti-GSK3β antibody (dilution, 1:5,000; ab32391; Abcam), and anti-AKT antibody (dilution, 1:1,000; ab8805; Abcam). We replaced the primary antibody with phosphate-buffered solution as the negative control. The results were reviewed and evaluated by two experienced pathologists. The number and proportion of positive cells was evaluated by analyzing 10 randomly fields. And the immunoreactive scoring was performed based on a quick scoring system. According to the intensity of protein staining, we divided all samples into four grades: 0 indicated no staining, 1 indicated weak staining, 2 indicated intermediate staining, and 3 indicated strong staining. Percentage scores were evaluated as 0 (0%), 1 (1–25%), 2 (25–50%), 3 (50–75%), and 4 (75–100%). We multiply the staining intensity grade by the percentage score, and the median value of total scores was identified as the optimal cutoff value. A score of >4 was considered as high expression.

2.3 Cell culture

Human normal esophageal epithelial cell line (HEEC) was used as normal cell. ESCC cell lines Eca109 and TE1 were obtained from Shanghai Cell Bank of Chinese Academy of Sciences (Shanghai, China), which were conventionally cultured in RPMI 1640 (GIBCO, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (GIBCO, USA) at 37°C in 5% CO2.

2.4 Spheroid formation assay

For spheroid formation, ESCC cells with different treatment groups were digested into suspensions and then seeded in ultra-low adhesion cell plates (Corning, USA) with complete medium (1 × 103 cells/well). The number of spheroid clusters was counted every other day until day 7.

2.5 Overexpression (OE) and knockdown of TET3

For TET3 OE, lentiviral vector (pLV-EF1α-EGFP-N plasmid; Inovogen, VL3311) containing full-length human TET3 cDNA (NM_001287491.2) and puromycin resistance gene was imported in 293T cells using cloned or purchased vectors. The shRNA1 and shRNA2 were designed and constructed into pLKO.1 plasmids (Addgene, Plasmid #10878) as TET3 knockdown vectors. The non-targeting RNA (ntRNA, pLKO) (GCGCGATAGCGCTAATAATTT), shRNA1 (GAACCTTCTCTTGCGCTATTT) (KD1), and shRNA2 (ACTCCTACCACTCCTACTATG) (KD2) sequences were cloned into vector, and Eca109 or TE1 cells were infected with shRNA or TET3-OE lentiviruses (MOI = 20). The cell sublines with OE or KD of TET3 were confirmed by the western blot assay.

2.6 RT-qPCR

The extraction of total RNA from cells and tissue samples was conducted by using TRIzol reagent (Invitrogen, USA) conventionally. We evaluated the quality and concentration of extracted RNA by detecting the absorbance of RNA solution (OD260/OD280). RT-qPCR was carried out by using a SYBR Premix Ex Taq™ II kit (Takara, China). Expression value of target gene was calculated automatically using 2−ΔΔCt. PCR primers for TET3 and GAPDH were synthesized (Sangon, China) as follows: TET3: forward 5′-GTTCCTGGAGCATGTACTTC-3′ and reverse 5′-CTTCCTCTTTGGGATTGTCC-3′; GAPDH: forward 5′-CACCCACTCCTCCACCTTTG-3′ and reverse 5′-CCACCACCCTGTTGCTGTAG-3′.

2.7 Western blot analysis

The extraction of total protein from cells and tissue samples was performed by radio-imunoprecipitation assay lysis buffer with 1% phenylmethanesulfonyl fluoride, 1% phosphatase inhibitor, and 1% protease inhibitor (Beyotime Biotech, China). The experimental procedure was carried out as usual. The information of antibodies is listed as follows: anti-TET3 antibody (dilution, 1:1,000; ab153724; Abcam), anti-β-catenin antibody (dilution, 1:2,000; ab32572; Abcam), anti-p-AKT (T308) antibody (dilution, 1:1,000; ab38449; Abcam), anti-p-AKT (S473) antibody (dilution, 1:1,000; ab81283; Abcam), anti-p-GSK3β (Tyr216 + Tyr279) antibody (dilution, 1:2,000; ab68476; Abcam), anti-p-GSK3β (Ser9) antibody (dilution, 1:2,000; ab75814; Abcam), anti-GSK3β antibody (dilution, 1:5,000; ab32391; Abcam), anti-AKT antibody (dilution, 1:1,000; ab8805; Abcam), and anti-GAPDH antibody (dilution, 1:5,000; ab9482; Abcam).

2.8 Colony formation assay

ESCC cells (1 × 103 cells/well) were seeded into six-well culture plates with complete medium. Cell colonies were fixed with 4% formaldehyde and stained with crystal violet staining solution (Beyotime Biotech) after culturing for 2 weeks. The number of clones was counted by using light microscope. Three independent experiments in each group were carried out.

