Startseite lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
Artikel Open Access

lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB

  • Shuangqin Peng , Yanjun Luo , Lijuan Chen , Kang Dai und Qin Wang EMAIL logo
Veröffentlicht/Copyright: 9. Dezember 2022
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 17 Heft 1

Abstract

The oncogenic role of lncRNA ELFN1-AS1 has been described in different cancers, including colon cancer (CC). However, how ELFN1-AS1 regulates CC malignancy remains unclear. In this study, ELFN1-AS1, AURKB, and miR-4270 expression levels in CC cells and tissues were determined using RT-qPCR and western blotting. CCK-8 and wound healing assays were also performed to analyze alterations in CC cell proliferation and migration. The expression of apoptosis-related proteins (Bax and Bcl-2) was determined via western blot analysis. RNA immunoprecipitation (RIP) assays coupled with luciferase reporter assays were employed to verify the relationship between miR-4270, ELFN1-AS1, and AURKB. An in vivo assay was performed using xenograft tumors in mice to detect the change of tumor growth. It was found that AURKB and ELFN1-AS1 expression was upregulated, whereas miR-4270 was downregulated in CC cells and tissues. ELFN1-AS1 silencing exhibited anti-proliferative, anti-migratory, and pro-apoptotic effects in CC cells. The tumor-suppressive effect of ELFN1-AS1 silencing was verified using in vivo assays. MiR-4270 was predicted to be a target of ELFN1-AS1 and AURKB as a target of miR-4270. Their interactions were further elucidated using luciferase reporter and RNA RIP assays. More importantly, treatment with a miR-4270 inhibitor not only rescued the tumor-suppressing effect of ELFN1-AS1 silencing but also abrogated the tumor suppressor functions of AURKB silencing in CC cells. Taken together, the ELFN1-AS1/miR-4270/AURKB axis facilitates CC tumorigenesis; therefore, targeting this axis might be a promising intervention in preventing CC progression.

Keywords: colon cancer; lncRNA ELFN1-AS1; miR-427; AURKB

1 Introduction

Colon cancer (CC) is the fourth most frequently diagnosed cancer and a predominant cause of cancer-related deaths worldwide. It has been reported that 1,148,515 new CC cases were diagnosed globally in 2020 [1]. Cancer-related fatality resulting from CC ranks behind lung, breast, stomach, and liver cancers, accounting for approximately 5% of all cancer-related mortalities [1]. Furthermore, CC could occur at any age, even in infancy [2,3]. Due to the asymptomatic or paucisymptomatic nature of the disease, most patients with CC are already diagnosed at a late stage upon initial clinical visit [4]. Notably, clinicians easily misdiagnose and miss CC in children or adolescents because these patients cannot detail their disease history and irregular living habits [3]. Although enormous improvements in therapies have been made in the last few years, the 5-year survival rate of patients with advanced CC is less than 5% [5]. In the era of precision medicine, appropriate therapeutic targets can be identified by revealing the genetic characteristics underlying cancer development [6]. Therefore, deciphering the mechanisms underlying CC progression is needed to facilitate diagnosis and therapy for this disease, especially in children.

Although the human genome is pervasively transcribed, >98% of RNA transcripts do not possess coding capacity. Among these, long noncoding RNAs (lncRNAs) are a subtype of transcripts longer than 200 bp. Compelling evidence has demonstrated that lncRNAs facilitate multiple cellular functions such as proliferation and migration. Abnormalities in these vital cellular functions have been described in various human disorders, including cancers [7,8]. An increasing number of lncRNAs are being discovered to play a role in CC progression. For example, the lncRNA LINC00662 promotes the expression of the ERK signaling pathway, facilitating CC progression [9]. Using data obtained from the TCGA database, Lin et al. identified immune-related lncRNAs, which are associated with the clinicopathological features of patients with CC [10]. Targeting the lncRNA DNAJC3-AS1 attenuates the migration, invasion, and epithelial–mesenchymal transition of CC cells [11]. ELFN1-AS1 is a newly identified lncRNA located on the human chromosome 7p22.3. The oncogenic role of lncRNA ELFN1-AS1 has been described in different cancers, including CC [12–16]. However, the regulatory mechanisms underlying CC progression remain unknown.

MicroRNAs (miRNAs) are 18–22 nucleotide-lncRNAs that inhibit RNA translation, promote RNA degradation, and regulate transcription and splicing processes [17]. The role of miRNAs in cancer has been studied previously. For example, miR-122, miR-1271, and miR-15b were associated with the risk of renal clear cell carcinoma [18,19]. A growing body of evidence suggests that several miRNAs are differentially expressed in CC and play important roles in its diagnosis and progression. MiR-378 acts as a tumor suppressor in CC as it has been found to be low in CC tissues and cell lines and inhibits proliferation, migration, and invasion of CC cells by targeting SDAD1 [20]. On the contrary, miR-510 acts as a tumor promoter in CC as it has been found to be considerably increased in CC tissues and cell lines and has been shown to promote CC cell proliferation, migration, and invasion by targeting SRCIN 1 [21]. Furthermore, the upregulation of miR-654-5p and downregulation of miR-376b-3p might be related to tumor progression in CC [22]. Moreover, lncRNAs have been found to epigenetically, transcriptionally, or post-transitionally modulate gene expression, contributing to their functional diversity [23]. lncRNAs negatively regulate miRNA expression, owing to their promiscuity with miRNA seed sequences, which is recognized as a competing endogenous RNA (ceRNA) mechanism. For instance, LINC00662 functions as a ceRNA of miR-340-5p, stimulates the ERK signaling pathway, and promotes CC progression [9]. The oncogenic NF-κB signaling pathway is hyperactivated by a ceRNA network consisting of the lncRNA DNAJC3-AS1, miR-214-3p, and LIVIN, resulting in CC progression [11]. Examples of ELFN1-AS1 ceRNA activity in different cancers include sponging miR-183-3p [24], miR-497-3p [25], mi-4644 [14], and miR-2470 [15]. Feng et al. found that miR-4270 was a target of ELFN1-AS1 in retinoblastoma (RB) [15]. Interestingly, miR-4270 acts as a tumor suppressor or oncomiR in various cancers [26,27]. However, the role of miR-4270 in CC has not yet been elucidated.

In this study, we investigated the role of the lncRNA ELFN1-AS1 in CC in vitro and in vivo. We also explored the ceRNA activity of ELFN1-AS1 on miR-4270 in CC. Our findings suggest that inhibiting ELFN1-AS1 expression might represent a therapeutic target in CC, implicating ELFN1-AS1 silencing as a promising therapeutic intervention in patients with CC.

