Home Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
Article Open Access

Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure

  • Haiyan Zhuo EMAIL logo , Jinhai Fan , Bifeng Zhang , Yixian Shi , Liqing Zheng , Yihong Chai and Lvfeng Yao EMAIL logo
Published/Copyright: September 6, 2022
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 17 Issue 1

Abstract

Genetic variation in UDP-glucuronosyltransferase 1A1 gene (UGT1A1) is a lithogenic risk factor for gallstone formation. This study aimed to assess genotype and allele frequencies of common UGT1A1 variants in patients with gallstone and hepatitis B virus (HBV)-related hepatic failure. This study enrolled 113 healthy individuals (CTRL), 54 patients with HBV infection (HBV), 134 patients with gallstone-free hepatic failure and HBV infection, and 34 patients with gallstone-related hepatic failure and HBV infection (GRHF). Peripheral venous blood samples were collected for genomic DNA isolation. Polymerase chain reaction amplification was carried out for UGT1A1, followed by direct sequencing. Analysis for genotype and allele frequencies of UGT1A1 variants (UGT1A1*6, UGT1A1*27, UGT1A1*28, and UGT1A1*60) was performed. The allele distributions of the four groups did not deviate from Hardy–Weinberg equilibrium. Allele (A) and genotype (CA) frequency distributions of UGT1A1*27 were significantly different between GRHF and CTRL, or between GRHF and HBV. GRHF and CTRL exhibited significant differences in allele (A) and genotype (CA) frequency distributions of UGT1A1*28. Linkage disequilibrium analysis suggested that haplotype G-G-[TA]7-T may be associated with gallstone in HBV-related hepatic failure. Our data reveal that UGT1A1*27 and UGT1A1*28 variants are significantly observed in patients with GRHF compared to healthy individuals.

Keywords: UGT1A1 ; gallstone; liver failure; hepatitis B virus; single-nucleotide polymorphism

1 Introduction

Chronic hepatitis B virus (HBV) infection frequently causes severely progressive hepatic diseases, including fibrosis, cirrhosis, hepatocellular carcinoma, and hepatic failure [1,2,3]. There are at least 292 million chronical carriers of HBV accounting for 3.9% of the world’s population, leading to 880,000 deaths from liver failure due to cirrhosis annually [4,5]. Available evidence shows that chronic infection with HBV is the most common causative factor of liver failure in China [6,7,8]. Recent studies have provided evidence on the association between the risk of gallstones and HBV infection [9,10]. Most notably, patients with cirrhosis and gallstone were detected with high levels of total bilirubin, direct bilirubin and indirect bilirubin compared with cirrhosis patients without gallstone [11]. The elevated bilirubin exacerbates liver failure for patients with HBV infection and is a valuable marker for predicting prognosis for patients with cirrhosis and liver failure [12,13].

UDP-glucuronosyltransferase (UGT) comprises a superfamily of enzymes that catalyze the glucuronidation reaction [14,15,16]. UDP-glucuronosyltransferase 1A1 gene (UGT1A1) is determined as the only related enzyme implicated in the glucuronidation of bilirubin that is a degradation product under a normal catabolic condition [17,18,19]. The deficiency of UGT1A1 enzyme results in serve unconjugated hyperbilirubinemia, appearing to be a risk factor for gallstone formation in Jamaican patients with sickle cell disease [20]. More importantly, UGT1A1 mutation is a pathogenic risk factor for cholelithiasis, given that UGT1A1 defects lead to bile acid malabsorption accompanied by enhanced bilirubin uptake and the development of hyperbilirubinemia [21,22,23]. Recently, allelic variants of UGT1A1 gene have gained major attentions since its polymorphism is associated with bilirubin levels and liver function in HBV-positive or HCV-positive carriers [24,25].

Historical research uncovers polymorphisms of UGT1A1 in the promoter or exon 1 regions contribute to unconjugated hyperbilirubinemia, which may be the source of gallstone formation, with UGT1A1*6 (c.211G>A, rs4148323, p.Gly71Arg), UGT1A1*27 (c.686C>A, rs35350960, p.Pro229Glu), UGT1A1*28 ([TA]6>[TA]7, rs3064744, rs4124874), and UGT1A1*60 (c.-3279T>G) mostly reported [26,27,28,29]. It was identified HBV-positive carriers of heterozygosis or homozygosis for UGT1A1*60; polymorphism analysis suggested that these individuals are more susceptible to cancer [30]. The most common polymorphism of UGT1A1 is an additional TA repeat in the TATA box region of the promoter, while the predominant variation in Asians is a missense mutation, c211G>A (p.G71R) [31,32]. The genetic mutation UGT1A1*27 (c.686C>A) contributes to severe neonatal hyperbilirubinemia in Jaundiced neonates [33]. However, the information is lacking about the important UGT1A1 gene variations in gallstone-related liver failure caused by HBV infection. The aim of this study was to analyze the association between UGT1A1 polymorphisms (UGT1A1*6, UGT1A1*27, UGT1A1*28, and UGT1A1*6) and gallstone in patients with hepatitis B-related liver failure.

2 Materials and methods

2.1 Subjects

This study comprised a hospital-based study of 335 subjects, including 113 healthy individuals (CTRL), 54 patients with HBV infection and without gallstone and hepatic failure (HBV), 134 patients with gallstone-free hepatic failure and HBV infection (GFHF), and 34 patients with gallstone-related hepatic failure and HBV infection (GRHF). Adult patients with hepatic failure received general internal medicine treatment and were treated with plasma exchange-centered artificial liver support system at our hospital from June 2015 to September 2017. Clinical information including basic characteristics (gender, age, and complications) and biochemical examinations was recorded. The research related to human use has been complied with all the relevant national regulations and institutional policies and in accordance with the tenets of the Helsinki Declaration and has been approved by the Ethics Committee of our Hospital (No. 2021-019-01). Informed consent has been obtained from all individuals included in this study.

2.2 DNA isolation and data analysis

Peripheral venous blood samples were taken in 10–12 h fasting status in the morning and stored at −20°C in ethylene diamine tetra-acetic acid-containing vacutainer. Genomic DNA was extracted using the Genomic DNA Isolation Kit (Tiangen). UGT1A1 was amplified by PCR with 30 ng genomic DNA, 0.5 μL specific primers (10 pmol) (Table 1), 2 μL dNTP (2.5 mmol), and 1 μL rTaq. PCR amplification was carried out on an ABI 9700 PCR thermal cycler (ABI). The reaction procedure was initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, primer annealing at 60°C for 30 s, primer extension at 72°C for 1 min, and final extension at 72°C for 5 min. The amplified product was separated using 1.5% agarose gel electrophoresis. The collected PCR products were purified with the MagNA Pure LightCycler 32 instrument (Roche Applied Science, Indianapolis, IN, USA). Genotyping of four SNPs in the promoter and exon regions of UGT1A1, namely UGT1A1*6 (rs4148323), UGT1A1*27 (rs35350960), UGT1A1*28 (rs3064744), and UGT1A1*60 (rs4124874) was determined by the sequencing of PCR products. The purified PCR amplicons were sequenced by BioSune Tech Co., Ltd. (Shanghai, China). After removal of the primer regions, all sequences were aligned with DNAstar’s SeqMan software (DNAStar, Madison, WI, USA). Representative electropherograms are shown in Figure 1.