2.9 Cell migration and invasion assay

The experimental procedure was conducted conventionally. In wound-healing assays, ImageJ software (V1.8.0, NIH, USA) was adopted to measure the injury aera. In Transwell assay, cells that passed through upper chambers were fixed using methyl alcohol and stained with crystal violet staining solution (Beyotime Biotech). Three independent experiments in each group were carried out.

2.10 Cellular immunofluorescence

The cell spheroids were collected after 7 days culture and identified by cellular immunofluorescence detection. The experimental procedure was carried out as usual. The information of antibodies is listed as follows: anti-EpCAM antibody (dilution, 1:100; ab221552; Abcam), anti-β-catenin antibody (dilution, 1:250; ab32572; Abcam), and anti-CD133 antibody (dilution, 1:200; D2V8Q; CST, USA).

2.11 Animal experiment

Animal experiments have been complied with the permission approved by the Committee on Ethics of Medicine, Navy Military Medical University. All animals were raised under SPF condition, all experimental procedures were in accordance with the criteria. Twenty-six-week-old BALB/c male nude mice were randomly divided into four groups (five mice/each group): control group (EGFP), TET3-OE group (OE), control group (pLKO), and TET3-knockdown group (KD1). In subcutaneous model, ESCC cells (1 × 107 cells/mouse) were subcutaneously injected into each mouse and raised for 42 days. After that, mice were sacrificed painlessly and tumor volume and weight were calculated. In the lung metastasis model, ESCC cells (5 × 105 cells/mouse) were injected into the tail vein and raised for 30 days. Mice were sacrificed and dissected to assess the number of metastatic nodules in lungs.

2.12 Statistical analysis

GraphPad Prism 5.0 software and SPSS 22.0 software were used for statistical analysis. Data were presented as mean ± standard deviation. Statistical differences between groups were tested by using Student’s t-test or one-way analysis of variance test. Kaplan–Meier survival method was used to analyze survival condition. P < 0.05 indicated that the difference was statistically significant.

  1. Ethics statement: The collection and use of clinical resources, including ESCC tissue samples and follow-up data, and in vivo animal models, which performed in accordance with guidelines, was complied with the permission of Biomedical Ethics Committee of Navy Military Medical University (Approval Number: CHEC2020-021; date: 06/02/2020; Shanghai, China). The written consent from each patient has been obtained in accordance with the Declaration of Helsinki.

3 Results

3.1 TET3 is overexpressed in ESCC

Based on the data from UALCAN (Data from TCGA database) (http://ualcan.path.uab.edu), we compared the mRNA expression of TET3 between ESCA tissues (n = 184) and normal tissues (n = 11). The results revealed that the expression of TET3 was elevated in tumors than that in normal tissues (P = 0.00252) (Figure A1(a)). We further focus on the correlation between the mRNA levels of TET3 and the survival time of patients with ESCA by using publicly available datasets (UALCAN). The results indicated that patients with ESCA with the high expression of TET3 mRNA were correlated with shorter survival time (P = 0.048) (Figure A1(b)).

To confirm the above conclusion, we detected the protein expression of TET3 in 62 ESCC samples and para-cancerous tissues by using IHC. The results suggested that TET3 was located in cytoplasm and nuclei, which were elevated in ESCC tissues compared with paired para-cancerous tissues (Figure 1a and b). We collected seven pairs of freshly surgically resected ESCC tissues and extracted total RNA and protein using the RT-qPCR assay and the western blot analysis, respectively. Our results revealed that the protein and mRNA levels of TET3 were dramatically up-regulated in ESCC tissues (Figure 1c–e). Meanwhile, the protein and mRNA expression of TET3 in ESCC cell lines (TE1 and Eca109) were up-regulated compared with normal HEEC (Figure 1f–h). According to these results, we confirmed that TET3 was abnormally up-regulated in ESCC.

Figure 1 TET3 is up-regulated in ESCC. (a) Representative fields of TET3 protein level in ESCC tissue samples (scale bar = 50 μm). (b) Statistical analysis of the proportion of positive cells in immunohistochemical results of ESCC tissue sections. (c) Protein levels of TET3 in paired ESCC tissues (n = 7). (d) Statistical analysis of the protein levels of TET3 in paired ESCC samples (n = 7). (e) RT-qPCR assays were used to measure TET3 mRNA in ESCC tissues. (f) Protein levels of TET3 in ESCC cell lines. (g) Statistical analysis of the protein expression levels of TET3 in ESCC cell lines. (h) RT-qPCR assays were used to detect TET3 mRNA in ESCC tissues. *P < 0.05, ***P < 0.001. N, non-tumor tissue; T, tumor tissue.
Figure 1

TET3 is up-regulated in ESCC. (a) Representative fields of TET3 protein level in ESCC tissue samples (scale bar = 50 μm). (b) Statistical analysis of the proportion of positive cells in immunohistochemical results of ESCC tissue sections. (c) Protein levels of TET3 in paired ESCC tissues (n = 7). (d) Statistical analysis of the protein levels of TET3 in paired ESCC samples (n = 7). (e) RT-qPCR assays were used to measure TET3 mRNA in ESCC tissues. (f) Protein levels of TET3 in ESCC cell lines. (g) Statistical analysis of the protein expression levels of TET3 in ESCC cell lines. (h) RT-qPCR assays were used to detect TET3 mRNA in ESCC tissues. *P < 0.05, ***P < 0.001. N, non-tumor tissue; T, tumor tissue.