2 Materials and methods

2.1 Patients and tissue samples

In total, 45 pairs of CC tissues and corresponding noncancerous tissues were obtained from the Maternity and Child Healthcare Hospital in Hubei, China. The patients whose samples were taken did not receive preoperative chemotherapy or chemoradiotherapy. After dissection and pathological confirmation, the clinical specimens were immediately frozen in liquid nitrogen and stored at –80°C until further analysis.

  1. Ethical approval: Ethics Committee of the Maternal and Child Hospital of Hubei Province (Wuhan, China) approved this work. All clinical samples were processed in strict concurrence with the Declaration of Helsinki s ethical standards. Informed consent was obtained from each patient before the tumors were surgically resected.

2.2 Cell culture

Normal colon FHC and CC cell lines (SW480, HCT116, and SW620) were obtained from the American Type Culture Collection (USA). FHC cells (DMEM, Thermo Fisher, USA), HCT116 (McCoy’s 5A Medium, Thermo Fisher), SW480, and SW620 cells (Leibovitz’s L-15 Medium, Thermo Fisher) were maintained in the indicated culture media supplemented with FBS (Thermo Fisher) and 1% penicillin–streptomycin solution (Thermo Fisher). The cells were cultured at 37°C in an incubator with an atmosphere of 5% CO2.

2.3 Cell transfection

Si-ELFN1-AS1 (si-lnc-1 and si-lnc-2), sh-ELFN1-AS1, si-AURKB, miR-4270 inhibitor/mimic, and their corresponding NCs were obtained from Hanbio Shanghai Biotechnology Co. Ltd, China. The synthesized oligonucleotides were transfected into 80% confluent SW480 and SW620 cell cultures using Lipofectamine 3000 reagent (Invitrogen, USA). After 48 h, RT-qPCR was conducted to analyze the transfection efficiency. To establish stable ELFN1-AS1-knockdown cells, sh-NC and sh-ELFN1-AS1 lentivirus vectors were introduced into SW480 cells, followed by neomycin selection. Five weeks later, neomycin-surviving cells were collected and validated using RT-qPCR.

2.4 CCK-8 assay

SW480 and SW620 cells were maintained in 96-well plates (5,000 cells per well) for 0, 24, 48, and 72 h. Next, 10 μL of CCK8 reagent (Thermo Fisher) was added to the cells and incubated for another 3 h. The absorbance of each well was then measured at 450 nm using a spectrophotometer.

2.5 Wound-healing assay

Briefly, 2  ×  105 SW480 and SW620 cells were seeded in each well of 24-well plates and were cultured until the cell monolayers reached 90% confluence. Next, a new 1-mL pipette tip was used to scratch the cell monolayer, and the scratched cellular debris was washed away. After incubation for another 24 h, the cells were photographed under a microscope at 100× magnification.

2.6 RT-qPCR

A RiboZol RNA kit (AMRESCO, USA) was used to extract total RNA from CC cells and tissues. Reverse transcription from isolated total RNA (3 μg) was conducted using a Titan One Tube RT-PCR kit (Merck, USA) or HyperScript III miRNA 1st Strand cDNA Synthesis Kit (NovaBio, China), according to the respective manufacturer’s instructions. Premixed maximum SYBR Green/ROX qPCR (Thermo Scientific, USA) was applied for qPCR analysis on the StepOnePlus system (Applied Biosystems, USA). The relative expressions of the target genes were calculated using the 2∆∆Ct method and were normalized using U6 or GAPDH as an internal control. The sequences of the primers used are listed in Table 1.

Table 1

Real-time PCR primer synthesis list

Gene Sequences
ELFN1-AS1 Forward 5′−TGTCATTCACTCCGAGACGC−3′
Reverse 5′−TGAGAGTGAATTCGGGGTGC−3′
miR-4270 Forward 5′−ACAAATAGCTTCAGGGAGTCAGG−3′
Reverse 5′−GACCCACTTTCTTCCCAGCA−3′
AURKB Forward 5′−GGGAGAGTAGCAGTGCCTTG−3′
Reverse 5′−CAGCTCTTCTGCAGCTCCTT−3′
U6 Forward 5′−CTCGCTTCGGCAGCACA−3′
Reverse 5′−AACGCTTCACGAATTTGCGT−3′
GAPDH Forward 5′−AGAAAAACCTGCCAAATATGATGAC−3′
Reverse 5′−TGGGTGTCGCTGTTGAAGTC−3′

A nuclear and cytoplasmic protein extraction kit (Beyotime, China) was used for the nucleocytoplasmic fractionation of SW480 and SW620 cells. Both extracts were subjected to RT-qPCR.

2.7 Western blot

Radioimmunoprecipitation assay lysis buffer was used to prepare SW480 and SW620 cell lysates. After microcentrifugation, the protein samples were quantified using a BCA Protein Assay kit (Abcam, USA). Protein samples (20 µg) were separated using 10% SDS-PAGE and transferred to a PVDF membrane at a constant voltage of 75 V. The membranes were blocked with 5% skim milk at room temperature for 1 h and then incubated with anti-AURKB (Cat#:36-5200; 1:1,000; Thermo Fisher), anti-Bax (Cat#:33-6400; 1:1,000; Thermo Fisher), anti-Bcl-2 (Cat#: MA5-11757; 1:1,000; Thermo Fisher), and anti-GAPDH antibodies (Cat#: MA1-16757; 1:1,000; Thermo Fisher) overnight at 4°C. The next day, the membranes were incubated at room temperature with HRP-conjugated goat anti-rabbit/mouse secondary antibodies (Cat#: SA5-10204 or A32727; 1:1,000; Thermo Fisher) for 2 h. The blots were then developed using BeyoECL Plus mix substrate (Beyotime, USA), and ImageJ (Image J Software, National Institutes of Health, USA) was used to quantify the target proteins.

2.8 Murine xenograft model

BALB/c mice (6–8-week old, 20–25 g) were obtained from the Animal Resource Center at the Wuhan Institute of Virology, Chinese Academy of Sciences, China. Mice were caged individually under specific pathogen-free conditions with good ventilation. Food and water were supplied daily. To construct a CC xenograft mouse model, SW480 cells were stably transfected with sh-ELFN1-AS1 or sh-NC and harvested in the exponential growth phase. Next, the mice received subcutaneous injections (1 × 107 cells/mouse) of the prepared CC cells. Xenograft size was monitored every 4 days using calipers (length, width, and height). The mice were anesthetized and euthanized via CO2 asphyxiation on the 28th day. Finally, the tumors were harvested and weighed.

  1. Ethical approval: The procedures executed in the animal study were authorized by the Maternal and Child Hospital of Hubei Province. All experiments on animals comply with the ARRIVE guidelines.