Table 1

Sequence of primers for targeting genomic amplicon sequencing for UGT1A1

Sites ID Primer sequences (5′−3′)
Forward Reverse
Enhancer UGT1A10628-PBERM AGGTGTAATGAGGATGTGTT CTCTTACCCTCTAGCCATTC
TATA box UGT1A10628-TATABOX CCAGTTCAACTGTTGTTGCC TCCTGCCAGAGGTTCGCCCT
Exon1a 70316-UGT1A1-1a TGAACTCCCTGCTACCTTTGT CAGTGGGCAGAGACAGGTAC
Exon1b 70316-UGT1A1-1b TCTGCTATGCTTTTGTCTGGC TGCCAAAGACAGACTCAAACC
Exon2 70316-UGT1A1-2 CAAACACGCATGCCTTTAATCA GGATTAATAGTTGGGAAGTGGCA
Exon3 70316-UGT1A1-3 CCAGTCCTCAGAAGCCTTCA GCAATGTAGGATATGTTGGCCA
Exon4 70316-UGT1A1-4 TGGCCAACATATCCTACATTGC AACAACGCTATTAAATGCTACGT
Exon5 70316-UGT1A1-5 ACAGGGCAAGACTCTGTATCT CCTGATCAAAGACACCAGAGG
Figure 1 Whole-exome seuqencing variants from UGT1A1. Electropherograms exhibit the variant positions, (a) UGT1A1*6 (rs4124874, c.-3279T>G, p.Gly71Arg), (b) UGT1A1*27 (c.686C>A, rs35350960, p.Pro229Glu), (c) UGT1A1*28 (rs3064744, [TA]6>[TA]7), and (d) UGT1A1*60 (rs4124874, c.-3279T>G) marked by red arrows.
Figure 1

Whole-exome seuqencing variants from UGT1A1. Electropherograms exhibit the variant positions, (a) UGT1A1*6 (rs4124874, c.-3279T>G, p.Gly71Arg), (b) UGT1A1*27 (c.686C>A, rs35350960, p.Pro229Glu), (c) UGT1A1*28 (rs3064744, [TA]6>[TA]7), and (d) UGT1A1*60 (rs4124874, c.-3279T>G) marked by red arrows.

2.3 Statistical analysis

Serum levels of total bilirubin, direct bilirubin, and indirect bilirubin were presented as the median and interquartile range (25th percentile to 75th percentile), and multiple comparisons were carried out using one-way ANOVA corrected by Tukey test. Hardy−Weinberg equilibrium, genotype distribution frequency, allele frequency, linkage disequilibrium (LD), and haplotype distribution were analyzed according to Shi’s method [34]. The normalizing coefficient LD (|D′|) and the square of correlation coefficient between pairs of loci (r 2) were calculated for all pairs of alleles (c.-3279T>G, [TA]6>[TA]7, c.211G>A, and c.686C>A). |D′| and r 2 of 1 correspond to complete LD, while 0 presents no LD. |D′| > 0.8 and r 2 > 0.8 indicate a high extent of LD. Differences in the proportion of four SNPs between HBV and CTRL, GRHF and CTRL, GFHF and HBV, GRHF and HBV, or GRHF and GFHF were analyzed using Pearson’s chi-square test with Yates’ continuity correction or Fisher’s exact test. Fisher’s exact test was used for the calculation of 95% confidence interval of the difference between proportions with less than five subjects.

3 Results

3.1 Bilirubin levels were different among the CTRL, HBV, GFHF and GRHF patients

Serum total bilirubin levels were significantly higher in patients with HBV infection (median 192.0 μmol/L; IQR 86.75–265.4) as defined by a serum total bilirubin ranging 0–26 μmol/L compared with healthy individuals (Figure 2). Direct bilirubin (median 125.0 μmol/L; IQR 56.50–166.6; p < 0.0001) and indirect bilirubin (median 68.40 μmol/L; IQR 32.75–99.55) were higher in HBV patients compared with healthy participants (direct bilirubin ranging 0–8 μmol/L; indirect bilirubin ranging 0.5–20.0 μmol/L). GFHF patients possessed higher levels of TBIL (median 362.4 μmol/L, IQR 259.9–503.0), DBIL (median 209.3 μmol/L, IQR 160.8–276.5), and IBIL (median 141.6 μmol/L, IQR 97.78–214.5) than HBV patients (TBIL: median 192.0 μmol/L, IQR 86.75–265.4, p < 0.0001; DBIL: median 125.0 μmol/L, IQR 56.50–166.6, p < 0.0001; IBIL: median 68.40 μmol/L, IQR 32.75–99.55, p < 0.0001). Consistently, patients with GRHF had higher levels of TBIL (median 362.4 μmol/L; IQR 259.9–503.0), DBIL (median 209.3 μmol/L; IQR 160.8–276.5), and IBIL (median 141.6 μmol/L; IQR 97.78–214.5) than HBV patients (TBIL, p = 0.0266; DBIL, p = 0.0326; IBIL, p = 0.0391). Of note, TBIL, DBIL, and IBIL levels differed significantly between GFHF patients and GRHF patients (TBIL, p = 0.0019; DBIL, p = 0.0026; IBIL, p = 0.0032).

Figure 2 Serum levels of (a) TBIL, (b) DBIL, and (c) IBIL increased in patients with HBV infection, GFHF and GRHF. Boxplots represted the median, 25th percentile, 75th percentile, and error bars. TBIL, total bilirubin; DBIL, direct bilirubin; IBIL, indirect bilirubin. HBV, hepatitis B virus. CTRL group, healthy individuals without HBV infection, gallstone, or hepatic failure; HBV group, patients with HBV infection; GFHF, patients with gallstone-free hepatic failure and HBV infection; GRHF, patients with gallstone-related hepatic failure and HBV infection. CTRL (n = 113), HBV (n = 54), GFHF (n = 134), and GRHF (n = 34). *p < 0.05, **p < 0.01, and ***p < 0.001 by one-way ANOVA corrected by Tukey test.
Figure 2

Serum levels of (a) TBIL, (b) DBIL, and (c) IBIL increased in patients with HBV infection, GFHF and GRHF. Boxplots represted the median, 25th percentile, 75th percentile, and error bars. TBIL, total bilirubin; DBIL, direct bilirubin; IBIL, indirect bilirubin. HBV, hepatitis B virus. CTRL group, healthy individuals without HBV infection, gallstone, or hepatic failure; HBV group, patients with HBV infection; GFHF, patients with gallstone-free hepatic failure and HBV infection; GRHF, patients with gallstone-related hepatic failure and HBV infection. CTRL (n = 113), HBV (n = 54), GFHF (n = 134), and GRHF (n = 34). *p < 0.05, **p < 0.01, and ***p < 0.001 by one-way ANOVA corrected by Tukey test.