3.2 TET3 promotes the proliferation and metastasis of ESCC cell lines in vitro and in vivo

To explore the biological function of TET3, endogenous OE and knockdown cell sublines were established in TE1 and Eca109. The exogenous TET3-EGFP was stably expressed in TE1 (OE) and Eca109 (OE). The transcription level of TET3 was stably down-regulated by two different shRNA vectors in TE1 (KD) and Eca109 (KD). Fluorescence microscopy showed that TET3 was located in cytoplasm and nuclei (Figure A2(a)). The OE and knockdown level of TET3 in ESCC cells were confirmed by the western blot analysis (Figure A2(b)).

Colony formation, Transwell, and wound-healing assays were employed to evaluate the proliferation and motility of TET3-OE/KD Eca109 and TE1 cells. Our results found that the OE of TET3 significantly promoted the ability of proliferation and the motility of ESCC cells, while knockdown of TET3 exhibited the opposite outcomes (Figure 2a–c).

Figure 2 High expression of TET3 promotes the viability and motility of ESCC cells in vitro. (a) TET3 increased the colony formation ability of ESCC cells. (b) TET3 elevates the invasion abilities of ESCC cells that were evaluated by Transwell chamber assays. (c) Cell wound-healing assays were conducted to measure the migration potential of ESCC cells. *P < 0.05.
Figure 2

High expression of TET3 promotes the viability and motility of ESCC cells in vitro. (a) TET3 increased the colony formation ability of ESCC cells. (b) TET3 elevates the invasion abilities of ESCC cells that were evaluated by Transwell chamber assays. (c) Cell wound-healing assays were conducted to measure the migration potential of ESCC cells. *P < 0.05.

Animal models by subcutaneous and tail vein injection in nude mice were established to evaluate the function of TET3 on tumorigenicity and metastatic potential of ESCC cells in vivo. The results revealed that the tumor volume and weight in TET3-OE group were significantly larger than those in the control group (Figure 3a–c). By contrary, the tumor volume and weight in TET3-KD group were significantly decreased compared with those in the control group (Figure 3d–f). HE staining showed that the number of metastatic nodules in lung tissues of TET3-OE group was statistically more than that in the control group, and TET3-KD group had the least number of lung metastatic nodules (Figure 3g–j). Our present results suggested that the high expression of TET3 could promote the proliferation and metastasis potential of ESCC cells in vitro and in vivo.

Figure 3 TET3 promotes proliferation and metastasis of ESCC cells in vivo. (a–f) Eca109 treated with OE and knockdown of TET3 subcutaneously injected in nude mice to construct animal model. Tumor volumes and weights were measured. n = 5 mice per each group. (g–j) Representative fields of metastatic tumor nodules in lung of each group of nude mice (scale bar = 50 μm). The numbers of metastatic tumor nodules in lung were statistically analyzed. Five mice per each group. *P < 0.05.
Figure 3

TET3 promotes proliferation and metastasis of ESCC cells in vivo. (a–f) Eca109 treated with OE and knockdown of TET3 subcutaneously injected in nude mice to construct animal model. Tumor volumes and weights were measured. n = 5 mice per each group. (g–j) Representative fields of metastatic tumor nodules in lung of each group of nude mice (scale bar = 50 μm). The numbers of metastatic tumor nodules in lung were statistically analyzed. Five mice per each group. *P < 0.05.

3.3 TET3 promotes spheroid formation of ESCC cells in vitro

To further explore the effect of TET3 on the maintenance of stem cell-like characteristics in ESCC cells, we examined the expression of candidate cancer stem cell (CSC) markers. Three-dimensional spheroid formation assay was used to evaluate the spheroidizing potential of ESCC cells. In the TET3-OE group, the ability of tumor cells to form spheroids was increased. Down-regulation of TET3 inhibited the formation of spheroids (Figure 4a). The stem cell markers in ESCC cell spheroids were measured by immunofluorescence staining, and we found that the stem cell markers, including EpCAM, β-catenin, and CD133 were positive (Figure 4b). While knockdown of TET3 down-regulated the protein level of β-catenin and CD133 in spheroids. These results demonstrated that the spheroids have the characteristics of stem cells (Figure 4b). Down-regulation of TET3 could inhibit the formation of ESCC cell spheroids and decreased the expression level of CSC markers. In summary, high expression of TET3 could promote the formation of spheroids and the maintenance of stem cell-like characteristics in ESCC cells.

