Startseite Medizin MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
Artikel Open Access

MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway

  • Hu Dai und Xianmei Lu EMAIL logo
Veröffentlicht/Copyright: 14. Dezember 2022

Abstract

Preeclampsia (PE) is a common pregnancy-specific syndrome with an incidence of 4.6% in all pregnant women. Numerous studies have uncovered the functions and mechanisms of microsomal glutathione transferase 1 (MGST1) in different diseases and cellular processes, but whether MGST1 plays a role in PE remains unclear. Our study aimed to investigate the regulatory role of MGST1 in PE progression. In this study, the HTR8/SVneo cells were incubated with CoCl2 (250 µM) to mimic hypoxia in trophoblasts. Real-time quantitative polymerase chain reaction revealed that MGST1 was dramatically reduced in the placenta of PE patients. The proliferation of HTR8/SVneo cells was assessed via the Cell Counting Kit-8 and colony formation assays, and the results showed that MGST1 upregulation increased the cell viability of HTR8/SVneo cells. In addition, wound healing and Transwell assays unveiled that the elevation of MGST1 enhanced trophoblast cell migration and invasion. Moreover, the upregulation of MGST1 alleviated the hypoxia-induced oxidative stress in trophoblast cell. Mechanically, we found that MGST1 regulated PE progression by activating the phosphoinositide-3-kinase/protein kinase B/mechanistic target of rapamycin (PI3K/AKT/mTOR) pathway. In conclusion, MGST1 alleviated the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promoted cell proliferation, migration, and invasion via the activation of the PI3K/AKT/mTOR pathway in PE. These results suggested that MGST1 can be a potential target for the prevention and treatment of PE.

1 Introduction

Preeclampsia (PE) is a common pregnancy-specific syndrome with an incidence of 4.6% in all pregnant women [1]. PE usually occurs during the second or third trimester of gestation and is characterized by hypertension and proteinuria [2,3]. PE has become the leading cause of preterm delivery and maternal mortality all over the world [4,5]. It has been reported that normal deep placentation is highly associated with the differentiation and invasion ability of trophoblast cells during gestation [6]. Dysregulation of trophoblast cell activities may be a cause of PE, and it has been confirmed that excessive trophoblast cell apoptosis was closely correlated with PE development, which was considered to be an important pathogenesis of PE [7]. Therefore, more and more studies focus on the trophoblast cells in PE.

Microsomal glutathione transferase 1 (MGST1) is a protein-coding gene with 39,102 nucleotides and is located at 12p12.3 [8]. MGST1 is a membrane-related protein in eicosanoid and glutathione (GSH) metabolism [9]. There were six types of proteins in membrane-related proteins in eicosanoid and GSH metabolism, and glutathione S-transferases (GSTs) are one of them [10]. As a subtype of GSTs, MGST1 is reported to be implicated in cell defense against carcinogenic, toxic, and pharmacologically active electrophilic compounds [11]. Previously, a review from Schaffert indicated that MGST1 is involved in reactive, intermediate-induced injury [12]. MGST1 is also identified as playing a protective role in the retinal pigment epithelium against oxidative stress and aging [13]. MGST1 participates in the growth, migration, invasion, and epithelial–mesenchymal transition of glioma cells by acting as a target of miR-379-5p [14]. Another study also demonstrated that MGST1 silencing attenuated the proliferation and promoted the apoptosis of lung adenocarcinoma cells [15]. Despite the numerous findings about the functions and mechanisms of MGST1 in different diseases and cellular processes, whether MGST1 serves a part in PE remains largely unclear.

This study aimed to probe the regulatory role of MGST1 in PE progression. Our work is the first time to reveal that MGST1 alleviated the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and accelerated cell proliferation, migration, and invasion through the activation of phosphoinositide-3-kinase/protein kinase B/mechanistic target of rapamycin (PI3K/AKT/mTOR) pathway in PE. The findings might shed some light on the role of MGST1 in the prevention and treatment of PE.

2 Methods

2.1 Participants and tissue sample collection

In total, 40 pregnant women from Hongsheng Community Health Service Center were enrolled in our study (PE group [n = 20], normal group [n = 20]). PE was diagnosed in line with the criteria of the American College of Obstetrics and Gynecology. The placental tissues were immediately collected after delivery and stored at −80°C post-washing.

  1. Ethics approval: Ethical approval was obtained from the Ethics Committee of the Hongsheng Community Health Service Center.

  2. Statement of informed consent: Written informed consent was obtained from a legally authorized representative(s) for anonymized patient information to be published in this article.

  3. Data availability statement: The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

2.2 Cell culture and hypoxia treatment

HTR8/SVneo cells were obtained from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China) and grown in RPMI-1640 (Gibco, California, USA) with additional 10% fetal bovine serum (Gibco) in an atmosphere of 5% CO2 at 37°C. The cells were incubated with CoCl2 (250 µM) to mimic hypoxia in trophoblasts for 48 h. MGST1 was knocked down by transfecting with short interference (si) RNA siMGST1 and overexpressed by transfection with the MGST1 vector (GenePharma, Shanghai, China).