2.9 Luciferase reporter assay

The wild-type (WT) sequences of miR-4270 binding to the 3′-UTR of ELFN1-AS1 or AURKB and the corresponding designed mutant (MUT) sequences were inserted into the GP-mirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, USA). The luciferase vectors containing ELFN1-AS1-WT, ELFN1-AS1-MUT, AURKB-WT, or AURKB-MUT were co-incubated with a miR-4270 or NC mimic in SW480 and SW620 cells. After 48 h, luminescence was monitored using a dual-luciferase reporter assay system (Promega). The outcomes are presented as normalized luciferase activity (Renilla luciferase/firefly luciferase).

2.10 RNA immunoprecipitation (RIP) assay

An EZ-Magna RIP Kit (Millipore) was employed as per the supplier’s directions to confirm the direct binding of ELFN1-AS1 and miR-4270. Briefly, SW480 and SW620 cells were lysed using a lysis buffer. The collected lysates were mixed with magnetic beads pre-covered with anti-IgG or anti-AGO2 antibodies. Finally, RT-qPCR was performed to evaluate the expression of the immunoprecipitated complex.

2.11 Statistical analysis

Statistical analyses were performed using GraphPad Prism 9 software (Prism, USA). The results are reported as mean ± SD. Student’s t-test was performed for two-group comparisons, while one-way analysis of variance (ANOVA) with Tukey’s post-hoc analysis was performed for multiple-group comparisons. The correlation between miR-4270 and the lncRNAs ELFN1-AS1 or AURKB was analyzed using Pearson’s correlation analysis. P < 0.05 was considered statistical significance.

3 Results

3.1 Upregulation of the cytoplasmic lncRNA ELFN1-AS1 in CC

To determine the role of ELFN1-AS1 in CC, its expression in 45 pairs of colon tissues and corresponding noncancerous tissues was examined. RT-qPCR results showed that ELFN1-AS1 expression was higher in tumor tissues than in normal tissues (Figure 1a). Higher ELFN1-AS1 levels were also detected in CC cells (SW480, HCT116, and SW620) than in normal FHC cells (Figure 1b). In particular, an increase in ELFN1-AS1 expression was observed in SW480 and SW620 cells compared to FHC cells. Meanwhile, the cytoplasm/nucleus separation assays showed that ELFN1-AS1 was predominantly enriched in the cytoplasm of SW480 and SW620 cells (Figure 1c), suggesting that ELFN1-AS1 exerts important cytoplasmic functions, such as acting as a miRNA sponge.

Figure 1 Upregulation of the cytoplasmic lncRNA ELFN1-AS1 in CC. (a) RT-qPCR of ELFN1-AS1 expression in CC tissues and normal tissues. (b) RT-qPCR of ELFN1-AS1 expression in CC cells (SW480, HCT116, and SW620). **P＜0.01 vs FHC. (c) RT-qPCR analysis of nuclear and cytoplasmic ELFN1-AS1 in both SW480 as well as SW620 cells.
Figure 1

Upregulation of the cytoplasmic lncRNA ELFN1-AS1 in CC. (a) RT-qPCR of ELFN1-AS1 expression in CC tissues and normal tissues. (b) RT-qPCR of ELFN1-AS1 expression in CC cells (SW480, HCT116, and SW620). **P＜0.01 vs FHC. (c) RT-qPCR analysis of nuclear and cytoplasmic ELFN1-AS1 in both SW480 as well as SW620 cells.

3.2 ELFN1-AS1 silencing retards CC growth in vitro and in vivo

To explore whether ELFN1-AS1 plays a role in CC tumorigenesis, we transfected si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) into SW480 and SW620 cells. An obvious reduction in ELFN1-AS1 expression was observed in both si-lnc-1- and si-lnc-2-treated CC cells (Figure 2a). Moreover, si-lnc-1 and si-lnc-2 expression significantly decreased the viability of SW480 and SW620 cells (Figure 2b). Scratch assays also demonstrated that si-lnc-1 and si-lnc-2 treatment reduced the migration of both CC cell lines (Figure 2c). A clear apoptotic activation upon ELFN1-AS1 silencing (si-lnc-1 and si-lnc-2) in CC cells was evidenced via western blotting, which showed increased Bax and decreased Bcl-2 expression (Figure 2d). More interestingly, quantification of the size and weight of the xenograft tumors showed that ELFN1-AS1 silencing significantly reduced tumorigenesis in vivo (Figure 2e). Taken together, our findings suggested that the malignant behavior of CC cells was inhibited through ELFN1-AS1 silencing in vitro and impeded tumor growth in vivo.

Figure 2 ELFN1-AS1 silence retards CC growth in vitro and in vivo. si-ELFN1-AS1 and si-NC were transfected into SW480 and SW620 cells. After 48 h, (a) ELFN1-AS1 expression in si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) or si-NC transfected SW480 as well as SW620 cells was determined through RT-qPCR. **P＜0.01 vs si-NC. (b) Quantification of cell proliferation of si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) or si-NC transfected SW480 as well as SW620 was detected by CCK8 assays. **P＜0.01 vs si-NC. (c) Wound-healing assay of SW480 and SW620 transfected with si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) compared to cells with or si-NC. Representative image shown. **P＜0.01 vs si-NC. (d) The Bax and Bcl-2 expression in SW480 and SW620 transfected with si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) and si-NC was checked through western blotting. **P＜0.01 vs si-NC. (e) The in vivo ELFN1-AS1 silencing effect was evaluated in xenograft mouse models bearing tumors originating from SW480 cells. **P＜0.01 vs sh-NC.
Figure 2

ELFN1-AS1 silence retards CC growth in vitro and in vivo. si-ELFN1-AS1 and si-NC were transfected into SW480 and SW620 cells. After 48 h, (a) ELFN1-AS1 expression in si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) or si-NC transfected SW480 as well as SW620 cells was determined through RT-qPCR. **P＜0.01 vs si-NC. (b) Quantification of cell proliferation of si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) or si-NC transfected SW480 as well as SW620 was detected by CCK8 assays. **P＜0.01 vs si-NC. (c) Wound-healing assay of SW480 and SW620 transfected with si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) compared to cells with or si-NC. Representative image shown. **P＜0.01 vs si-NC. (d) The Bax and Bcl-2 expression in SW480 and SW620 transfected with si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) and si-NC was checked through western blotting. **P＜0.01 vs si-NC. (e) The in vivo ELFN1-AS1 silencing effect was evaluated in xenograft mouse models bearing tumors originating from SW480 cells. **P＜0.01 vs sh-NC.