Figure 4 TET3 promotes ESCC cell spheroid formation. (a) Three-dimensional spheroid assay was conducted to measure the spheroidizing ability of ESCC cells. (b) Immunofluorescence of stem cell markers, including EpCAM, β-catenin, and CD133, in Eca109, scale bar = 50 μm, *P < 0.05 vs control group.
Figure 4

TET3 promotes ESCC cell spheroid formation. (a) Three-dimensional spheroid assay was conducted to measure the spheroidizing ability of ESCC cells. (b) Immunofluorescence of stem cell markers, including EpCAM, β-catenin, and CD133, in Eca109, scale bar = 50 μm, *P < 0.05 vs control group.

3.4 TET3 enhances the malignant transformation of ESCC cells by activating the PI3K/AKT/GSK3β/β-catenin axis

It has been widely recognized that PI3K/AKT signaling pathway could participate in the malignant progression of a variety of human tumors by regulating the growth of tumor cells, invasion, metastasis, and angiogenesis and maintaining the characteristics of tumor stem cells [18,19]. GSK3β is a crucial substrate in the PI3K/AKT signaling pathway and regulates several physiological processes, such as the activity of mitochondria [20].

Based on IHC results of serial tissue sections of ESCC, the protein level of p-AKT (T308), p-AKT (S473), EpCAM, and β-catenin was up-regulated; meanwhile, p-GSK3β (Tyr216 + Tyr279) and p-GSK3β (Ser9) are relatively low (Figure 5a). In addition, the up-regulation of TET3 led to a significant increase in p-AKT (T308), p-AKT (S473), and β-catenin while inhibited the expression of p-GSK3β (Tyr216 + Tyr279) and p-GSK3β (Ser9) in ESCC cells. Knockdown of TET3 expression led to the activation of the expression of p-GSK3β (Ser9); meanwhile, it down-regulated p-AKT (T308), p-AKT (S473), and β-catenin, but the expression changes in p-GSK3β (Tyr216 + Tyr279) were not obvious (Figure 5b). According to these results, we could infer that TET3 inhibits the phosphorylation level of GSK3β (especially on Ser9 site) through the activated PI3K/AKT signaling pathway, enhancing the stability of β-catenin in cancer cells and subsequently participating in downstream gene transcription related to cell proliferation and metastasis.

Figure 5 TET3 increased the viability, motility, and stem cell characteristics of ESCC cells by regulating the PI3K/AKT/GSK3β/β-catenin axis. (a) Representative fields of signaling pathway-related protein expression, including TET3, EpCAM, β-catenin, p-AKT (T308 and S473), and p-GSK3β (Tyr216/279 and Ser9), in ESCC samples (scale bar = 50 μm). (b) Western blot assay was used to detect the expression of signaling pathway-related protein in ESCC cells. (c) OS and DFS analyses of TET3 in patients with ESCC (n = 62).
Figure 5

TET3 increased the viability, motility, and stem cell characteristics of ESCC cells by regulating the PI3K/AKT/GSK3β/β-catenin axis. (a) Representative fields of signaling pathway-related protein expression, including TET3, EpCAM, β-catenin, p-AKT (T308 and S473), and p-GSK3β (Tyr216/279 and Ser9), in ESCC samples (scale bar = 50 μm). (b) Western blot assay was used to detect the expression of signaling pathway-related protein in ESCC cells. (c) OS and DFS analyses of TET3 in patients with ESCC (n = 62).

3.5 High expression of TET3 leads to poor prognosis for patients with ESCC

The expression pattern of TET3 and clinicopathological indicators of patients with ESCC was analyzed. These results indicated that the gender, age, degree of differentiation, and TMN staging were not correlated with the OE of TET3 of patients with ESCC (Table 1). The elevated expression of TET3 was significantly correlated with lymph node metastasis (P = 0.047). According to the staining scores of TET3, we divided 62 patients with ESCC into the high expression group (n = 41) and the low expression group (n = 21). The patients were followed up from 6 months to 60 months, and the median time was 42.2 ± 18.1 months. Kaplan–Meier survival analysis was carried out to analyze the expression of TET3 on the clinical prognosis of patients with ESCC. As presented in Figure 5c, high expression of TET3 was related to lower overall survival (OS) rate (P = 0.048) and disease-free survival (DFS) rate (P = 0.023) compared with the TET3-low group. Obviously, OE of TET3 was significantly correlated to the poor prognosis and survival of patients with ESCC. Based on the univariate analysis, we selected lymph node metastasis (P = 0.001), TMN staging (P = 0.003), and TET3 expression (P = 0.001) for multivariate analysis. The results revealed that TET3 has the potential to be an independent favorable factor for OS and recurrence (P = 0.001, Table 2). Collectively, clinical analysis suggested that elevated expression of TET3 may promote the malignant transformation of ESCC and is closely related to poor prognosis.