2.3 Transwell assay

Cell invasion of HTR8/SVneo cells was conducted using Corning Costar Transwell chambers pre-coated with Matrigel (Sigma, St Louis, USA). The transfected HTR8/SVneo cells were grown in the upper chamber with a serum-free medium, and RPMI-1640 (Gibco; 600 μL) with 10% calf serum was added in the lower chamber. After 24 h, crystal violet (1%; Sigma) was applied for staining the cells in the lower chamber cells for 20 min in 2% ethanol, and a microscope (DM6000B, Leica) was used to count the number of stained cells.

2.4 Real-time quantitative polymerase chain reaction (RT-qPCR)

The Trizol reagent (Thermo Fisher Scientific, Waltham, USA) was employed for the extraction of total RNA from the placental tissues of participants. The complementary DNA was synthesized via the SuperScript reverse transcriptase kit (Vazyme, Nanjing, China), and RT-qPCR was employed for evaluating the level of MGST1 on the Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, USA) according to the 2−ΔΔCt method. β-Actin served as a control. The primers were listed as follows:

  • MGST1

    F: 5′−AAATGGGCCAACCTGGATGT−3′

    R: 5′−ACACTGGTTTACCTGCGTACA−3′;

  • β-actin

    F: 5′−GGACATCCGCAAAGACCTGTA−3′

    R: 5′−GCTCAGGAGGAGCAATGATCT−3′.

2.5 Western blot analysis

The proteins were isolated from tissues or cells via radio immunoprecipitation assay lysis buffer. Then, sodium dodecyl sulfate–polyacrylamide gel electrophoresis was used to separate the proteins, followed by transferring them onto the polyvinylidene difluoride membrane (Sigma). The membranes were further incubated with the respective primary antibodies for overnight, followed by incubating with a secondary antibody against rabbit IgG (1:1,000; ab190475; Abcam, Shanghai) for 1 h at indoor temperature. An enhanced chemiluminescence system (Thermo Fisher Scientific, USA) was used to detect the protein bands, and ImageJ software (National Institutes of Health, Bethesda, USA) was applied for the quantification of proteins. The primary antibodies included anti-MGST1 (1:1,000; ab131059; Abcam), anti-AKT (10 µL; ab283852; Abcam), anti-PI3K (10 µL; ab283852; Abcam), anti-mTOR (1:10,000; ab134903; Abcam), p-AKT (1:1,000; ab38449; Abcam), p-PI3K (0.5 µg/mL, ab278545; Abcam), p-mTOR (1:1,000; ab109268; Abcam), and β-actin (1 µg/mL; ab8226; Abcam).

2.6 Cell Counting Kit-8 (CCK-8) assay

The viability of HTR8/SVneo cells was assessed via the CCK-8 (Dojindo, Tokyo, Japan) assay. Transfected cells were plated in 96-well plates for 24 h, and CCK-8 solution (10 μl) was supplemented into the wells every 24 h. After incubation for 2 h, the 450 nm absorbance was evaluated.

2.7 Wound healing assay

The migration of HTR8/SVneo cells was examined by a wound healing assay. The cells were planted in six-well plates, and a 200 μL-tip was used to scratch on the plates. The migration of the cells was photographed at 0 and 48 h, and the wound healing rate was calculated based on (width at 0 h − width of the wound at 48 h)/width at 0 h.

2.8 Colony formation assay

The transfected HTR8/SVneo cells were grown in six-well plates with RPMI-1640 medium for 2 weeks. The cell colonies were fixed by crystal violet (0.1%) and methanol solution (20%) for 10 min. A Nikon microscope (Tokyo, Japan) was used to count and photograph the visible colonies.

2.9 Immunohistochemistry (IHC) assay

The placental tissues were fixed in 10% formalin and paraffin-embedded. The tissues were cut into sections, and the antigen was retrieved by ethylene diamine tetraacetic acid (Invitrogen, Carlsbad, USA). The endogenous peroxidase activity was sealed by a 0.5% hydrogen peroxide–methanol solution. The tissues were incubated with anti-MGST1 (1:1,000; ab232469; Abcam) antibodies for 2 h followed by adding secondary antibodies (1:1,000; Santa Cruz Biotechnology, USA) into it for half an hour. Next, diaminobenzidine (Zytomed Systems, Berlin, Germany) was applied for dyeing the tissues, and then the tissues were counterstained with hematoxylin (Servicebio, Wuhan, China) after washing. The nuclear staining was performed with 4,6-diamino-2-phenyl indole. The stained tissues were observed via an Olympus fluorescence microscope (Olympus Corporation, Tokyo, Japan), and the expression of MGST1 was analyzed.