3.2 UGT1A1 variants and Hardy–Weinberg equilibrium analysis

In the present study, the subjects in the CTRL group comprised 26.5% UGT1A1*6 (rs4124874, c.-3279T>G, p.Gly71Arg), 15.9% UGT1A1*28 (rs3064744, [TA]6>[TA]7), and 59.3% UGT1A1*60 (rs4124874, c.-3279T>G) (Table 2). HBV-infected individuals were detected with 29.6% UGT1A1*6, 24.1% UGT1A1*28, and 53.7% UGT1A1*60. UGT1A1*6, UGT1A1*27, UGT1A1*28, and UGT1A1*60 were noted in 34.3, 4.5, 26.1, and 56.0% GFHF patients, respectively. GRHF group consisted of 32.4% UGT1A1*6, 8.8% UGT1A1*27, 35.3% UGT1A1*28, and 52.9% UGT1A1*60. The frequency of UGT1A1*27 and UGT1A1*28 in GRHF patients is significantly higher than that of healthy participants (p < 0.05). The odd ratios of UGT1A1*27 and UGT1A1*28 were 25.22 [1.27, 502] and 2.88 [1.21, 6.84] when the CTRL group was compared the GRHF group (Table S1). These results indicated that UGT1A1*27 and UGT1A1*28 showed a strong association with GRHF. The observed genotype distributions of the CTRL, HBV, GFHF, and GRHF subjects were not obviously different from the values computed by Fisher’s exact test (p > 0.05), suggesting that the allele distributions of the CTRL, HBV, GFHF, and GRHF groups did not deviate from Hardy–Weinberg equilibrium (Table 3).

Table 2

Odds ratio and 95% CI for gallbladder stone-related hepatic failure associated with UGT1A1 (NM_000463) variants

Polymorphisms
UGT1A1*6 UGT1A1*27 UGT1A1*28 UGT1A1*60
Variant c.211G>A c.686C>A [TA]6>[TA]7 c.-3279T>G
Amino acid change p.Gly71Arg p.Pro229Glu — —
SNP ID rs4148323 rs35350960 rs3064744 rs4124874
Location Exon 1 Exon 1 Promoter Promoter
Position GRCh38.p13 GRCh38.p13 GRCh38.p13 GRCh38.p13
Type of variant Missense Missense Upstream transcript Upstream transcript
CTRL (n, freq) 30, 26.5% 0, 0.0% 18, 15.9% 67, 59.3%
HBV (n, freq) 16, 29.6% 0, 0.0% 13, 24.1% 29, 53.7%
GFHF (n, freq) 46, 34.3% 6, 4.5% 35, 26.1% 75, 56.0%
GRHF (n, freq) 11, 32.4% 3, 8.8%a 12, 35.3%a 18, 52.9%

UGT1A1, UDP-glucuronosyltransferase 1A1; SNP, single-nucleotide polymorphism; HBV, hepatitis B virus. p-values were calculated using Fisher’s exact test or Pearson’s chi-square test (a p < 0.05 compared to CTRL group). CTRL group, healthy individuals without HBV infection, gallstone, or hepatic failure; HBV group, patients with HBV infection; GFHF, patients with gallstone-free hepatic failure and HBV infection; GRHF, patients with gallstone-related hepatic failure and HBV infection. CTRL (n = 113), HBV (n = 54), GFHF (n = 134), and GRHF (n = 34).

Table 3

Hardy–Weinberg equilibrium analysis

Polymorphisms Fisher’s p-value
CTRL HBV GFHF GRHF
UGT1A1*6 0.6559 0.7288 0.9341 0.4010
UGT1A1*27 1.0000 1.0000 0.7909 0.7878
UGT1A1*28 0.3577 0.9111 0.0821 0.7878
UGT1A1*60 0.8330 0.8382 0.4033 0.7296

The p-values of Fisher’s exact test or or Pearson’s chi-square test more than 0.05 meet the Hardy–Weinberg equilibrium. UGT1A1, UDP-glucuronosyltransferase 1A1; HBV, hepatitis B virus. CTRL group, healthy individuals without HBV infection, gallstone, or hepatic failure; HBV group, patients with HBV infection; GFHF, patients with gallstone-free hepatic failure and HBV infection; GRHF, patients with gallstone-related hepatic failure and HBV infection. CTRL (n = 113), HBV (n = 54), GFHF (n = 134), and GRHF (n = 34).

3.3 UGT1A1 polymorphism was associated with the development of GRHF

The differences in allele frequencies and genotype distribution of UGT1A1 SNPs were analyzed between GRHF patients and GFHF patients. It was suggested that GRHF patients and CTRL patients exhibited significant differences in allele frequencies distributions of UGT1A1*27 (p = 0.0120) and UGT1A1*28 (p = 0.0129) (Table 4 and Table S2). There was significantly different in the distribution of genotype CA of UGT1A1*27 between the CTRL and GRHF group (p = 0.0115) or HBV and GRHF group (p = 0.0264). The distribution of genotype [TA]6[TA]7 of UGT1A1*28 was obviously different between the GRHF and CTRL group (p = 0.0448). In contrast, no significant difference in genotype distribution and allele frequencies of UGT1A1*6 and UGT1A1*60 was observed between the GRHF and CTRL group or the GRHF and HBV group (p > 0.05).

Table 4

Genotype distribution and allele frequencies of four SNPs in UGT1A1 gene with the development of hepatic failure associated with gallbladder stone