Table 1

Correlation between TET3 expression and ESCC clinicopathological features

Variables N (N = 62) TET3 High TET3 Low χ 2 P
Gender 41 21 0.014 0.907
 Male 39 26 13
 Female 23 15 8
Age (years) 0.192 0.661
 ≤60 26 18 8
 >60 36 23 13
Differentiation 2. 254 0.324
 Grade 1 19 10 9
 Grade 2 33 24 9
 Grade 3 10 7 3
Lymphatic metastasis 3.961 0.047
 No 22 11 11
 Yes 40 30 10
TNM staging 3.734 0. 053
 I–II 25 13 12
 III–IV 37 28 9

TET3: ten–eleven translocation 3; ESCC: esophageal squamous cell carcinoma; TNM: tumor, lymph node, and metastasis.

Table 2

Univariate and multivariate Cox’s proportional hazard models (n = 62)

Term Risk ratio 95% confidence interval P value
Univariate
Gender 1.082 0.915–1.279 0.358
Age 0.924 0.781–1.094 0.360
Differentiation 1.110 0.980–1.257 0.100
Lymphatic metastasis 1.466 1.230–1.747 0.001
TNM staging 1.292 1.093–1.527 0.003
TET3 2.225 1.860–2.662 0.001
Multivariate
Lymphatic metastasis 1.128 0.965–1.318 0.130
TNM staging 1.059 0.915–1.227 0.442
TET3 1.953 1.664–2.292 0.001

TET3: ten–eleven translocation 3; ESCC: esophageal squamous cell carcinoma; TNM: tumor, lymph node, and metastasis.

4 Discussion

In our present study, we found that TET3 was abnormally overexpressed in ESCC cells and tissues, which could be acted as an oncogene by facilitating malignant progression and predicting poor prognosis. Tumor recurrence and metastasis are multi-step processes, which usually accompanied by specific genomic, proteomic, metabolic, and epigenetic changes [21,22,23]. In recent decades, accumulating novel biomarkers could be used for early diagnosis and clinical therapy, accompanied with studies focus on the mechanism of tumorigenesis, and progression has made remarkable achievements. However, it is regrettable that some clinical challenges, such as the precise molecular mechanism of tumorigenesis, proliferation, and metastasis, maintenance of tumor stem-like characteristics, acquired drug resistance including chemotherapeutic drugs, and radiotherapy, still have not been well solved.

ESCC is one of the death-related tumors in China [24]. Postoperative recurrence and metastasis of ESCC are the crucial factors restricting the long-term survival of patients [25]. Based on the sequencing data by our group, screening and analyzing the public databases (http://ualcan.path.uab.edu), we locked TET3 as the target molecular. We investigated the function and possible mechanism of TET3 in ESCC, for the purpose of elucidating the molecular mechanism, regulatory function, and the clinical value in ESCC.

As we know, TET family members were dysregulated in various tumors, which play the function of oncogene or tumor suppressor gene. TET3 was decreased in ovarian cancer and silencing of which could inhibit malignant transformation of cancer cells [26]. But in acute myeloid leukemia, TET3 expression was significantly increased and could be used as an independent prognostic factor [27]. Therefore, the biological function of TET3 may be tissue specific. Combined with the information of the public database and our present results, we validated that TET3 was dramatically overexpressed in ESCC, which was consistent with Murata’s experimental results [28]. That is to say, TET3 could serve as an oncogene in the initiation and progression of ESCC. Furthermore, molecular mechanism study found that up-regulation of TET3 could elevate the proliferation and metastasis ability of ESCC cells. This phenomenon has also been verified in nude mice. Deprivation of TET3 expression remarkably inhibited the proliferation and metastatic ability of ESCC cells in vitro and in vivo. Meanwhile, based on the clinical data, we got a consistent result that elevated level of TET3 was significantly correlated with poor prognosis of patients with ESCC.

Studies have shown that OE of TET3 contributes to inducing and maintaining the CSC-like phenotype [29,30,31]. Recent findings revealed that, as a functional approach, spheroid formation is particularly useful to enrich the potential CSC subpopulations [32,33]. In this study, we found that OE of TET3 could enhance the spheroidization and the expression level of CD133 and β-catenin in ESCC cells in vitro. Down-regulation of TET3 decreased the ability of spheroid formation, meanwhile the expression of above stem cell-related markers was also significantly inhibited. These CSC-like cells may have significant growth advantages and the ability to resist survival pressure, even led to tumor proliferation and metastasis under specific physiological condition.