3.3 ELFN1-AS1 targets miR-4270

Considering the cytoplasmic localization of ELFN1-AS1, we determined the potential downstream targets affecting ELFN1-AS1 function. Bioinformatic analysis showed that the ELFN1-AS1 sequence contained two putative binding sites for miR-4270 (Figure 3a). To validate this prediction, we fused the ELFN1-AS1 sequence and three mutated sequences to luciferase reporter vectors and then co-incubated them with a miR-4270 or NC mimic into SW480 and SW620 cells. Quantification of luciferase activity showed that the miR-4270 mimic remarkably reduced the transcriptional activity of ELFN1-AS1 or only partly influenced the transcriptional activity of Mut-1 and Mut-2 ELFN1-AS1; however, it failed to affect co-MUT transcription (Figure 3b). LncRNAs act as miRNA sponges, modulate miRNA activity, and form an RNA-induced silencing complex (RISC); the AGO2 protein is essential in this complex. Therefore, we performed AGO2 enrichment analysis on SW480 and SW620 cells to verify whether ELFN1-AS1 and miR-4270 could bind to the Ago2 protein in RISC. The results demonstrated that both ELFN1-AS1 and miR-4270 were enriched in the Ago2-IP fractions (Figure 3c). Therefore, miR-4270 is a potential target of ELFN1-AS. It is well-recognized that lncRNAs antagonize miRNA expression, weakening their action by binding to their binding site. The RT-qPCR analysis demonstrated that miR-4270 expression was downregulated in both CC cells and tissues (Figures 3d and 3e). A negative correlation existed between miR-4270 and ELFN1-AS1 levels in CC tissues (Figure 3f), while upregulated miR-4270 levels were observed in the si-lnc-1- and si-lnc-2-treated groups, as shown by the RT-qPCR results (Figure 3g). These data further validate the antagonizing interaction between miR-4270 and ELFN1-AS1.

Figure 3 ELFN1-AS1 targets miR-4270. (a) Predicted lncRNA–miRNA interactions (ELFN1-AS1 and miR-4270) was predicted by bioinformatic analysis. (b) Luciferase activity in extracts from SW480 as well as SW620 cells co-transfected with ELFN1-AS1-related wide type or mutant luciferase vectors and miR-4270 mimic or NC. *P＜0.05, **P＜0.01 vs WT + NC. (c) RT-qPCR assessing AGO2 RIP by AGO2 antibody in RIP. **P＜0.01 vs Anti-IgG. (d) RT-qPCR analysis of miR-4270 expression in CC cells (SW480 and SW620) and FHC cells. **P＜0.01 vs FHC. (e) RT-qPCR analysis of miR-4270 expression in CC tissues and normal cells. (f) Pearson correlation coefficient between miR-4270 expression and ELFN1-AS1 expression. (g) miR-4270 expression in si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) or si-NC transfected SW480 as well as SW620 cells was determined through RT-qPCR. **P＜0.01 vs si-NC.
Figure 3

ELFN1-AS1 targets miR-4270. (a) Predicted lncRNA–miRNA interactions (ELFN1-AS1 and miR-4270) was predicted by bioinformatic analysis. (b) Luciferase activity in extracts from SW480 as well as SW620 cells co-transfected with ELFN1-AS1-related wide type or mutant luciferase vectors and miR-4270 mimic or NC. *P＜0.05, **P＜0.01 vs WT + NC. (c) RT-qPCR assessing AGO2 RIP by AGO2 antibody in RIP. **P＜0.01 vs Anti-IgG. (d) RT-qPCR analysis of miR-4270 expression in CC cells (SW480 and SW620) and FHC cells. **P＜0.01 vs FHC. (e) RT-qPCR analysis of miR-4270 expression in CC tissues and normal cells. (f) Pearson correlation coefficient between miR-4270 expression and ELFN1-AS1 expression. (g) miR-4270 expression in si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) or si-NC transfected SW480 as well as SW620 cells was determined through RT-qPCR. **P＜0.01 vs si-NC.

3.4 ELFN1-AS1 targets miR-4270 and promotes malignant behaviors in CC cells

We subsequently attempted to uncover if the interaction between ELFN1-AS1 and miR-4270 contributes to CC progression in vitro. Briefly, we co-incubated inhibitors of both si-ELFN1-AS1 and miR-4270 into SW480 and SW620 cells. The introduction of a miR-4270 inhibitor neutralized the increased expression of miR-4270 when co-incubated with si-ELFN1-AS in both these cell lines (Figure 4a). Next, we examined whether the miR-4270 inhibitor affected the malignant behavior of CC cells regulated by ELFN1-AS1 silencing. As described in Figure 4b, the blockade of miR-4270 resulted in an elevated proliferation of CC cells, which was almost nullified by ELFN1-AS1 silencing. Consistently, the increased migration of colon cells upon treatment with a miR-4270 inhibitor was abrogated by co-transfection with si-ELFN1-AS1 (Figure 4c). Additionally, resistance to apoptosis was observed in SW480 and SW620 cells treated with a miR-4270 inhibitor. This phenomenon was offset upon transfection of a miR-4270 inhibitor and si-ELFN1-AS1 (Figure 4d). These findings demonstrated that miR-4270 downregulation is required for the oncogenic activity of ELFN1-AS1.

Figure 4 ELFN1-AS1 targeting miR-4270 promotes CC cell malignant behaviors. SW480 and SW620 cells was transfected with si-NC, si-ELFN1-AS1, miR-4270 inhibitor, inhibitor NC, and si-ELFN1-AS1 + miR-4270 inhibitor. After 48 h, (a) miR-4270 expression through RT-qPCR, (b) proliferation tested by CCK-8 assay, (c) migration measured with wound-healing assay. (d) The Bax as well as Bcl-2 expression in transfected SW480 and SW620 cells was checked through western blotting. *P＜0.05, **P＜0.01 vs si-NC; # P＜0.05, ## P＜0.01 vs inhibitor-NC; & P＜0.05, && P＜0.01 vs si-lnc + inhibitor.
Figure 4

ELFN1-AS1 targeting miR-4270 promotes CC cell malignant behaviors. SW480 and SW620 cells was transfected with si-NC, si-ELFN1-AS1, miR-4270 inhibitor, inhibitor NC, and si-ELFN1-AS1 + miR-4270 inhibitor. After 48 h, (a) miR-4270 expression through RT-qPCR, (b) proliferation tested by CCK-8 assay, (c) migration measured with wound-healing assay. (d) The Bax as well as Bcl-2 expression in transfected SW480 and SW620 cells was checked through western blotting. *P＜0.05, **P＜0.01 vs si-NC; # P＜0.05, ## P＜0.01 vs inhibitor-NC; & P＜0.05, && P＜0.01 vs si-lnc + inhibitor.