Polymorphisms Genotype (n, frequency) Allele (n, frequency)
UGT1A1*6 GG GA AA G A
CTRL (n, freq) 83, 73.5% 27, 23.9% 3, 2.7% 193, 85.4% 33, 14.6%
HBV (n, freq) 38, 70.4% 15, 27.8% 1, 1.9% 91, 84.3% 17, 15.7%
GFHF (n, freq) 88, 65.7% 41, 30.6% 5, 3.7% 217, 81.0% 51, 19.0%
GRHF (n, freq) 23, 67.6% 9, 26.5% 2, 5.9% 55, 80.9% 13, 19.1%
UGT1A1*27 CC CA AA C A
CTRL (n, freq) 113, 100% 0, 0.0% 0, 0.0% 226, 100.0% 0, 0.0%
HBV (n, freq) 54, 100% 0, 0.0% 0, 0.0% 108, 100.0% 0, 0.0%
GFHF (n, freq) 128, 95.5% 6, 4.5% 0, 0.0% 262, 97.8% 6, 2.2%
GRHF (n, freq) 31, 91.2% 3, 8.8%ab 0, 0.0% 65, 95.6% 3, 4.4%ab
UGT1A1*28 [TA]6[TA]6 [TA]6[TA]7 [TA]7[TA]7 [TA]6 [TA]7
CTRL (n, freq) 95, 84.1% 18, 15.9% 0, 0.0% 208, 92.0% 18, 8.0%
HBV (n, freq) 41, 75.9% 12, 22.2% 1, 1.9% 94, 87.0% 14, 13.0%
GFHF (n, freq) 99, 73.9% 35, 26.1% 0, 0.0% 233, 86.9% 35, 13.1%
GRHF (n, freq) 22, 64.7% 11, 32.4%a 1, 2.9% 55, 80.9% 13, 19.1%a
UGT1A1*60 TT TG GG T G
CTRL (n, freq) 46, 40.7% 53, 46.9% 14, 12.4% 145, 64.2% 81, 35.8%
HBV (n, freq) 25, 46.3% 23, 42.6% 6, 11.1% 73, 67.6% 35, 32.4%
GFHF (n, freq) 59, 44.0% 63, 47.0% 12, 9.0% 181, 67.5% 87, 32.5%
GRHF (n, freq) 16, 47.1% 14, 41.2% 4, 11.8% 46, 67.6% 22, 32.4%

p-values were calculated using Fisher’s exact test or or Pearson’s chi-square test (lowercase character “a” indicates p < 0.05 compared to the CTRL group, “b” indicating p < 0.05 compared to the HBV group). UGT1A1, UDP-glucuronosyltransferase 1A1; SNP, single-nucleotide polymorphism; HBV, hepatitis B virus. CTRL group, healthy individuals without HBV infection, gallstone, or hepatic failure; HBV group, patients with HBV infection; GFHF, patients with gallstone-free hepatic failure and HBV infection; GRHF, patients with gallstone-related hepatic failure and HBV infection. CTRL (n = 113), HBV (n = 54), GFHF (n = 134), and GRHF (n = 34).

3.4 Association between UGT1A1 haplotypes and development of GRHF

The LD pattern across the multiple SNPs of UGT1A1 is shown in Table 5. When CRHF was compared with CTRL, UGT1A1*60 and UGT1A1*6 (|D′| > 0.8, r 2 = 0.100) or stie 4 and UGT1A1*28 (|D′| = 0.782, r 2 = 0.134) showed moderate pairwise LD. Moderate pairwise LD was observed between UGT1A1*60 and UGT1A1*6 (|D′| > 0.8, r 2 = 0.094, HBV vs CTRL; |D′| > 0.8, r 2 = 0.098, GRHF vs HBV; |D′| > 0.8, r 2 = 0.113, GRHF vs GFHF), UGT1A1*60 and UGT1A1*28 (|D′| > 0.8, r 2 = 0.147, HBV vs CTRL; |D′| = 0.790, r 2 = 0.236, GRHF vs HBV; |D′| > 0.8, r 2 = 0.271, GRHF vs GFHF). In comparison between the HBV and CTRL group, UGT1A1*28 and UGT1A1*27 (|D′| = 0.8, r 2 = 0.108), UGT1A1*60 and UGT1A1*6 (|D′| > 0.8, r 2 = 0.106), or UGT1A1*60 and UGT1A1*28 (|D′| > 0.8, r 2 = 0.266) showed moderate pairwise LD. Low pairwise LD was found within UGT1A1*6, UGT1A1*27, UGT1A1*28, and UGT1A1*60 (|D′| < 0.8 or r 2 ranging 0.000–0.082). As a result, LD analysis showed the four SNPs were not significantly associated with each other. There was no evidence of apparent LD. Thus, it was likely that the four SNPs independently contribute to the association.

Table 5

Linkage disequilibrium between different SNPs of UGT1A1 gene

GRHF vs CTRL HBV vs CTRL GFHF vs HBV GRHF vs HBV GRHF vs GFHF
|D′| Site 2 Site 3 Site 4 Site 2 Site 3 Site 4 Site 2 Site 3 Site 4 Site 2 Site 3 Site 4 Site 2 Site 3 Site 4
Site 1 0.024 0.998 0.999 0.000 1.000 0.999 0.183 0.998 1.000 0.036 0.997 0.999 0.325 0.997 1.000
Site 2 — 0.255 0.487 — 0.000 0.000 — 1.000 0.998 — 0.213 0.507 — 0.704 0.790
Site 3 — — 0.782 — — 0.859 — — 0.923 — — 0.790 — — 0.883
r 2 Site 2 Site 3 Site 4 Site 2 Site 3 Site 4 Site 2 Site 3 Site 4 Site 2 Site 3 Site 4 Site 2 Site 3 Site 4
Site 1 0.000 0.022 0.100 0.000 0.019 0.094 0.000 0.033 0.106 0.000 0.037 0.098 0.001 0.039 0.113
Site 2 — 0.006 0.005 — 0.000 0.000 — 0.108 0.034 — 0.004 0.009 — 0.082 0.036
Site 3 — — 0.134 — — 0.147 — — 0.266 — — 0.236 — — 0.271

SNP, single-nucleotide polymorphism; UGT1A1, UDP-glucuronosyltransferase 1A1; HBV, hepatitis B virus. |D′|, the normalizing coefficient linkage disequilibrium; r 2, the square of correlation coefficient between pairs of loci; |D′| and r 2 of 1 correspond to complete LD, while 0 presents no LD. CTRL group, healthy individuals without HBV infection, gallstone, or hepatic failure; HBV group, patients with HBV infection; GFHF, patients with gallstone-free hepatic failure and HBV infection; GRHF, patients with gallstone-related hepatic failure and HBV infection. CTRL (n = 113), HBV (n = 54), GFHF (n = 134), and GRHF (n = 34).

Because all the four SNPs were within the UGT1A1 region, we focused on a haplotype analysis. The distribution of haplotypes of UGT1A1 polymorphisms (UGT1A1*6, UGT1A1*27, UGT1A1*28, and UGT1A1*60) in the disease and control groups is presented in Table 6. The results suggested that the haplotype G-C-[TA]6-G was significantly associated with healthy people (p < 0.05) rather than patients with GRHF, and odds ratio was 0.472. The haplotype G-C-[TA]7-T was distinctly related with GRHF patients compared with GFHF patients (p < 0.05), showing an increased risk of GRHF (OR = 7.616; 95% CI 0.887–65.411).