It has been widely recognized that PI3K/AKT is a classic signaling pathway, which participates in malignant progression of a variety of human malignances by regulating proliferation of tumor cells, invasion and metastatic potential, angiogenesis and maintaining the characteristics of tumor stem cells [18,19]. GSK3β is a crucial substrate in the PI3K/AKT signaling pathway and regulates the activity of mitochondria [20]. Abnormal phosphorylation level of GSK3β could affect Wnt/β-catenin/T-cytokine (TCF) signals and mediate epithelial mesenchymal transformation (EMT) process by participating in the transcriptional regulation of snail (EMT-related transcription factor) expression [34,35]. However, activation of PI3K/AKT signaling pathway could suppress GSK3β phosphorylation at the Ser9 site, which enhances the stability of β-catenin in cells, promotes its nuclear translocation, and eventually participates in the transcriptional regulation of downstream cell proliferation and metastasis-related genes [20,36]. Our present study revealed that the expression of TET3 was significantly positively correlated with β-catenin and the phosphorylation level of AKT (T308 and S473) was negatively correlated with the phosphorylation level of GSK3β (Ser9). These results confirmed that TET3 could inhibit the phosphorylation level of GSK3β (mainly through Ser9 site) by activating the AKT signaling pathway, eventually to stabilize and promote the β-catenin expression in ESCC cells.

Taken together, our data suggested that TET3 may act as an oncogene in ESCC. Elevated expression of TET3 could significantly facilitate the malignant progression, including proliferation, metastasis, and maintenance of stem cell characteristics in ESCC cells via PI3K/AKT/GSK3β/β-catenin pathway. The importance of TET3 in prognostic survival has also been validated in patients with ESCC. TET3 is expected to become a novel molecular marker for clinical diagnosis, treatment, and monitoring prognosis in the future.

Abbreviations

TET3

ten–eleven translocation 3

ESCC

esophageal squamous cell carcinoma

IF

immunofluorescence

IHC

immunohistochemistry

qRT-PCR

quantitative real-time PCR

KD

knockdown

OE

overexpression

N

non‑tumor tissue

T

tumor tissue

CSC

cancer stem cell

TNM

tumor, lymph node, and metastasis

EpCAM

epithelial cell adhesion molecule

OS

overall survival

DFS

disease-free survival.

tel: +86-21-56051080; fax: +86-21-56051080
tel: +86-21-65690520; fax: +86-21-65696249

Acknowledgments

Not applicable.

  1. Funding information: Not applicable.

  2. Author contributions: MLZ designed the study, performed the majority experiments, and wrote the article; BWS and CGL helped with the collection of clinical samples and follow-up data, IHC assay, and animal models; SCX supervised the study and provided suggestive advice for the experiments and article.

  3. Conflict of interest: The authors declare that they have no competing interest.

  4. Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Appendix

Figure A1 Overexpression and knockdown of TET3 in ESCC cells. (a) Fluorescence microscopy confirmed that TET3 was located in cytoplasm and nuclei (scale bar = 50 μm) at 72 h after infection with lentiviral vectors (MOI = 20). (b) Western blot assay was used to detect the protein level of TET3 in OE and KD cell sublines.
Figure A1

Overexpression and knockdown of TET3 in ESCC cells. (a) Fluorescence microscopy confirmed that TET3 was located in cytoplasm and nuclei (scale bar = 50 μm) at 72 h after infection with lentiviral vectors (MOI = 20). (b) Western blot assay was used to detect the protein level of TET3 in OE and KD cell sublines.

Figure A2 TET3 is over-expressed in ESCA and is correlated to poor prognosis and survival. (a) TET3 mRNA is up-regulated in ESCA samples (TCGA data). (b) Survival analysis suggested that elevated TET3 resulting in shorter overall survival.
Figure A2

TET3 is over-expressed in ESCA and is correlated to poor prognosis and survival. (a) TET3 mRNA is up-regulated in ESCA samples (TCGA data). (b) Survival analysis suggested that elevated TET3 resulting in shorter overall survival.

References

[1] Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424. 10.3322/caac.21492.Suche in Google Scholar PubMed

[2] Pennathur A, Gibson MK, Jobe BA, Luketich JD. Oesophageal carcinoma. Lancet. 2013;381(9864):400–12. 10.1016/S0140-6736(12)60643-6.Suche in Google Scholar PubMed

[3] Zhang Y. Epidemiology of esophageal cancer. World J Gastroenterol. 2013;19(34):5598–606. 10.3748/wjg.v19.i34.5598.Suche in Google Scholar PubMed PubMed Central

[4] Falk GW. Risk factors for esophageal cancer development. Surg Oncol Clin N Am. 2009;18(3):469–85. 10.1016/j.soc.2009.03.005.Suche in Google Scholar PubMed

[5] Hayeck TJ, Kong CY, Spechler SJ, Gazelle GS, Hur C. The prevalence of Barrett’s esophagus in the US:estimates from a simulation model confirmed by SEER data. Dis Esophagus. 2010;23(6):451–7. 10.1111/j.1442-2050.2010.01054.x.Suche in Google Scholar PubMed PubMed Central