2.10 Enzyme-linked immunosorbent assay (ELISA)

The ELISA was used for evaluating the concentrations of oxidative stress indexes, including superoxide dismutase (SOD), GSH, malondialdehyde (MDA), and myeloperoxidase (MPO) via respective ELISA kits.

2.11 Statistical analysis

The Gene Expression Omnibus (GEO) datasets were downloaded from national center of biotechnology information(https://www.ncbi.nlm.nih.gov/) to probe MGST1 expression in the placenta of preterm PE patients and normal preterm pregnant women. Statistical product service solutions (version 20.0, IBM, USA) was employed for data analysis of the experimental data. The data were displayed as mean ± standard deviation, and comparisons were subjected to an independent sample t-test or one-way analysis of variance. P < 0.05 was set as statistical significance. All tests were executed at least three times.

3 Results

3.1 MGST1 was lowly expressed in the placenta of PE patients

In order to identify the role of MGST1 in PE, the level of MGST1 in the placenta of preterm PE and normal preterm pregnant women was analyzed using GEO data. The volcano plot depicted that the level of MGST1 was evidently lower in the placenta of preterm PE patients than that in normal preterm pregnant women (Figure 1a). In addition, our study recruited 20 PE patients and 20 normal pregnant women. The maternal and fetal baseline data are exhibited in Table 1. The data demonstrated that the gestational age (39.64 weeks vs 37.49 weeks), the placental weight of women (542.94 vs 512.24 g), fetal weight (3423.05 vs 3092.55 g), and length (55.97 vs 49.48 cm) in the normal group were higher than those in the PE group. The body mass index (BMI, 10.94 vs 12.65 kg/m2), urinary protein (0.27 g/24 h vs 2.36 g/24 h), systolic pressure (113.8 vs 145.78 mmHg), and diastolic pressure (68.89 vs 99.17 mmHg) were lower in the normal group than those in the PE group. Similarly, RT-qPCR also revealed that the MGST1 mRNA level was dramatically decreased in the placenta of PE patients (Figure 1b). IHC also showed that the MGST1 and p-AKT expressions were downregulated in the placental tissues of PE patients (Figure 1c). All in all, MGST1 was lowly expressed in the placenta of PE patients.

Figure 1 
                  MGST1 was lowly expressed in the placenta of PE patients. (a) Volcano plot showed the expression level of MGST1 in the placenta of preterm PE and normal preterm pregnant women using GEO data. (b) RT-qPCR was applied to assess the mRNA level of MGST1. (c) IHC assay manifested the expression of MGST1 and p-AKT in the placental tissues. ***
                     P < 0.001.
Figure 1

MGST1 was lowly expressed in the placenta of PE patients. (a) Volcano plot showed the expression level of MGST1 in the placenta of preterm PE and normal preterm pregnant women using GEO data. (b) RT-qPCR was applied to assess the mRNA level of MGST1. (c) IHC assay manifested the expression of MGST1 and p-AKT in the placental tissues. *** P < 0.001.

Table 1

Maternal and fetal baseline demographic data of the PE patients and normal pregnant women

Clinical indicators Normal (n = 20) PE (n = 20)
Maternal age (years) 30.49 ± 1.67 29.92 ± 2.15
Gestational age (weeks) 39.64 ± 0.81 37.49 ± 1.22***
BMI (kg/m2) 10.94 ± 1.61 12.65 ± 1.35***
Urinary protein (g/24 h) 0.27 ± 0.01 2.36 ± 0.12***
Systolic pressure (mmHg) 113.8 ± 3.36 145.78 ± 7.31***
Diastolic pressure (mmHg) 68.89 ± 8.14 99.17 ± 5.82***
Fetal weight (g) 3423.05 ± 488.29 3092.55 ± 335.92*
Fetal length (cm) 55.97 ± 1.04 49.48 ± 1.88***
Placental weight (g) 542.94 ± 44.06 512.24 ± 23.12**

*P < 0.05, **P < 0.01, ***P < 0.001.