Table 6

Haplotype distribution of UGT1A1 polymorphisms (UGT1A1*6, UGT1A1*27, UGT1A1*28, and UGT1A1*60) among different groups

Haplotype GRHF (n, freq) CTRL (n, freq) p-value OR [95% CI]
G C [TA]6G 10.39, 15.3% 64.93, 28.7% 0.0388 0.472 [0.229, 0.973]
G C [TA]7G 9.60, 14.1% 16.07, 7.1% 0.0551 2.264 [0.965, 5.310]
A C [TA]6T 11.99, 17.6% 33.00, 14.6% 0.4498 1.323 [0.639, 2.738]
G C [TA]6T 30.6, 45.0% 110.07, 48.7% 0.8215 0.938 [0.540, 1.631]
G C [TA]7T 2.39, 3.5% 1.93, 0.9% 0.0972 4.434 [0.652, 30.177]
Haplotype HBV (n, freq) CTRL (n, freq) p-value OR [95% CI]
A C [TA]6T 16.99, 15.7% 33.00, 14.6% 0.7740 1.098 [0.581, 2.075]
G C [TA]6G 22.38, 20.7% 64.93, 28.7% 0.1238 0.651 [0.376, 1.127]
G C [TA]6T 54.62, 50.6% 110.07, 48.7% 0.7192 1.088 [0.686, 1.726]
G C [TA]7G 12.61, 11.7% 16.07, 7.1% 0.1596 1.737 [0.799, 3.775]
Haplotype GFHF (n, freq) HBV (n, freq) p-value OR [95% CI]
A C [TA]6T 50.94, 19.0% 16.99, 15.7% 0.4196 1.281 [0.701, 2.339]
G C [TA]6G 53.31, 19.9% 22.38, 20.7% 0.9068 0.967 [0.555, 1.685]
G C [TA]6T 128.75, 48.0% 54.62, 50.6% 0.7475 0.929 [0.592, 1.457]
G C [TA]7G 27.69, 10.3% 12.61, 11.7% 0.7368 0.886 [0.437, 1.797]
Haplotype GRHF (n, freq) HBV (n, freq) p-value OR [95% CI]
A C [TA]6T 11.99, 17.6% 16.99, 15.7% 0.6433 1.212 [0.537, 2.732]
G C [TA]6G 10.39, 15.3% 22.38, 20.7% 0.4414 0.728 [0.324, 1.637]
G C [TA]6T 30.62, 45.0% 54.62, 50.6% 0.6591 0.871 [0.470, 1.612]
G C [TA]7G 9.60, 14.1% 12.61, 11.7% 0.5560 1.311 [0.532, 3.232]
G C [TA]7T 2.39, 3.5% 1.39, 1.3% 0.2974 2.931 [0.354, 24.290]
Haplotype GRHF (n, freq) GFHF (n, freq) p-value OR [95% CI]
A C [TA]6T 11.99, 17.6% 50.94, 19.0% 0.8554 0.937 [0.467, 1.883]
G C [TA]6G 10.39, 15.3% 53.31, 19.9% 0.4271 0.745 [0.360, 1.543]
G C [TA]6T 30.62, 45.0% 128.75, 48.0% 0.7701 0.922 [0.535, 1.589]
G C [TA]7G 9.60, 14.1% 27.69, 10.3% 0.3403 1.466 [0.665, 3.232]
G C [TA]7T 2.39, 3.5% 1.31, 0.5% 0.0301 7.616 [0.887, 65.411]

All those frequency <0.03 was ignored in analysis; P-values were calculated using Fisher’s exact test or Pearson’s chi-square test. UGT1A1, UDP-glucuronosyltransferase 1A1; OR, odds ratio; CI, confidence interval; SNP, single-nucleotide polymorphism; UGT1A1, UDP-glucuronosyltransferase 1A1; HBV, hepatitis B virus. CTRL group, healthy individuals without HBV infection, gallstone, or hepatic failure; HBV group, patients with HBV infection; GFHF, patients with gallstone-free hepatic failure and HBV infection; GRHF, patients with gallstone-related hepatic failure and HBV infection. CTRL (n = 113), HBV (n = 54), GFHF (n = 134), and GRHF (n = 34).

4 Discussion

Genetic variation in UGT1A1 underlies the development of unconjugated hyperbilirubinemia that is a lithogenic risk factor for gallstone formation in multiple diseases, such as sickle cell disease [20], cystic fibrosis [21], and pigmentous gallstones [22]. Here, we revealed the association between UGT1A1 polymorphisms (UGT1A1*6, UGT1A1*27, UGT1A1*28, and UGT1A1*60) and GRHF. Patients in HBV, GFHF, and GRHF groups showed higher levels of total bilirubin, direct bilirubin, and indirect bilirubin. UGT1A1*27 and UGT1A1*28 showed a strong connection with GRHF. The haplotype G-C-[TA]7-T was distinctly related with GRHF patients compared with GFHF patients.

UGT1A1*6 polymorphism is frequent in neonates with severe hyperbilirubinemia in the Chaozhou region of southern China [26]. The compound heterozygous UGT1A1*6 and UGT1A1*28 are major genotypes associated with the high risks of hyperbilirubinemia in Chinese Han people [35]. UGT1A1*6 variants contribute to disordered bilirubin that results the clinical phenotype of neonatal hyperbilirubinemia [36]. However, the effect of UGT1A1*6 gene polymorphisms on gallstone in patients with HBV-related liver failure is still unknown. Our studies showed that there were no significant differences in the frequency of UGT1A1*6 between GRHF (32.4%) and CTRL, HBV (29.6%) and CTRL (26.5%), GFHF (34.3%) and HBV, GRHF and HBV, or GRHF and GFHF, suggesting that this variant was not associated with cholelithiasis observed in HBV-related liver failure. By contrast, Chaouch et al. showed that allele A and genotype AA are significantly related to a decreased risk of gallstone in Tunisian patients with cholelithiasis, suggesting that c.211G>A seems to be linked with a protective effect against gallstone [37]. Nonetheless, the different conclusions may be ascribed to the small sample size.

UGT1A1*27 is described as a substitution of cytosine by adenine, changing amino acid 229 from proline to glycine, and its mutations may have phenotypically severe jaundice classified as Crigler–Najjar syndrome [38]. Here, we presented that the frequency of UGT1A1*27 in GRHF group was 8.8%, which was obviously higher than that in the CTRL group (0.0%). The odds ratio of UGT1A1*27 was 25.22, showing that UGT1A1*27 increased the risk of gallstone in HBV-related hepatic failure. The frequencies of the genotype CA and allele A of UGT1A1*27 in GRHF were significantly higher than those of CTRL or HBV groups. This may imply that gallstone and hepatic failure are related to UGT1A1*27. A recent study from Malaysia revealed that Jaundiced neonates with severe neonatal hyperbilirubinemia were detected with genetic mutant UGT1A1*27 (c.686C>A) [33]. UGT1A1*27 mutation was detected in the patient with hyperbilirubinemia and his mother [27]. Clinical data of Korean patients with hyperbilirubinemia showed that UGT1A1*27 allele was significantly different between patients and healthy individuals [39]. On the contrary, UGT1A1*27 variants were not observed in Indian patients with neonatal hyperbilirubinemia, which may indicate the low frequency of c.686C>A in the study cohort [36].