[6] Thrift AP, Whiteman DC. The incidence of esophageal adenocarcinoma continues to rise: analysis of period and birth cohort effects on recent trends. Ann Oncol. 2012;23(12):3155–62. 10.1093/annonc/mds181.Suche in Google Scholar PubMed

[7] Lagergren J, Smyth E, Cunningham D, Lagergren P. Oesophageal cancer. Lancet. 2017;390:2383–96. 10.1016/S0140-6736(17)31462-9.Suche in Google Scholar PubMed

[8] van Rossum PSN, Mohammad NH, Vleggaar FP, van Hillegersberg R. Treatment for unresectable or metastatic oesophageal cancer: current evidence and trends. Nat Rev Gastroenterol Hepatol. 2018;15(4):235–49. 10.1038/nrgastro.2017.162.Suche in Google Scholar PubMed

[9] Ohashi S, Miyamoto S, Kikuchi O, Goto T, Amanuma Y, Muto M. Recent advances from basic and clinical studies of esophageal squamous cell carcinoma. Gastroenterology. 2015;149(7):1700–15. 10.1053/j.gastro.2015.08.054.Suche in Google Scholar PubMed

[10] Weisenberger DJ. Characterizing DNA methylation alterations from the cancer genome atlas. J Clin Invest. 2014;124(1):17–23. 10.1172/JCI69740.Suche in Google Scholar PubMed PubMed Central

[11] An J, Rao A, Ko M. TET family dioxygenases and DNA demethylation in stem cells and cancers. Exp Mol Med. 2017;49(4):e323. 10.1038/emm.2017.5.Suche in Google Scholar PubMed PubMed Central

[12] Li Z, Lyu C, Ren Y, Wang H. Role of TET dioxygenases and DNA hydroxymethylation in bisphenols-stimulated proliferation of breast cancer cells. Env Health Perspect. 2020;128(2):27008. 10.1289/EHP5862.Suche in Google Scholar PubMed PubMed Central

[13] Cao LQ, Yang XW, Chen YB, Zhang DW, Jiang XF, Xue P. Exosomal miR-21 regulates the TETs/PTENp1/PTEN pathway to promote hepatocellular carcinoma growth. Mol Cancer. 2020;19(1):59. 10.1186/s12943-020-01177-7.Suche in Google Scholar PubMed PubMed Central

[14] Bonvin E, Radaelli E, Bizet M, Luciani F, Calonne E, Putmans P, et al. TET2-dependent hydroxymethylome plasticity reduces melanoma initiation and progression. Cancer Res. 2019;79(3):482–94. 10.1158/0008-5472.Suche in Google Scholar

[15] Bian EB, Zong G, Xie YS, Meng XM, Huang C, Li J, et al. TET family proteins: new players in gliomas. J Neurooncol. 2014;116(3):429–35. 10.1007/s11060-013-1328-7.Suche in Google Scholar PubMed

[16] Shenoy N, Bhagat TD, Cheville J, Lohse C, Bhattacharyya S, Tischer A, et al. Ascorbic acid-induced TET activation mitigates adverse hydroxymethylcytosine loss in renal cell carcinoma. J Clin Invest. 2019;129(4):1612–25. 10.1172/JCI98747.Suche in Google Scholar PubMed PubMed Central

[17] Rawłuszko-Wieczorek AA, Siera A, Horbacka K, Horst N, Krokowicz P, Jagodziński PP. Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer. J Cancer Res Clin Oncol. 2015;141:1379–92. 10.1007/s00432-014-1901-2.Suche in Google Scholar PubMed PubMed Central

[18] Xia P, Xu XY. PI3K/Akt/mTOR signaling pathway in cancer stem cells: from basic research to clinical application. Am J Cancer Res. 2015;5(5):1602–9.Suche in Google Scholar

[19] Akbarzadeh M, Mihanfar A, Akbarzadeh S, Yousefi B, Majidinia M. Crosstalk between miRNA and PI3K/AKT/mTOR signaling pathway in cancer. Life Sci. 2021;285:119984. 10.1016/j.lfs.2021.119984.Suche in Google Scholar PubMed

[20] Yang K, Chen Z, Gao J, Shi W, Li L, Jiang S, et al. The key roles of GSK-3β in regulating mitochondrial activity. Cell Physiol Biochem. 2017;44(4):1445–59. 10.1159/000485580.Suche in Google Scholar PubMed

[21] Chakraborty S, Hosen MI, Ahmed M, Shekhar HU. Onco-Multi-OMICS approach: A new frontier in cancer research. Biomed Res Int. 2018;2018:9836256. 10.1155/2018/9836256.Suche in Google Scholar PubMed PubMed Central