3.2 Overexpression of MGST1 increased the hypoxia-induced trophoblast cell proliferation, migration, and invasion

Next, the function of MGST1 in PE was investigated. The cell model was established by simulating hypoxia in trophoblast cells using 250 μM CoCl2 for 24 h. The results indicated that MGST1 expression was downregulated by the treatment with CoCl2. siMGST1 transfection markedly decreased while MGST1 overexpression obviously increased the MGST1 protein level in CoCl2-treated trophoblast cells (Figure 2a). The results from CCK-8 assay showed that the treatment with CoCl2 suppressed the viability of trophoblast cells, and downregulation of MGST1 inhibited whereas upregulation of MGST 1 elevated the viability of CoCl2-treated trophoblast cells (Figure 2b). The colony formation assay also unveiled that the proliferation of trophoblast cells was inhibited by CoCl2 induction, and the proliferation of trophoblast cells was alleviated by downregulation of MGST1 and enhanced by overexpression of MGST1 in CoCl2-treated trophoblast cells (Figure 2c). Moreover, the wound closure was inhibited by CoCl2 induction, and in CoCl2-treated trophoblast cells, the wound closure was repressed by MGST1 knockdown and enhanced by overexpression of MGST1 (Figure 2d). The invasion of trophoblast cells was relieved by the induction of CoCl2, and the invasion of CoCl2-treated trophoblast cells was attenuated by MGST1 inhibition and promoted by MGST1 upregulation (Figure 2e). Taken together, overexpression of MGST1 increased hypoxia-induced trophoblast cell proliferation, migration, and invasion.

Figure 2 
                  Overexpression of MGST1 increased the hypoxia-induced trophoblast cell proliferation, migration, and invasion. Groups were divided into the control, CoCl2, CoCl2 + siNC, CoCl2 + siMGST1, CoCl2 + NC, and CoCl2 + MGST1 group. (a) The protein level of MGST1 was tested via Western blot analysis. (b and c) The proliferation of HTR8/SVneo cells was assessed via the CCK-8 and colony formation assays. (d and e) The wound healing and Transwell assay unveiled that the elevation of MGST1 led to the increase of trophoblast cell migration and invasion. *
                     P < 0.05, **
                     P < 0.01, ***
                     P < 0.001.
Figure 2

Overexpression of MGST1 increased the hypoxia-induced trophoblast cell proliferation, migration, and invasion. Groups were divided into the control, CoCl2, CoCl2 + siNC, CoCl2 + siMGST1, CoCl2 + NC, and CoCl2 + MGST1 group. (a) The protein level of MGST1 was tested via Western blot analysis. (b and c) The proliferation of HTR8/SVneo cells was assessed via the CCK-8 and colony formation assays. (d and e) The wound healing and Transwell assay unveiled that the elevation of MGST1 led to the increase of trophoblast cell migration and invasion. * P < 0.05, ** P < 0.01, *** P < 0.001.

3.3 MGST1 upregulation alleviated the hypoxia-induced trophoblast cell oxidative stress

Subsequently, whether MGST1 was involved in the hypoxia-induced trophoblast cell oxidative stress was explored. CoCl2 treatment decreased the concentrations of SOD and GSH but increased the concentrations of MDA and MPO. The downregulation of MGST1 suppressed the concentrations of SOD and GSH, whereas the overexpression of MGST1 had the opposite effects. The concentrations of MDA and MPO were elevated by MGST1 knockdown and were repressed by MGST1 overexpression (Figure 3). These results suggested that upregulation of MGST1 alleviated the hypoxia-induced oxidative stress in trophoblast cell.

Figure 3 
                  MGST1 upregulation alleviated the hypoxia-induced oxidative stress in trophoblast cell. Groups were divided into the control, CoCl2, CoCl2 + siNC, CoCl2 + siMGST1, CoCl2 + NC, and CoCl2 + MGST1 group. ELISA unveiled the concentrations of oxidative stress-related proteins (SOD, MDA, GSH, and MPO). **
                     P < 0.01, ***
                     P < 0.001.
Figure 3

MGST1 upregulation alleviated the hypoxia-induced oxidative stress in trophoblast cell. Groups were divided into the control, CoCl2, CoCl2 + siNC, CoCl2 + siMGST1, CoCl2 + NC, and CoCl2 + MGST1 group. ELISA unveiled the concentrations of oxidative stress-related proteins (SOD, MDA, GSH, and MPO). ** P < 0.01, *** P < 0.001.

3.4 MGST1 activated PI3K/AKT/mTOR pathway

Then, whether MGST1 modulated PE development via the PI3K/AKT/mTOR pathway was probed. Western blot analysis uncovered that the levels of key proteins of the PI3K/AKT/mTOR pathway (p-AKT, p-PI3K, and p-mTOR) were decreased by CoCl2 treatment, and MGST1 downregulation decreased the protein levels of p-AKT, p-PI3K, and p-mTOR while overexpression of MGST1 enhanced their levels (Figure 4). To sum up, MGST1 activated the PI3K/AKT/mTOR pathway.

Figure 4 
                  MGST1 activated PI3K/AKT/mTOR pathway. Groups were divided into the control, CoCl2, CoCl2 + siNC, CoCl2 + siMGST1, CoCl2 + NC, and CoCl2 + MGST1 group. Western blot analysis assessed the levels of PI3K/AKT/mTOR pathway-associated proteins (AKT, p-AKT, PI3K, P-PI3K, mTOR, and p-mTOR). *
                     P < 0.05, **
                     P < 0.01, ***
                     P < 0.001.
Figure 4

MGST1 activated PI3K/AKT/mTOR pathway. Groups were divided into the control, CoCl2, CoCl2 + siNC, CoCl2 + siMGST1, CoCl2 + NC, and CoCl2 + MGST1 group. Western blot analysis assessed the levels of PI3K/AKT/mTOR pathway-associated proteins (AKT, p-AKT, PI3K, P-PI3K, mTOR, and p-mTOR). * P < 0.05, ** P < 0.01, *** P < 0.001.