TATA sequence polymorphism in UGT1A1 is strongly associated with glucuronidation rates of bilirubin [28]. It has been found that [TA]7 and [TA]8 variants are associated with high levels of bilirubin and increased risk of cholelithiasis in Tunisia [37]. A statistically significant association has been confirmed between allele ([TA]7) or phenotypes ([TA]6/[TA]7 and [TA]7/[TA]7) and cholelithiasis in Kuwaiti subjects with hemoglobinopathy [40]. A case–control study has suggested that chronic hepatitis C patients with increased bilirubin levels have a high frequency of UGT1A1*28 [24]. However, few studies have showed that allele ([TA]7) and genotypes ([TA]6/[TA]7 and [TA]7/[TA]7) are risk factors for cholelithiasis in liver failure caused by HBV. In our study, we found that the frequency of UGT1A1*28 variants in the CTRL group (15.9%) was lower than that in the GRHF group (35.3%). The odds ratio of UGT1A1*28 variants was 2.88 with a 95% confidence interval of 1.21–6.84, indicating that UGT1A1*28 variants were associated with cholecystolithiasis in HBV-related liver failure. By contrast, genotypes [TA]6/[TA]7 and [TA]7/[TA]7 are not significantly associated with gallstone phenotype in patients with HBV-related liver failure. Given the small sample size, this result should be viewed with caution.

UGT1A1*60 is a common variant located in the promoter region, which is a risk factor for Gilbert syndrome [29]. Sugatani et al. found that compound heterozygosity and homozygosity for mutations in the promoter of UGT1A1 gene ([TA]6>[TA]7 and c.-3279T>G) are associated with the hyperbilirubinemia in most patients with Gilbert’s syndrome [29]. For neonatal jaundice in the Malay population, c.-3279T>G, in the promoter of UGT1A1 gene, is also recognized as a risk factor [41]. Besides, the transcriptional activity of the c.-3279G allele was decreased compared with c.-3279T allele [41]. Homozygous mutation of c.-3279T>G is associated with a high level of total serum bilirubin, which represents a significant risk factor for the development of neonatal hyperbilirubinemia [42]. Besides, homozygosity of c.-3279T>G allele combined with [TA]7 heterozygous genotype is associated with pediatric mild hyperbilirubinemia [43]. It was confirmed that A–T haplotype increases the risk of hyperbilirubinemia instead of c.-3279T>G and c.-3156G>A variants alone in an Iranian population [44]. However, the frequency of UGT1A1*60 is not significantly different between GRHF and CTRL groups, implying that this variant was not associated gallstone in patients with HBV-related liver failure.

To further investigate the combined effects of SNPs in UGT1A1 on the development of gallstone- and HBV-related liver failure, haplotype analysis was carried out. Healthy participants showed a high frequency of the haplotype G-C-[TA]-G compared with GRHF patients (15.3%), revealing an association of the haplotype G-C-[TA]-G to healthy individuals. The haplotype G-C-[TA]7-T was significantly associated with GRHF compared to GFHF patients, indicating that this haplotype might be the causative factor for the development of GRHF. This result revealed that haplotype G-G-[TA]7-T may be associated with gallstone in HBV-related hepatic failure. Besides the genetic factors, cirrhotic individuals are sensitive to bile acid composition and bile nucleation, which leads to the generation of biliary stones and symptomatic cholelithiasis [45,46]. Although this study first reports the effects of UGT1A1 single-nucleotide polymorphism on gallstone-related liver failure caused by HBV, these results should be seriously viewed because of the small sample size, or be confirmed by in vivo experiments.

5 Conclusions

In total, this study broadens the knowledge concerning the association between gallstone and UGT1A1 variations in patients with HBV-related liver failure. Patients with GFHF showed increased levels of serum total bilirubin, direct bilirubin, and indirect bilirubin. UGT1A1*27 and UGT1A1*28 showed a strong association with GRHF. Haplotype G-C-[TA]7-T (UGT1A1*6, UGT1A1*27, UGT1A1*28, and UGT1A1*60) was significantly associated with GRHF patients compared with GFHF patients. Based on the finding that UGT1A1*27 and UGT1A1*28 variants were significantly observed in gallstone-related liver failure induced by HBV, our project highlights the value of UGT1A1 genotypes in genetic testing and pathogenetic studies. However, further expansion of the study population is required because statistical bias is caused by the low available population from the determined time set.

# Contributed equally to this work.

tel: +86-591-88116068

Acknowledgments

Not applicable.

  1. Funding information: This work was supported by the Fujian Provincial Natural Science Foundation (grant number 2010J01118) and the Fuzhou Health Science and Technology Plan Project (grant number 2020-S-wq7).

  2. Author contributions: Z.H.Y. and Y.L.F. designed the study. Z.H.Y. and F.J.H. interpreted data and wrote the article. Z.B.F. and S.Y.X. screened literature and extracted data. Z.L.Q. and C.Y.H. conducted statistical analyses. All authors critically revised the manuscript, approved the final version to be published, and agreed to be accountable for all aspects of the work.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: All data generated or analyzed during this study are included in this published article.

References

[1] Péneau C, Imbeaud S, La Bella T, Hirsch TZ, Caruso S, Calderaro J, et al. Hepatitis B virus integrations promote local and distant oncogenic driver alterations in hepatocellular carcinoma. Gut. 2022;71(3):616–26. 10.1136/gutjnl-2020-323153.Search in Google Scholar

[2] Wong SW, Ting YW, Yong YK, Tan HY, Barathan M, Riazalhosseini B, et al. Chronic inflammation involves CCL11 and IL-13 to facilitate the development of liver cirrhosis and fibrosis in chronic hepatitis B virus infection. Scand J Clin Lab Invest. 2021;81(2):147–59. 10.1080/00365513.2021.1876245.Search in Google Scholar

[3] Tang X, Qi T, Li B, Chen J. Pre-acute-on-chronic liver failure in hepatitis B-related patients. J Hepatol. 2021;74(2):479–80. 10.1016/j.jhep.2020.09.001.Search in Google Scholar

[4] Polaris Observatory Collaborators. Global prevalence, treatment, and prevention of hepatitis B virus infection in 2016: A modelling study. Lancet Gastroenterol Hepatol. 2018;3(6):383–403. 10.1016/s2468-1253(18)30056-6.Search in Google Scholar

[5] Organization WH. Global hepatitis report 2017. World Health Organization; 2017.Search in Google Scholar

[6] Xie GJ, Zhang HY, Chen Q, Liu HM, You JP, Yang S, et al. Changing etiologies and outcome of liver failure in Southwest China. Virol J. 2016;13:89. 10.1186/s12985-016-0536-0.Search in Google Scholar PubMed PubMed Central

[7] You S, Rong Y, Zhu B, Zhang A, Zang H, Liu H, et al. Changing etiology of liver failure in 3,916 patients from northern China: A 10-year survey. Hepatol Int. 2013;7(2):714–20. 10.1007/s12072-013-9424-5.Search in Google Scholar PubMed