3.5 MiR-4270 interacts with AURKB

Subsequently, we used TargetScan analysis to identify the potential targets of miR-4270. As predicted, the 3′-UTR of AURKB shared a complementary sequence with miR-4270 (Figure 5a). Direct binding between these molecules was also checked using luciferase reporter assays, which showed that the miR-4270 mimic disrupted 3′-UTR AURKB WT-mediated luciferase activity but had no effect on 3′-UTR AURKB MUT-mediated luciferase activity (Figure 5b). Furthermore, abundant AURKB expression was detected in both CC cells and tissues (Figures 5c and d). Their negative correlation further supports the idea that miR-4270 could be directly recognized by the 3′-UTR of AURKB (Figure 5e). Furthermore, western blot analysis showed that AURKB protein levels were lower in the si-lnc-1- and si-lnc-2-treated groups than in the si-NC-treated group (Figure 5f). Therefore, AURKB is a direct target of miR-4270 and is upregulated by ELFN1-AS1.

Figure 5 miR-4270 interacts with AURKB. (a) The miRNA-4270 binding sites in human AURKB 3′-UTR predicted through TargetScan. (b) Relative luciferase activity of AURKB 3′-UTR MUT and WT was determined after co-transfection with miR-4270 mimics or mimics NC. **P＜0.01 vs miR-NC. (c) RT-qPCR analysis of AURKB expression in CC cells (SW480 and SW620) and FHC cells. (d) RT-qPCR analysis of AURKB expression in CC tissues and normal tissues. (e) Pearson correlation analysis of miR-4270 expression with AURKB expression. (f) AURKB protein expression in si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) or si-NC transfected SW480 as well as SW620 cells was determined through western blotting. **P＜0.01 vs si-NC.
Figure 5

miR-4270 interacts with AURKB. (a) The miRNA-4270 binding sites in human AURKB 3′-UTR predicted through TargetScan. (b) Relative luciferase activity of AURKB 3′-UTR MUT and WT was determined after co-transfection with miR-4270 mimics or mimics NC. **P＜0.01 vs miR-NC. (c) RT-qPCR analysis of AURKB expression in CC cells (SW480 and SW620) and FHC cells. (d) RT-qPCR analysis of AURKB expression in CC tissues and normal tissues. (e) Pearson correlation analysis of miR-4270 expression with AURKB expression. (f) AURKB protein expression in si-ELFN1-AS1 (si-lnc-1 and si-lnc-2) or si-NC transfected SW480 as well as SW620 cells was determined through western blotting. **P＜0.01 vs si-NC.

3.6 AURKB is required for the inhibitory effect of miR-4270 on the malignant behaviors of CC cells

Based on our initial findings, we then sought to determine whether AURKB expression dysregulation could explain the function of miR-4270 in CC. Hence, a miR-4270 inhibitor and si-AURKB were co-introduced into SW480 and SW620 cells. As shown in Figure 6a, treatment with the miR-4270 inhibitor enhanced AURKB expression, whereas this enhanced expression was almost nullified by si-AURKB treatment. Next, functional assays demonstrated that the loss of endogenous AURKB expression constrained CC cell viability and migration; however, this phenomenon was restored through the co-introduction of si-AURKB and a miR-4270 inhibitor (Figures 6b and 6c). Additionally, AURKB silencing induced the apoptotic activation of CC cells; however, this outcome was nullified by treatment with the miR-4270 inhibitor (Figure 6d). Taken together, our results indicate that miR-4270 inhibits the malignant phenotype of CC cells by downregulating AURKB expression.

Figure 6 AURKB is required for the inhibitory effect of miR-4270 on CC cell malignant behaviors. SW480 and SW620 cells were transfected with miR-4270 inhibitor, inhibitor NC, si-AURKB, si-NC, and miR-4270 inhibitor + si-AURKB. 48 h later, (a) AURKB expression analysis through western blotting, (b) proliferation tested by CCK-8 assay, (c) migration measured with wound-healing assay. (d) Bax and Bcl-2 expression in transfected SW480 as well as SW620 cells was checked through western blot analysis. *P＜0.05, **P＜0.01 vs si-NC; # P＜0.05, ## P＜0.01 vs inhibitor-NC; & P＜0.05, && P＜0.01 vs si-AURKB + inhibitor.
Figure 6

AURKB is required for the inhibitory effect of miR-4270 on CC cell malignant behaviors. SW480 and SW620 cells were transfected with miR-4270 inhibitor, inhibitor NC, si-AURKB, si-NC, and miR-4270 inhibitor + si-AURKB. 48 h later, (a) AURKB expression analysis through western blotting, (b) proliferation tested by CCK-8 assay, (c) migration measured with wound-healing assay. (d) Bax and Bcl-2 expression in transfected SW480 as well as SW620 cells was checked through western blot analysis. *P＜0.05, **P＜0.01 vs si-NC; # P＜0.05, ## P＜0.01 vs inhibitor-NC; & P＜0.05, && P＜0.01 vs si-AURKB + inhibitor.

4 Discussion

The incidence of CC is increasing annually, with CC being a commonly occurring malignancy in children and adolescents [28]. Along with the basic symptoms of adult CC, chronic abdominal discomfort is a key symptom of CC in children. Therefore, CC in children is often overlooked, resulting in dismal clinical outcomes [29]. Hence, it is imperative to elucidate the mechanism behind CC progression, which would help uncover new approaches to interfere with CC progression, especially in children. Our results demonstrated that ELFN1-AS1 expression was enhanced in CC tissues, and that silencing ELFN1-AS1 inhibited CC progression both in vitro and in vivo. Furthermore, ELFN1-AS1 silencing led to the upregulation of miR-4270 and resulted in AURKB downregulation, reversing the malignant properties of CC. In conclusion, ELFN1-AS1 regulated the miR-4270/AURKB axis, which resulted in CC progression; thus, targeting ELFN1-AS1 may have diagnostic and therapeutic implications for patients with CC, particularly children.

Previous studies have demonstrated the tumorigenic potential of ELFN1-AS1 in different cancers, including CC. Researchers have shown that siRNAs targeting ELFN1-AS1 disrupted the uncontrolled proliferation and migration of CC cells, thereby interfering with their malignancy [13,16]. A recent study showed that ELFN1-AS1 sponged miR-1250 and upregulated the expression of metastasis-associated protein 1, which promoted the tumorigenic and metastatic behavior of CC cells [30]. Interestingly, ELFN1-AS1 is also regarded as a ferroptosis-related lncRNA that is enriched in cancer- and metabolism-related cascades, such as in CC [31]. Consistent with the earlier reports, we also found that ELFN1-AS1 silencing impeded tumorigenesis in vitro and in vivo, clearly indicating the pro-oncogenic action of ELFN1-AS1 in CC.