[22] Crispo F, Condelli V, Lepore S, Notarangelo T, Sgambato A, Esposito F, et al. Metabolic dysregulations and epigenetics: A bidirectional interplay that drives tumor progression. Cells. 2019;8(8):798. 10.3390/cells8080798.Suche in Google Scholar PubMed PubMed Central

[23] Cooper LA, Demicco EG, Saltz JH, Powell RT, Rao A, Lazar AJ. PanCancer insights from The cancer genome atlas: the pathologist’s perspective. J Pathol. 2018;244(5):512–24. 10.1002/path.5028.Suche in Google Scholar PubMed PubMed Central

[24] Chen W, Zheng R, Zhang S, Zeng H, Fan Y, Qiao Y, et al. Esophageal cancer incidence and mortality in China, 2010. Thorac Cancer. 2014;5(4):343–8. 10.1111/1759-7714.12100.Suche in Google Scholar PubMed PubMed Central

[25] Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics in China, 2015. CA Cancer J Clin. 2016;66(2):115–32. 10.3322/caac.21338.Suche in Google Scholar PubMed

[26] Ye Z, Li J, Han X, Hou H, Chen H, Zheng X, et al. TET3 inhibits TGF-β1-induced epithelial-mesenchymal transition by demethylating miR-30d precursor gene in ovarian cancer cells. J Exp Clin Cancer Res. 2016;35:72. 10.1186/s13046-016-0350-y.Suche in Google Scholar PubMed PubMed Central

[27] Zhang T, Zhao Y, Zhao Y, Zhou J. Expression and prognosis analysis of TET family in acute myeloid leukemia. Aging (Albany NY). 2020;12(6):5031–47. 10.18632/aging.102928.Suche in Google Scholar PubMed PubMed Central

[28] Murata A, Baba Y, Ishimoto T, Miyake K, Kosumi K, Harada K, et al. TET family proteins and 5-hydroxymethylcytosine in esophageal squamous cell carcinoma. Oncotarget. 2015;6(27):23372–82. 10.18632/oncotarget.4281.Suche in Google Scholar PubMed PubMed Central

[29] Xu F, Liu Z, Liu R, Lu C, Wang L, Mao W, et al. Epigenetic induction of tumor stemness via the lipopolysaccharide-TET3-HOXB2 signaling axis in esophageal squamous cell carcinoma. Cell Commun Signal. 2020;18(1):17. 10.1186/s12964-020-0510-8.Suche in Google Scholar PubMed PubMed Central

[30] Herrmann A, Lahtz C, Song J, Aftabizadeh M, Cherryholmes GA, Xin H, et al. Integrin α6 signaling induces STAT3-TET3-mediated hydroxymethylation of genes critical for maintenance of glioma stem cells. Oncogene. 2020;39(10):2156–69. 10.1038/s41388-019-1134-6.Suche in Google Scholar PubMed PubMed Central

[31] Santiago M, Antunes C, Guedes M, Iacovino M, Kyba M, Reik W, et al. Tet3 regulates cellular identity and DNA methylation in neural progenitor cells. Cell Mol Life Sci. 2020;77(14):2871–83. 10.1007/s00018-019-03335-7.Suche in Google Scholar PubMed PubMed Central

[32] Fujii H, Honoki K, Tsujiuchi T, Kido A, Yoshitani K, Takakura Y. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int J Oncol. 2009;34:1381–6.10.3892/ijo_00000265Suche in Google Scholar

[33] Cao L, Zhou Y, Zhai B, Liao J, Xu W, Zhang R, et al. Sphere-forming cell subpopulations with cancer stem cell properties in human hepatoma cell lines. BMC Gastroenterol. 2011;11:71. 10.1186/1471-230X-11-71.Suche in Google Scholar PubMed PubMed Central

[34] Stemmer V, de Craene B, Berx G, Behrens J. Snail promotes Wnt target gene expression and interacts with beta-catenin. Oncogene. 2008;27(37):5075–80. 10.1038/onc.2008.140.Suche in Google Scholar PubMed

[35] Zhou BP, Deng J, Xia W, Xu J, Li YM, Gunduz M, et al. Dual regulation of snail by GSK-3beta-mediated phosphorylation in control of epithelial-mesenchymal transition. Nat Cell Biol. 2004;6(10):931–40. 10.1038/ncb1173.Suche in Google Scholar PubMed

[36] Hur EM, Zhou FQ. GSK3 signalling in neural development. Nat Rev Neurosci. 2010;11(8):539–51. 10.1038/nrn2870.Suche in Google Scholar PubMed PubMed Central

Received: 2022-06-21
Revised: 2022-10-07
Accepted: 2022-10-16
Published Online: 2022-12-02

© 2022 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0601
Schlagwörter für diesen Artikel
ten–eleven translocation 3; esophageal squamous cell carcinoma; PI3K/AKT/GSK3β/β-catenin pathway; prognosis
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 15.12.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0601/html
Button zum nach oben scrollen