[8] Gu WY, Xu BY, Zheng X, Chen J, Wang XB, Huang Y, et al. Acute-on-chronic liver failure in China: Rationale for developing a patient registry and baseline characteristics. Am J Epidemiol. 2018;187(9):1829–39. 10.1093/aje/kwy083.Search in Google Scholar PubMed

[9] Wijarnpreecha K, Thongprayoon C, Panjawatanan P, Manatsathit W, Ungprasert P. Hepatitis B virus infection and risk of gallstones: A systematic review and meta-analysis. Eur J Gastroenterol Hepatol. 2016;28(12):1437–42. 10.1097/meg.0000000000000754.Search in Google Scholar PubMed

[10] Sulaberidze GT, Rachvelishvili NB, Zhamutashvili MT, Barbakadze GG. HBV as one of the causes for development of cholelithiasis. Georgian Med N. 2009;168:56–60.Search in Google Scholar

[11] Tang S-H, Huang Q-Y, Zhou J-M, Wu S-L. Risk factors of cholelithiasis in patients with hepatitis B virus-associated chronic liver diseases. Med J Chin People’s Liberation Army. 2014;39(6):485–8.Search in Google Scholar

[12] Chen B, Lin S. Albumin-bilirubin (ALBI) score at admission predicts possible outcomes in patients with acute-on-chronic liver failure. Med (Baltim). 2017;96(24):e7142. 10.1097/MD.0000000000007142.Search in Google Scholar PubMed PubMed Central

[13] Lee HA, Jung JY, Lee YS, Jung YK, Kim JH, An H, et al. Direct bilirubin is more valuable than total bilirubin for predicting prognosis in patients with liver cirrhosis. Gut Liver. 2021;15(4):599–605. 10.5009/gnl20171.Search in Google Scholar PubMed PubMed Central

[14] Perreault M, Gauthier-Landry L, Trottier J, Verreault M, Caron P, Finel M, et al. The Human UDP-glucuronosyltransferase UGT2A1 and UGT2A2 enzymes are highly active in bile acid glucuronidation. Drug Metab Dispos. 2013;41(9):1616–20. 10.1124/dmd.113.052613.Search in Google Scholar PubMed PubMed Central

[15] Sneitz N, Vahermo M, Mosorin J, Laakkonen L, Poirier D, Finel M. Regiospecificity and stereospecificity of human UDP-glucuronosyltransferases in the glucuronidation of estriol, 16-epiestriol, 17-epiestriol, and 13-epiestradiol. Drug Metab Dispos. 2013;41(3):582–91. 10.1124/dmd.112.049072.Search in Google Scholar PubMed

[16] Wang Z, Wong T, Hashizume T, Dickmann LZ, Scian M, Koszewski NJ, et al. Human UGT1A4 and UGT1A3 conjugate 25-hydroxyvitamin D3: metabolite structure, kinetics, inducibility, and interindividual variability. Endocrinology. 2014;155(6):2052–63. 10.1210/en.2013-2013.Search in Google Scholar PubMed PubMed Central

[17] Lévesque E, Girard H, Journault K, Lépine J, Guillemette C. Regulation of the UGT1A1 bilirubin-conjugating pathway: Role of a new splicing event at the UGT1A locus. Hepatology. 2007;45(1):128–38. 10.1002/hep.21464.Search in Google Scholar PubMed

[18] Udomuksorn W, Elliot DJ, Lewis BC, Mackenzie PI, Yoovathaworn K, Miners JO. Influence of mutations associated with Gilbert and Crigler-Najjar type II syndromes on the glucuronidation kinetics of bilirubin and other UDP-glucuronosyltransferase 1A substrates. Pharmacogenet Genomics. 2007;17(12):1017–29. 10.1097/FPC.0b013e328256b1b6.Search in Google Scholar PubMed

[19] Sneitz N, Bakker CT, De Knegt RJ, Halley DJ, Finel M, Bosma PJ. Crigler-Najjar syndrome in The Netherlands: Identification of four novel UGT1A1 alleles, genotype-phenotype correlation, and functional analysis of 10 missense mutants. Hum Mutat. 2010;31(1):52–9. 10.1002/humu.21133.Search in Google Scholar PubMed

[20] Haverfield EV, Mckenzie CA, Forrester T, Bouzekri N, Harding R, Serjeant G, et al. UGT1A1 variation and gallstone formation in sickle cell disease. Blood. 2005;105(3):968–72. 10.1182/blood-2004-02-0521.Search in Google Scholar PubMed

[21] Wasmuth HE, Keppeler H, Herrmann U, Schirin-Sokhan R, Barker M, Lammert F. Coinheritance of Gilbert syndrome-associated UGT1A1 mutation increases gallstone risk in cystic fibrosis. Hepatology. 2006;43(4):738–41. 10.1002/hep.21105.Search in Google Scholar PubMed

[22] Ravikanth VV, Rao GV, Govardhan B, Sasikala M, Subramanyam C, Vivekananda Murthy HV, et al. Polymorphisms in UGT1A1 gene predispose South Indians to pigmentous gallstones. J Clin Exp Hepatol. 2016;6(3):216–23. 10.1016/j.jceh.2016.08.004.Search in Google Scholar PubMed PubMed Central

[23] Warang P, Devendra R, D’silva S, Chiddarwar A, Kedar P, Ghosh K, et al. Do UGT1A1 and HMOX1 gene promoter polymorphisms increase the risk of hyperbilirubinemia and gallstones in patients with hereditary spherocytosis? Ann Hematol. 2015;94(1):169–71. 10.1007/s00277-014-2123-z.Search in Google Scholar PubMed

[24] De Souza MMT, Vaisberg VV, Abreu RM, Ferreira AS, Dasilvaferreira C, Nasser PD, et al. UGT1A1*28 relationship with abnormal total bilirubin levels in chronic hepatitis C patients: Outcomes from a case-control study. Med (Baltim). 2017;96(11):e6306. 10.1097/MD.0000000000006306.Search in Google Scholar

[25] Marku E, Maltese PE, Koni M, Capodicasa N, Qendro IS, Rigoni E, et al. Polymorphism of UGT1A1*28 (TA)7 and liver damage in hepatitis B virus-positive patients in Albania. Genet Mol Res. 2015;14(2):5221–8. 10.4238/2015.May.18.13.Search in Google Scholar

[26] Yang H, Wang Q, Zheng L, Zheng XB, Lin M, Zhan XF, et al. Clinical significance of UGT1A1 genetic analysis in chinese neonates with severe hyperbilirubinemia. Pediatr Neonatol. 2016;57(4):310–7. 10.1016/j.pedneo.2015.08.008.Search in Google Scholar

[27] Tan Y, Ye Y, Zhou X. Nilotinib-induced liver injury: A case report. Med (Baltim). 2020;99(36):e22061. 10.1097/MD.0000000000022061.Search in Google Scholar