Bioinformatics analysis revealed that miR-4270 is a target of ELFN1-AS1. Their direct binding was further verified in this study using luciferase reporter assays. Their targeted regulatory actions were also observed in RB, where ELFN1-AS1 promoted progression of RB through regulating the miR-4270/SBK1 axis [15]. The authors found that miR-4270 mimics inhibited the proliferation, migration, and invasion of RB cells, showing that it is a tumor suppressor in RB [15]. Surprisingly, miR-4270 plays opposing roles in various cancers [26,27,32]. For instance, miR-4270 was downregulated in gastric cancer and hepatocellular (HCC) tissues as compared to the precancerous tissues, implying a tumor suppressor role [26]. On the contrary, it was significantly upregulated in the blood of breast cancer patients [33]. Furthermore, the rescued expression of p53 via miR-4270 inhibition induced nasopharyngeal carcinoma cells to be more sensitive to irradiation [27]. However, the role of miR-4270 in CC remains unclear. To the best of our knowledge, our findings indicated for the first time that miR-4270 silencing increased CC cell proliferation and motility and triggered apoptotic inactivation. Our results in CC are in line with previous findings in gastric cancer, HCC, and CC, where miR-4270 functions as a tumor suppressor in CC. Mechanistically, miR-4270 silencing abrogated the tumor-suppressive function of ELFN1-AS1 silencing. ELFN1-AS1 knockdown further antagonized the low expression of miR-4270 caused by miR-4270 inhibitor, further supporting the negative regulation of ELFN1-AS1 on miR-4270. Collectively, ELFN1-AS1 sponged miR-4270 and facilitated CC progression.

According to the ceRNA hypothesis, lncRNAs compete for miRNA binding and keep miRNAs away from their target mRNAs, reshaping the mRNA expression landscape of a cell [34]. Using TargetScan analysis, we found that AURKB might be a target of miR-4270. Simultaneously, we used luciferase reporter assays to verify that miR-4270 could target the 3′-UTR of AURKB. We reported the interaction between miR-4270 and AURKB in CC for the first time. RT-qPCR analysis showed that the miR-4270 inhibitor antagonized the loss of AURKB expression in CC cells transfected with si-AURKB. More importantly, the miR-4270 inhibitor restored the antitumor action of si-AURKB in CC cells. Therefore, miR-4270 suppresses CC progression by downregulating AURKB expression. The negative correlation between miR-4270 and AURKB expression further verified the antagonistic relationship between these molecules.

The AURKB gene is located in the locus 17p13.1, comprising seven exons. This gene encodes a member of the Aurora kinase subfamily of serine/threonine kinases. These kinases participate in regulating chromosome alignment and segregation during mitosis and meiosis by associating with microtubules. Convincing data have demonstrated the oncogenic action of AURKB in various cancers, such as gastric cancer [35] and clear cell renal cell carcinoma [36]. AURKB expression has been shown to positively regulate cancer proliferation, metastasis, and drug resistance [35,37–39]. For example, AURKB was found to be associated with the clinicopathological characteristics of gastric cancer, and its high expression activated the Wnt/β-catenin/Myc cascade to induce epithelial–mesenchymal transition [36]. AURKB overexpression results in chromosomal mis-segregation errors, which are hallmarks of cancer, including colorectal cancer [40]. However, little is known about its role in CC. Our functional assays demonstrated that AURKB silencing attenuated uncontrolled cell proliferation and migration. The Bcl-2 family of proteins comprises key regulators of the mitochondria-mediated apoptosis pathway, including the pro-apoptotic protein Bax and the anti-apoptotic protein Bcl-2 [41]. Studies have shown that AURKB inhibited the intrinsic resistance of malignant tumors to autophagy-related death by overcoming Bcl-2 expression [42]. In addition, AURKB inhibited the apoptosis of breast cancer cells by promoting Bcl-2 expression and inhibiting Bax expression [43]. Similarly, this study found that AURKB knockdown reduced the protein level of Bcl-2 and increased Bax expression in CC cells, revealing the pro-apoptotic effect of AURKB knockdown on CC. Our findings provide further evidence of the oncogenic role of AURKB in malignancy. As in RB, AURKB could be a therapeutic target, and targeting it could be a unique therapeutic technique to limit the progression of CC [44]. Therefore, we might provide a novel optimal target for CC therapy.

Our study had several limitations. The regulatory network associated with ELFN1-AS1 in CC may be complex because of the promiscuity of miRNA seed sequences. Therefore, ELFN1-AS1 may interact with different miRNAs and regulate CC progression through another mechanism. Moreover, more clinical samples are required to validate our findings. Furthermore, the downstream effectors or signaling cascades related to AURKB in the CC context requires further investigation.

In conclusion, we established ELFN1-AS1 as an oncogenic lncRNA that promotes CC progression by regulating miR-4270 expression, thereby upregulating AURKB expression. In addition, inhibition of AURKB inhibition could be a potential treatment strategy in CC. As a result, ELFN1-AS1 and AURKB warrant further investigation as an intriguing therapeutic target to reduce the occurrence of detrimental consequences associated with CC tumorigenesis and progression.

tel: +86 15327253485, fax: +86 15327253485

Acknowledgements

None.

  1. Funding information: Authors state no funding involved.

  2. Author contributions: S.Q.P. and Y.J.L. conducted the study and analyzed the data. L.J.C. conceived and planned this study. Data acquisition was done by K.D. and Q.W. S.Q.P., Y.J.L. and L.J.C. inspected and elucidated the data. All authors have read and approved the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The data and material utilized and analyzed in this study are accessible on request from the corresponding author.

References

[1] Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 Countries. CA: A Cancer J Clinicians. 2021;71(3):209–49. 10.3322/caac.21660.Suche in Google Scholar PubMed

[2] Hayes-Jordan AA, Sandler G, Malakorn S, Xiao LC, Kopetz S, Rodriquez-Bigas M. Colon cancer in patients under 25 years old: a different disease? J Am Coll Surg. 2020;230(4):648–56. 10.1016/j.jamcollsurg.2019.12.043.Suche in Google Scholar PubMed

[3] Tamakoshi K, Wakai K, Kojima M, Watanabe Y, Hayakawa N, Toyoshima H, et al. A prospective study on the possible association between having children and colon cancer risk: findings from the JACC Study. Cancer Sci. 2004;95(3):243–7. 10.1111/j.1349-7006.2004.tb02210.x.Suche in Google Scholar PubMed

[4] Benson AB, Venook AP, Al-Hawary MM, Cederquist L, Chen YJ, Ciombor KK, et al. NCCN guidelines insights: colon cancer, version 2.2018. J Natl Compr Cancer Network JNCCN. 2018;16(4):359–69. 10.6004/jnccn.2018.0021.Suche in Google Scholar PubMed