3.5 MGST1 modulated PE progression through the PI3K/AKT/mTOR pathway

Further experiments were conducted to verify whether MGST1 modulated PE progression through the PI3K/AKT/mTOR pathway. LY294002 (LY, the inhibitor for the PI3K/AKT pathway) was used in this work. The levels of p-AKT/AKT, p-PI3K/PI3K, and p-mTOR/mTOR were all increased after MGST1 overexpression, but these effects were attenuated by LY treatment (Figure 5a). In addition, the increased cell proliferation mediated by MGST1 overexpression was reversed by LY treatment (Figure 5b). The cell migration and invasion were enhanced by overexpression of MGST1, but these changes were attenuated by LY treatment (Figure 5c and d). Finally, the increased SOD and GSH levels, as well as the decreased MDA and MPO levels induced by MGST1 overexpression, were reversed by LY treatment (Figure 5e). These results indicated that MGST1 modulated PE progression through the PI3K/AKT/mTOR pathway.

Figure 5 
                  The effects of MGST1 overexpression on PE progression were attenuated after inhibiting the PI3K/AKT/mTOR pathway. Groups were divided into the control, CoCl2, CoCl2 + MGST1, and CoCl2 + MGST1 + LY groups. LY294002 (LY) is the inhibitor for PI3K/AKT pathway. (a) Western blot analysis detected the levels of PI3K/AKT/mTOR pathway-associated proteins (AKT, p-AKT, PI3K, P-PI3K, mTOR, and p-mTOR). (b) The cell proliferation was assessed through CCK-8 assay. (c and d) The cell migration and invasion were evaluated through wound healing and Transwell assays. (e) The concentrations of oxidative stress-related proteins (SOD, MDA, GSH, and MPO) were tested through ELISA. *
                     P < 0.05, **
                     P < 0.01, ***
                     P < 0.001.
Figure 5

The effects of MGST1 overexpression on PE progression were attenuated after inhibiting the PI3K/AKT/mTOR pathway. Groups were divided into the control, CoCl2, CoCl2 + MGST1, and CoCl2 + MGST1 + LY groups. LY294002 (LY) is the inhibitor for PI3K/AKT pathway. (a) Western blot analysis detected the levels of PI3K/AKT/mTOR pathway-associated proteins (AKT, p-AKT, PI3K, P-PI3K, mTOR, and p-mTOR). (b) The cell proliferation was assessed through CCK-8 assay. (c and d) The cell migration and invasion were evaluated through wound healing and Transwell assays. (e) The concentrations of oxidative stress-related proteins (SOD, MDA, GSH, and MPO) were tested through ELISA. * P < 0.05, ** P < 0.01, *** P < 0.001.

4 Discussion

In this study, HTR8/SVneo cells were incubated with CoCl2 (250 µM) to mimic hypoxia in trophoblasts. RT-qPCR revealed that MGST1 was dramatically reduced in the placenta of PE patients. The proliferation of HTR8/SVneo cells was assessed via the CCK-8 and colony formation assays, and the results uncovered that the upregulation of MGST1 increased the cell viability of HTR8/SVneo cells. In addition, wound healing and Transwell assays unveiled that the elevation of MGST1 enhanced trophoblast cell migration and invasion. Moreover, the upregulation of MGST1 alleviated the hypoxia-induced oxidative stress in trophoblast cell. Mechanically, it was found that MGST1 modulated PE progression by activating the PI3K/AKT/mTOR pathway.

As a hypertensive disorder during pregnancy, PE is already confirmed to have various acute and long-term complications in pregnant women and newborns [16]. PE, characterized by hypertension and proteinuria, often occurs after 20 weeks of gestation, which is possibly due to inadequate blood perfusion and ischemia caused by defective placentation [17]. In previous studies, numerous researchers have found that some proteins are associated with PE. For instance, as a target of miR-485-5p, absent in melanoma 2 (AIM2) is involved in PE development by regulating the Treg/Th17 imbalance and/or AIM2 axis [18]. The silencing of histone deacetylase 4 promotes the autophagy and apoptosis of cells in PE by acting as a target of miR-29b [19]. Tumor necrosis factor-related apoptosis-inducing ligand is involved in the development of PE via modulating the invasion of trophoblast cells [20]. Although MGST1 was found to exert a role in reactive intermediate-induced injury [12], oxidative stress [21], aging [13], glioma [14], and lung adenocarcinoma [15], its function in PE remains to be explored. Here, our results showed that the level of MGST1 was decreased in the placental tissues of patients with PE. In addition, overexpression of MGST1 enhanced trophoblast cell proliferation, migration, and invasion. Moreover, the upregulation of MGST1 alleviated the hypoxia-induced oxidative stress in trophoblast cell. In summary, MGST1 was downregulated in the placenta of PE patients and modulated hypoxia-induced trophoblast cell proliferation, migration, and invasion, as well as oxidative stress in PE.