[28] Iyer L, Hall D, Das S, Mortell MA, Ramírez J, Kim S, et al. Phenotype-genotype correlation of in vitro SN-38 (active metabolite of irinotecan) and bilirubin glucuronidation in human liver tissue with UGT1A1 promoter polymorphism. Clin Pharmacol Ther. 1999;65(5):576–82. 10.1016/s0009-9236(99)70078-0.Search in Google Scholar

[29] Sugatani J, Yamakawa K, Yoshinari K, Machida T, Takagi H, Mori M, et al. Identification of a defect in the UGT1A1 gene promoter and its association with hyperbilirubinemia. Biochem Biophys Res Commun. 2002;292(2):492–7. 10.1006/bbrc.2002.6683.Search in Google Scholar PubMed

[30] De Mattia E, Cecchin E, Polesel J, Lupo F, Tiribelli C, Crovatto M, et al. UGT1A polymorphisms as genetic biomarkers for hepatocellular carcinoma risk in Caucasian population. Liver Int. 2017;37(9):1345–53. 10.1111/liv.13411.Search in Google Scholar PubMed

[31] Liu JY, Qu K, Sferruzza AD, Bender RA. Distribution of the UGT1A1*28 polymorphism in Caucasian and Asian populations in the US: A genomic analysis of 138 healthy individuals. Anticancer Drugs. 2007;18(6):693–6. 10.1097/CAD.0b013e32803a46fe.Search in Google Scholar PubMed

[32] Lampe JW, Bigler J, Horner NK, Potter JD. UDP-glucuronosyltransferase (UGT1A1*28 and UGT1A6*2) polymorphisms in Caucasians and Asians: relationships to serum bilirubin concentrations. Pharmacogenetics. 1999;9(3):341–9. 10.1097/00008571-199906000-00009.Search in Google Scholar PubMed

[33] Boo NY, Sin S, Chee SC, Mohamed M, Ahluwalia AK, Ling MM, et al. Genetic factors and delayed TSB monitoring and treatment as risk factors associated with severe hyperbilirubinemia in term neonates admitted for phototherapy. J Trop Pediatr. 2020;66(6):569–82. 10.1093/tropej/fmaa016.Search in Google Scholar PubMed

[34] Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res. 2005;15(2):97–8. 10.1038/sj.cr.7290272.Search in Google Scholar

[35] Zhang M, Wang H, Huang Y, Xu X, Liu W, Ning Q, et al. Compound heterozygous UGT1A1*28 and UGT1A1*6 or single homozygous UGT1A1*28 are major genotypes associated with Gilbert’s syndrome in Chinese Han people. Gene. 2021;781:145526. 10.1016/j.gene.2021.145526.Search in Google Scholar

[36] Tiwari PK, Bhutada A, Agarwal R, Basu S, Raman R, Kumar A. UGT1A1 gene variants and clinical risk factors modulate hyperbilirubinemia risk in newborns. J Perinatol. 2014;34(2):120–4. 10.1038/jp.2013.140.Search in Google Scholar

[37] Chaouch L, Said Y, Moumni I, Mahjoubi I, Chaabene AB, Darragi I, et al. Implication of genetic variation at the promoter and exon1 of UGT1A1 in occurrence of cholelithiasis in Tunisia. Ann Biol Clin (Paris). 2012;70(6):702–6. 10.1684/abc.2012.0743.Search in Google Scholar

[38] Aono S, Adachi Y, Uyama E, Yamada Y, Keino H, Nanno T, et al. Analysis of genes for bilirubin UDP-glucuronosyltransferase in Gilbert’s syndrome. Lancet. 1995;345(8955):958–9. 10.1016/s0140-6736(95)90702-5.Search in Google Scholar

[39] Kim JJ, Oh J, Kim Y, Lee KA. Genetic Spectrum of UGT1A1 in Korean Patients with Unconjugated Hyperbilirubinemia. Ann Lab Med. 2020;40(3):281–3. 10.3343/alm.2020.40.3.281.Search in Google Scholar PubMed PubMed Central

[40] Alfadhli S, Al-Jafer H, Hadi M, Al-Mutairi M, Nizam R. The effect of UGT1A1 promoter polymorphism in the development of hyperbilirubinemia and cholelithiasis in hemoglobinopathy patients. PLoS One. 2013;8(10):e77681. 10.1371/journal.pone.0077681.Search in Google Scholar PubMed PubMed Central

[41] Yusoff S, Takeuchi A, Ashi C, Tsukada M, Ma’amor NH, Zilfalil BA, et al. A polymorphic mutation, c.-3279T > G, in the UGT1A1 promoter is a risk factor for neonatal jaundice in the Malay population. Pediatr Res. 2010;67(4):401–6. 10.1203/PDR.0b013e3181d22f78.Search in Google Scholar PubMed

[42] Tomerak RH, Helal NF, Shaker OG, Yousef MA. Association between the specific UGT1A1 promoter sequence variant (c-3279T > G) and unconjugated neonatal hyperbilirubinemia. J Trop Pediatr. 2016;62(6):457–63. 10.1093/tropej/fmw031.Search in Google Scholar PubMed

[43] Ferraris A, D’amato G, Nobili V, Torres B, Marcellini M, Dallapiccola B. Combined test for UGT1A1 -3279T-- > G and A(TA)nTAA polymorphisms best predicts Gilbert’s syndrome in Italian pediatric patients. Genet Test. 2006;10(2):121–5. 10.1089/gte.2006.10.121.Search in Google Scholar PubMed

[44] Pouralizadeh N, Mamouri G, Boskabadi A, Boskabadi H, Rafatpanah H, Moradi A, et al. Genetic association of UGT1A1 promoter variants (c.-3279T > G and c.-3156G > A) with Neonatal Hyperbili-rubinemia in an Iranian Population. Iranian J Neonatology IJN. 2021;12(2):63–9.Search in Google Scholar

[45] Wang SY, Yeh CN, Jan YY, Chen MF. Management of gallstones and acute cholecystitis in patients with liver cirrhosis: What should we consider when performing surgery? Gut Liver. 2021;15(4):517–27. 10.5009/gnl20052.Search in Google Scholar PubMed PubMed Central

[46] Ramirez-Perez O, Cruz-Ramon V, Aguilar-Olivos N, Mendez X, Sanchez N. The role of unconjugated bilirubin in the development of non-alcoholic fatty liver disease and gallstone disease. Off J Am Coll Gastroenterol. 2018;113:S1579.Search in Google Scholar
Received: 2022-04-20
Revised: 2022-08-03
Accepted: 2022-08-10
Published Online: 2022-09-06

© 2022 Haiyan Zhuo et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0549
Keywords for this article
UGT1A1; gallstone; liver failure; hepatitis B virus; single-nucleotide polymorphism
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 9.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0549/html
Scroll to top button