[5] Pawlik TM. Colon cancer. Surgical Oncol Clin North Am. 2018;27(2):xiii–xiv. 10.1016/j.soc.2017.11.013.Suche in Google Scholar PubMed

[6] Baldassarri M, Fallerini C, Cetta F, Ghisalberti M, Bellan C, Furini S, et al. Omic approach in non-smoker female with lung squamous cell carcinoma pinpoints to germline susceptibility and personalized medicine. Cancer Res Treat. 2018;50(2):356–65. 10.4143/crt.2017.125.Suche in Google Scholar PubMed PubMed Central

[7] Ma Y, Zhang J, Wen L, Lin A. Membrane-lipid associated lncRNA: a new regulator in cancer signaling. Cancer Lett. 2018;419:27–9. 10.1016/j.canlet.2018.01.008.Suche in Google Scholar PubMed

[8] Peng WX, Koirala P, Mo YY. LncRNA-mediated regulation of cell signaling in cancer. Oncogene. 2017;36(41):5661–7. 10.1038/onc.2017.184.Suche in Google Scholar PubMed PubMed Central

[9] Cheng B, Rong A, Zhou Q, Li W. LncRNA LINC00662 promotes colon cancer tumor growth and metastasis by competitively binding with miR-340-5p to regulate CLDN8/IL22 co-expression and activating ERK signaling pathway. J Exp Clin Cancer Res. 2020;39(1):5. 10.1186/s13046-019-1510-7.Suche in Google Scholar PubMed PubMed Central

[10] Lin Y, Pan X, Chen Z, Lin S, Chen S. Identification of an immune-related Nine-lncRNA signature predictive of overall survival in colon cancer. Front Genet. 2020;11:318. 10.3389/fgene.2020.00318.Suche in Google Scholar PubMed PubMed Central

[11] Han B, Ge Y, Cui J, Liu B. Down-regulation of lncRNA DNAJC3-AS1 inhibits colon cancer via regulating miR-214-3p/LIVIN axis. Bioengineered. 2020;11(1):524–35. 10.1080/21655979.2020.1757224.Suche in Google Scholar PubMed PubMed Central

[12] Ma G, Li G, Gou A, Xiao Z, Xu Y, Song S, et al. Long non-coding RNA ELFN1-AS1 in the pathogenesis of pancreatic cancer. Ann Transl Med. 2021;9(10):877. 10.21037/atm-21-2376.Suche in Google Scholar PubMed PubMed Central

[13] Dong L, Ding C, Zheng T, Pu Y, Liu J, Zhang W, et al. Extracellular vesicles from human umbilical cord mesenchymal stem cells treated with siRNA against ELFN1-AS1 suppress colon adenocarcinoma proliferation and migration. Am J Transl Res. 2019;11(11):6989–99.10.1155/2019/8108576Suche in Google Scholar

[14] Lei R, Feng L, Hong D. ELFN1-AS1 accelerates the proliferation and migration of colorectal cancer via regulation of miR-4644/TRIM44 axis. Cancer Biomarkers Sect A Dis Markers. 2020;27(4):433–43. 10.3233/cbm-190559.Suche in Google Scholar

[15] Feng W, Zhu R, Ma J, Song H. LncRNA ELFN1-AS1 promotes retinoblastoma growth and invasion via regulating miR-4270/SBK1 axis. Cancer Manag Res. 2021;13:1067–73. 10.2147/cmar.S281536.Suche in Google Scholar

[16] Du Y, Hou Y, Shi Y, Liu J, Li T. Long non-coding RNA ELFN1-AS1 promoted colon cancer cell growth and migration via the miR-191-5p/Special AT-rich sequence-binding protein 1 axis. Front Oncol. 2020;10:588360. 10.3389/fonc.2020.588360.Suche in Google Scholar PubMed PubMed Central

[17] Correia de Sousa M, Gjorgjieva M, Dolicka D, Sobolewski C, Foti M. Deciphering miRNAs’ action through miRNA editing. Int J Mol Sci. 2019;20(24):6249. 10.3390/ijms20246249.Suche in Google Scholar PubMed PubMed Central

[18] Cochetti G, Cari L, Nocentini G, Maulà V, Suvieri C, Cagnani R, et al. Detection of urinary miRNAs for diagnosis of clear cell renal cell carcinoma. Sci Rep. 2020;10(1):21290. 10.1038/s41598-020-77774-9.Suche in Google Scholar PubMed PubMed Central

[19] Cochetti G, Cari L, Maulà V, Cagnani R, Paladini A, Del Zingaro M, et al. Validation in an independent cohort of MiR-122, MiR-1271, and MiR-15b as urinary biomarkers for the potential early diagnosis of clear cell renal cell carcinoma. Cancers. 2022;14(5):1112. 10.3390/cancers14051112.Suche in Google Scholar PubMed PubMed Central

[20] Zeng M, Zhu L, Li L, Kang C. miR-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1. Cell Mol Biol Lett. 2017;22:12. 10.1186/s11658-017-0041-5.Suche in Google Scholar PubMed PubMed Central

[21] Hang J, Wei F, Yan Z, Zhang X, Xu K, Zhu Y. The value of miR-510 in the prognosis and development of colon cancer. Open Med (Warsaw, Pol). 2021;16(1):795–804. 10.1515/med-2021-0251.Suche in Google Scholar PubMed PubMed Central

[22] Li P, Cai JX, Han F, Wang J, Zhou JJ, Shen KW, et al. Expression and significance of miR-654-5p and miR-376b-3p in patients with colon cancer. World J Gastrointest Oncol. 2020;12(4):492–502. 10.4251/wjgo.v12.i4.492.Suche in Google Scholar PubMed PubMed Central

[23] Lin W, Zhou Q, Wang CQ, Zhu L, Bi C, Zhang S, et al. LncRNAs regulate metabolism in cancer. Int J Biol Sci. 2020;16(7):1194–206. 10.7150/ijbs.40769.Suche in Google Scholar PubMed PubMed Central

[24] Zhang C, Lian H, Xie L, Yin N, Cui Y. LncRNA ELFN1-AS1 promotes esophageal cancer progression by up-regulating GFPT1 via sponging miR-183-3p. Biol Chem. 2020;401(9):1053–61. 10.1515/hsz-2019-0430.Suche in Google Scholar PubMed

[25] Jie Y, Ye L, Chen H, Yu X, Cai L, He W, et al. ELFN1-AS1 accelerates cell proliferation, invasion and migration via regulating miR-497-3p/CLDN4 axis in ovarian cancer. Bioengineered. 2020;11(1):872–82. 10.1080/21655979.2020.1797281.Suche in Google Scholar PubMed PubMed Central