The PI3K/AKT/mTOR signaling pathway is widely accepted to be implicated with the process of normal cell growth, angiogenesis, autophagy, and metabolism [22,23,24,25]. Over-activation of the PI3K/AKT/mTOR pathway causes normal cellular dysregulation, which then leads to competitive growth, metabolic advantage, and angiogenesis [26]. The PI3K/AKT/mTOR pathway can function by interacting with some other pathways. Previously, there has been large-scale evidence indicating the role of the PI3K/AKT/mTOR pathway in various diseases. For instance, the PI3K/AKT/mTOR pathway is mediated by reactive oxygen species and exhibits a role in salidroside-modulated lipopolysaccharide-induced myocardial injury in vitro and in vivo [27]. The PI3K/AKT/mTOR pathway is regulated by Naringin and is involved in the development of glucocorticoid-induced osteoporosis [28]. The PI3K/AKT/mTOR pathway is implicated in AIM2-mediated proliferation, invasion, migration, and apoptosis in osteosarcoma cells [29]. This PI3K/AKT/mTOR pathway has also been investigated in PE progression. For instance, mangiferin activates the PI3K/AKT/mTOR pathway to relieve placental oxidative stress in the PE mouse model [30]. Moreover, DDX46 suppression modulates the PI3K/AKT/mTOR pathway to reduce trophoblast cell proliferation and migration in PE [31]. In the PE placenta, receptor tyrosine kinase-like orphan receptor 1 knockdown regulates the PI3K/AKT/mTOR pathway to suppress trophoblast cell proliferation, migration, and invasion [32]. In addition, the knockdown of apelin receptor early endogenous ligand modulates the PI3K/AKT/mTOR pathway to alleviate trophoblast invasion in early-onset PE [33]. Nevertheless, whether MGST1 modulated the PI3K/AKT/mTOR pathway in PE was largely unknown. Herein, downregulation of MGST1 decreased the protein levels of p-AKT, p-PI3K, and p-mTOR while overexpression of MGST1 elevated their levels. Collectively, MGST1 activated the PI3K/AKT/mTOR pathway in PE.

In conclusion, we found that MGST1 alleviated the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promoted cell proliferation, migration, and invasion through the activation of the PI3K/AKT/mTOR pathway in PE. The findings might highlight the role of MGST1 in the prevention and treatment of PE in the future.


tel: +86-0510-82725161

Acknowledgements

Not applicable.

  1. Funding information: Not applicable.

  2. Author contributions: Conceptualization, methodology, and writing – original draft were performed by Hu Dai and Xianmei Lu. Formal analysis, resources, and investigation were performed by Hu Dai. Formal analysis, visualization, data curation, project administration, and validation were performed by Xianmei Lu. Validation, supervision, and writing – review & editing were performed by Hu Dai and Xianmei Lu. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors state that there are no conflicts of interest to disclose.

References

[1] Filipek A, Jurewicz E. Preeclampsia – a disease of pregnant women. Postepy Biochem. 2018;64(4):232–29. 10.18388/pb.2018_146.Suche in Google Scholar PubMed

[2] Wu Y, Mi Y, Zhang F, Cheng Y, Wu X. Suppression of bromodomain-containing protein 4 protects trophoblast cells from oxidative stress injury by enhancing Nrf2 activation. Hum Exp Toxicol. 2021;40(5):742–53. 10.1177/0960327120968857.Suche in Google Scholar PubMed

[3] Turkdogan FT, Coskun A. Evaluation of the effects of pain scale and analgesic administration on radiological imaging methods and hospitalization in trauma patients admitted to the emergency service. Signa Vitae. 2021;17(5):77–85.Suche in Google Scholar

[4] Jin M, Cao B, Lin C, Li J, Xu Q, Ren Q, et al. Tianma Gouteng decoction exerts pregnancy-protective effects against preeclampsia via regulation of oxidative stress and NO signaling. Front Pharmacol. 2022;13:849074. 10.3389/fphar.2022.849074.Suche in Google Scholar PubMed PubMed Central

[5] Wang X-J, Hua K-Q. Incidence and predictors of venous thromboembolism after surgery for gynecologic cancer. Eur J Gynaecol Oncol. 2021;42(3):477–81.10.31083/j.ejgo.2021.03.2240Suche in Google Scholar

[6] Majali-Martinez A, Barth S, Lang U, Desoye G, Cervar-Zivkovic M. Temporal changes of the endothelin system in human cytotrophoblasts during the first trimester of pregnancy. Physiol Res. 2018;67(Suppl 1):S247–s55. 10.33549/physiolres.933828.Suche in Google Scholar PubMed

[7] Yu L, Li D, Liao QP, Yang HX, Cao B, Fu G, et al. High levels of activin A detected in preeclamptic placenta induce trophoblast cell apoptosis by promoting nodal signaling. J Clin Endocrinol Metab. 2012;97(8):E1370–9. 10.1210/jc.2011-2729.Suche in Google Scholar PubMed

[8] Yan J, Ye G, Shao Y. High expression of the ferroptosis-associated MGST1 gene in relation to poor outcome and maladjusted immune cell infiltration in uterine corpus endometrial carcinoma. J Clin Lab Anal. 2022;36(4):e24317. 10.1002/jcla.24317.Suche in Google Scholar PubMed PubMed Central

[9] Morgenstern R, Zhang J, Johansson K. Microsomal glutathione transferase 1: mechanism and functional roles. Drug Metab Rev. 2011;43(2):300–6. 10.3109/03602532.2011.558511.Suche in Google Scholar PubMed

[10] Bräutigam L, Zhang J, Dreij K, Spahiu L, Holmgren A, Abe H, et al. MGST1, a GSH transferase/peroxidase essential for development and hematopoietic stem cell differentiation. Redox Biol. 2018;17:171–9. 10.1016/j.redox.2018.04.013.Suche in Google Scholar PubMed PubMed Central

[11] Kuang F, Liu J, Xie Y, Tang D, Kang R. MGST1 is a redox-sensitive repressor of ferroptosis in pancreatic cancer cells. Cell Chem Biol. 2021;28(6):765–75. 10.1016/j.chembiol.2021.01.006.Suche in Google Scholar PubMed

[12] Schaffert CS. Role of MGST1 in reactive intermediate-induced injury. World J Gastroenterol. 2011;17(20):2552–7. 10.3748/wjg.v17.i20.2552.Suche in Google Scholar PubMed PubMed Central

[13] Maeda A, Crabb JW, Palczewski K. Microsomal glutathione S-transferase 1 in the retinal pigment epithelium: protection against oxidative stress and a potential role in aging. Biochemistry. 2005;44(2):480–9. 10.1021/bi048016f.Suche in Google Scholar PubMed PubMed Central

[14] Yang B, Xia S, Ye X, Jing W, Wu B. MiR-379-5p targets microsomal glutathione transferase 1 (MGST1) to regulate human glioma in cell proliferation, migration and invasion and epithelial-mesenchymal transition (EMT). Biochem Biophys Res Commun. 2021;568:8–14. 10.1016/j.bbrc.2021.05.099.Suche in Google Scholar PubMed

[15] Zeng B, Ge C, Li R, Zhang Z, Fu Q, Li Z, et al. Knockdown of microsomal glutathione S-transferase 1 inhibits lung adenocarcinoma cell proliferation and induces apoptosis. Biomed Pharmacother. 2020;121:109562. 10.1016/j.biopha.2019.109562.Suche in Google Scholar PubMed

[16] Wang Y, Cheng K, Zhou W, Liu H, Yang T, Hou P, et al. miR-141-5p regulate ATF2 via effecting MAPK1/ERK2 signaling to promote preeclampsia. Biomed Pharmacother. 2019;115:108953. 10.1016/j.biopha.2019.108953.Suche in Google Scholar PubMed

[17] Dong K, Zhang X, Ma L, Gao N, Tang H, Jian F, et al. Downregulations of circulating miR-31 and miR-21 are associated with preeclampsia. Pregnancy Hypertens. 2019;17:59–63. 10.1016/j.preghy.2019.05.013.Suche in Google Scholar PubMed

[18] Chen J, Zhang Y, Tan W, Gao H, Xiao S, Gao J, et al. Silencing of long non-coding RNA NEAT1 improves Treg/Th17 imbalance in preeclampsia via the miR-485-5p/AIM2 axis. Bioengineered. 2021;12(1):8768–77. 10.1080/21655979.2021.1982306.Suche in Google Scholar PubMed PubMed Central

[19] Du J, Ji Q, Dong L, Meng Y, Xin G. HDAC4 knockdown induces preeclampsia cell autophagy and apoptosis by miR-29b. Reprod Sci. 2021;28(2):334–42. 10.1007/s43032-020-00286-4.Suche in Google Scholar PubMed

[20] Xiao C, Rui Y, Zhou S, Huang Y, Wei Y, Wang Z. TNF-related apoptosis-inducing ligand (TRAIL) promotes trophoblast cell invasion via miR-146a-EGFR/CXCR4 axis: A novel mechanism for preeclampsia? Placenta. 2020;93:8–16. 10.1016/j.placenta.2020.02.011.Suche in Google Scholar PubMed