[26] Shen D, Zhao H, Zeng P, Song J, Yang Y, Gu X, et al. Circular RNA hsa_circ_0005556 accelerates gastric cancer progression by sponging miR-4270 to increase MMP19 expression. J Gastric Cancer. 2020;20(3):300–12. 10.5230/jgc.2020.20.e28.Suche in Google Scholar PubMed PubMed Central

[27] Hao W, Zhu Y, Wang H, Guo Y. miR-4270 modulates the irradiation-sensitivity of nasopharyngeal carcinoma cells through modulation of p53 in vivo. Tohoku J Exp Med. 2021;254(2):63–70. 10.1620/tjem.254.63.Suche in Google Scholar PubMed

[28] Arnold MW. Colon cancer: the road traveled. Surg Oncol Clin North Am. 2018;27(2):xv–xviii. 10.1016/j.soc.2017.11.012.Suche in Google Scholar PubMed

[29] Célind J, Ohlsson C, Bygdell M, Nethander M, Kindblom JM. Childhood body mass index is associated with risk of adult colon cancer in men: an association modulated by pubertal change in body mass index. Cancer Epidemiol Biomarkers Prev. 2019;28(5):974–9. 10.1158/1055-9965.Epi-18-1077.Suche in Google Scholar

[30] Zhai LQ, Wang XX, Qu CX, Yang LZ, Jia CM, Shi XC. A long non-coding RNA, ELFN1-AS1, sponges miR-1250 to upregulate MTA1 to promote cell proliferation, migration and invasion, and induce apoptosis in colorectal cancer. Eur Rev Med Pharmacol Sci. 2021;25(14):4655–67. 10.26355/eurrev_202107_26376.Suche in Google Scholar PubMed

[31] Chen W, Chen Y, Liu L, Wu Y, Fu P, Cao Y, et al. Comprehensive analysis of immune infiltrates of ferroptosis-related long noncoding RNA and prediction of colon cancer patient prognoses. J Immunol Res. 2022;2022:9480628. 10.1155/2022/9480628.Suche in Google Scholar PubMed PubMed Central

[32] Wang Y, Li CF, Sun LB, Li YC. microRNA-4270-5p inhibits cancer cell proliferation and metastasis in hepatocellular carcinoma by targeting SATB2. Hum Cell. 2020;33(4):1155–64. 10.1007/s13577-020-00384-0.Suche in Google Scholar PubMed

[33] Hamam R, Ali AM, Alsaleh KA, Kassem M, Alfayez M, Aldahmash A, et al. microRNA expression profiling on individual breast cancer patients identifies novel panel of circulating microRNA for early detection. Sci Rep. 2016;6:25997. 10.1038/srep25997.Suche in Google Scholar PubMed PubMed Central

[34] Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 2011;146(3):353–8. 10.1016/j.cell.2011.07.014.Suche in Google Scholar PubMed PubMed Central

[35] Nie M, Wang Y, Yu Z, Li X, Deng Y, Wang Y, et al. AURKB promotes gastric cancer progression via activation of CCND1 expression. Aging. 2020;12(2):1304–21. 10.18632/aging.102684.Suche in Google Scholar PubMed PubMed Central

[36] Wan B, Huang Y, Liu B, Lu L, Lv C. AURKB: a promising biomarker in clear cell renal cell carcinoma. PeerJ. 2019;7:e7718. 10.7717/peerj.7718.Suche in Google Scholar PubMed PubMed Central

[37] Poulard C, Kim HN, Fang M, Kruth K, Gagnieux C, Gerke DS, et al. Relapse-associated AURKB blunts the glucocorticoid sensitivity of B cell acute lymphoblastic leukemia. Proc Natl Acad Sci U S A. 2019;116(8):3052–61. 10.1073/pnas.1816254116.Suche in Google Scholar PubMed PubMed Central

[38] Zhou X, Ma X, Sun H, Li X, Cao H, Jiang Y, et al. Let-7b regulates the adriamycin resistance of chronic myelogenous leukemia by targeting AURKB in K562/ADM cells. Leukemia Lymphoma. 2020;61(14):3451–9. 10.1080/10428194.2020.1811269.Suche in Google Scholar PubMed

[39] Bertran-Alamillo J, Cattan V, Schoumacher M, Codony-Servat J, Giménez-Capitán A, Cantero F, et al. AURKB as a target in non-small cell lung cancer with acquired resistance to anti-EGFR therapy. Nat Commun. 2019;10(1):1812. 10.1038/s41467-019-09734-5.Suche in Google Scholar PubMed PubMed Central

[40] Chen B, Dragomir MP, Fabris L, Bayraktar R, Knutsen E, Liu X, et al. The long noncoding RNA CCAT2 induces chromosomal instability through BOP1-AURKB signaling. Gastroenterology. 2020;159(6):2146–62.e33. 10.1053/j.gastro.2020.08.018.Suche in Google Scholar PubMed PubMed Central

[41] Lessene G, Czabotar PE, Colman PM. BCL-2 family antagonists for cancer therapy. Nat Rev Drug Discovery. 2008;7(12):989–1000. 10.1038/nrd2658.Suche in Google Scholar PubMed

[42] Zhang J, Zhang S, Shi Q, Allen TD, You F, Yang D. The anti-apoptotic proteins Bcl-2 and Bcl-xL suppress Beclin 1/Atg6-mediated lethal autophagy in polyploid cells. Exp Cell Res. 2020;394(1):112112. 10.1016/j.yexcr.2020.112112.Suche in Google Scholar PubMed

[43] Huang D, Huang Y, Huang Z, Weng J, Zhang S, Gu W. Relation of AURKB over-expression to low survival rate in BCRA and reversine-modulated aurora B kinase in breast cancer cell lines. Cancer Cell Int. 2019;19:166. 10.1186/s12935-019-0885-z.Suche in Google Scholar PubMed PubMed Central

[44] Borah NA, Sradhanjali S, Barik MR, Jha A, Tripathy D, Kaliki S, et al. Aurora Kinase B expression, its regulation and therapeutic targeting in human retinoblastoma. Investig Ophthalmol Vis Sci. 2021;62(3):16. 10.1167/iovs.62.3.16.Suche in Google Scholar PubMed PubMed Central

Received: 2022-03-23
Revised: 2022-09-09
Accepted: 2022-09-18
Published Online: 2022-12-09

© 2022 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0582
Schlagwörter für diesen Artikel
colon cancer; lncRNA ELFN1-AS1; miR-427; AURKB
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 19.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0582/html
Button zum nach oben scrollen