[21] Siritantikorn A, Johansson K, Ahlen K, Rinaldi R, Suthiphongchai T, Wilairat P, et al. Protection of cells from oxidative stress by microsomal glutathione transferase 1. Biochem Biophys Res Commun. 2007;355(2):592–6. 10.1016/j.bbrc.2007.02.018.Suche in Google Scholar PubMed

[22] Feng FB, Qiu HY. Effects of Artesunate on chondrocyte proliferation, apoptosis and autophagy through the PI3K/AKT/mTOR signaling pathway in rat models with rheumatoid arthritis. Biomed Pharmacother. 2018;102:1209–20. 10.1016/j.biopha.2018.03.142.Suche in Google Scholar PubMed

[23] Yang J, Pi C, Wang G. Inhibition of PI3K/Akt/mTOR pathway by apigenin induces apoptosis and autophagy in hepatocellular carcinoma cells. Biomed Pharmacother. 2018;103:699–707. 10.1016/j.biopha.2018.04.072.Suche in Google Scholar PubMed

[24] Qiu J, Zhang Y, Xie M. Chrysotoxine attenuates sevoflurane-induced neurotoxicity in vitro via regulating PI3K/AKT/GSK pathway. Signa Vitae. 2021;17(4):185–91.Suche in Google Scholar

[25] Szymankiewicz M, Szubert S. Microbiological characteristics of early and late infectious complications following total pelvic exenteration due to cervical cancer recurrence – the significance of infections in long-term outcomes. Eur J Gynaecol Oncol. 2021;42(4):742–51.10.31083/j.ejgo4204112Suche in Google Scholar

[26] Keppler-Noreuil KM, Parker VE, Darling TN, Martinez-Agosto JA. Somatic overgrowth disorders of the PI3K/AKT/mTOR pathway & therapeutic strategies. Am J Med Genet C Semin Med Genet. 2016;172(4):402–21. 10.1002/ajmg.c.31531.Suche in Google Scholar PubMed PubMed Central

[27] Chen L, Liu P, Feng X, Ma C. Salidroside suppressing LPS-induced myocardial injury by inhibiting ROS-mediated PI3K/Akt/mTOR pathway in vitro and in vivo. J Cell Mol Med. 2017;21(12):3178–89. 10.1111/jcmm.12871.Suche in Google Scholar PubMed PubMed Central

[28] Ge X, Zhou G. Protective effects of naringin on glucocorticoid-induced osteoporosis through regulating the PI3K/Akt/mTOR signaling pathway. Am J Transl Res. 2021;13(6):6330–41.Suche in Google Scholar

[29] Zheng J, Liu C, Shi J, Wen K, Wang X. AIM2 inhibits the proliferation, invasion and migration, and promotes the apoptosis of osteosarcoma cells by inactivating the PI3K/AKT/mTOR signaling pathway. Mol Med Rep. 2022;25(2):53. 10.3892/mmr.2021.12569.Suche in Google Scholar PubMed PubMed Central

[30] Huang J, Zheng L, Wang F, Su Y, Kong H, Xin H. Mangiferin ameliorates placental oxidative stress and activates PI3K/Akt/mTOR pathway in mouse model of preeclampsia. Arch Pharm Res. 2020;43(2):233–41. 10.1007/s12272-020-01220-7.Suche in Google Scholar PubMed

[31] You X, Cui H, Yu N, Li Q. Knockdown of DDX46 inhibits trophoblast cell proliferation and migration through the PI3K/Akt/mTOR signaling pathway in preeclampsia. Open Life Sci. 2020;15(1):400–8. 10.1515/biol-2020-0043.Suche in Google Scholar PubMed PubMed Central

[32] Chen J, Yue C, Xu J, Zhan Y, Zhao H, Li Y, et al. Downregulation of receptor tyrosine kinase-like orphan receptor 1 in preeclampsia placenta inhibits human trophoblast cell proliferation, migration, and invasion by PI3K/AKT/mTOR pathway accommodation. Placenta. 2019;82:17–24. 10.1016/j.placenta.2019.05.002.Suche in Google Scholar PubMed

[33] Wang L, Zhang Y, Qu H, Xu F, Hu H, Zhang Q, et al. Reduced ELABELA expression attenuates trophoblast invasion through the PI3K/AKT/mTOR pathway in early onset preeclampsia. Placenta. 2019;87:38–45. 10.1016/j.placenta.2019.08.077.Suche in Google Scholar PubMed

Received: 2022-08-02
Revised: 2022-10-31
Accepted: 2022-11-15
Published Online: 2022-12-14

© 2022 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Heruntergeladen am 15.12.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0617/html
Button zum nach oben scrollen