Home miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
Article Open Access

miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6

  • Qijun Dai , Jian Sun , Tianyi Dai , Qin Xu and Yueqin Ding EMAIL logo
Published/Copyright: February 22, 2022
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 17 Issue 1

Abstract

Blood–brain barrier participates in the pathological process of ischemic stroke. MicroRNA-29c-5p was highly expressed in clinical samples from patients with ischemic stroke. In this study, oxygen-glucose deprivation (OGD) treatment of astrocytes enhanced the permeability of brain microvascular endothelial cells (BMECs), and the miR-29c-5p expression was elevated in clinical samples from patients with ischemic stroke. For the function of miR-29c-5p in ischemic stroke, the miR-29c-5p knockdown decreased the permeability and the tight junction protein (TJP) destruction of BMECs and ameliorated the inflammation induced by OGD-treated astrocytes. Mechanistically, miR-29c-5p interacted with lipoprotein receptor-related protein 6 (LRP6) and negatively regulated the LRP6 expression in astrocytes. Moreover, the rescue assays indicated that the interference with miR-29c-5p ameliorated the TJP destruction of BMECs and inflammation caused by OGD-treated astrocytes by increasing the LRP6 expression. Together, miR-29c-5p knockdown decreased the high permeability and the TJP destruction of BMECs and ameliorated the inflammation induced by OGD-treated astrocytes by elevating LRP6 expression.

Keywords: ischemic stroke; blood–brain barrier; brain microvascular endothelial cells; astrocytes; miRNA

1 Introduction

Ischemic stroke is a central nervous system disease with high morbidity and mortality worldwide [1]. One of the pathophysiological features of ischemic stroke is the destruction of blood–brain barrier (BBB) [2]. BBB is formed by the tight junctions and adhesion of endothelial cells, and it acts as a functional barrier between the blood and the brain, which provides an optimal environment for neural network [3]. Considering the critical function of BBB dysfunction in the pathophysiology of ischemic stroke [4,5], maintaining BBB function and integrity are expected to alleviate brain injury after ischemic stroke. However, the mechanisms that regulate the BBB function after ischemic stroke have not been fully established.

Brain microvascular endothelial cells (BMECs) and astrocytes are major components of BBB [6]. In brain injury, BMECs and astrocytes support the formation of a neurovascular unit, a complex structural and functional unit that protects the BBB [7,8]. As the most abundant cell type in the central nervous system, astrocytes exert pivotal functions in maintaining normal brain function [9]. BMECs exert a critical role in BBB function through a highly selective barrier, in which tight junction proteins (TJPs) such as claudin-5, occludin, and zonula occluden-1 (ZO-1) are vital proteins regulating BBB integrity [10,11]. Under physiological and pathological conditions, BMECs–astrocyte interactions and signal transduction are critical for BBB integrity [12]. Thus, uncovering the underlying mechanism of BMECs–astrocyte interaction is essential for protecting BBB function after ischemic stroke.

MicroRNAs (miRNAs) are small noncoding RNAs that regulate mRNA degradation or translation by binding to the 3′-untranslated region (UTR) of target mRNAs [13]. MiRNAs participate in regulating various cellular behaviors, mainly including cell proliferation, differentiation, and metabolism [14,15]. Recently, increasing miRNAs have been confirmed to be abnormally expressed in ischemic stroke and to mediate the occurrence and development of ischemic stroke. For instance, Zuo et al. found that miR-132 alleviates brain injury by protecting the BBB in mice, suggesting that miR-132 might be a novel therapeutic target for BBB protection in ischemic stroke [16]; Zhang et al. indicated that miR-182 protects the integrity of the BBB during cerebral ischemia by repressing endothelial apoptosis, implying that miR-182 might be a potential target for the treatment of BBB disruption during cerebral ischemia [17]. Notably, another study confirmed that in an in vitro BBB model induced by the coculture of BMECs and astrocytes, miR-9-5p alleviates BBB injury and neuroinflammatory response and promotes neurological function recovery [18]. Thus, the discovery of novel miRNAs involved in the BMECs–astrocyte interaction is beneficial to better reveal the regulatory mechanism of BBB function after ischemic stroke.

The low-density lipoprotein receptor-related protein (LRP) signaling pathway participates in several processes, such as cerebral vascular remodeling and cerebral ischemia [19]. LRP6 is a single-span transmembrane protein and is involved in the regulation of various disease processes, including ischemic stroke [20]. As has been reported, the mutations in LRP6 are associated with the risk of ischemic stroke [21]; LRP6 protects the brain from ischemic injury, suggesting that LRP6 might provide a novel therapeutic approach for ischemic stroke [22]. In this study, the abnormal expressions of the miR-181 and miR-29 families in cerebral ischemia astrocytes were verified in the clinical samples from patients with ischemic stroke. Furthermore, the results authenticated that only miR-29c-5p was markedly overexpressed. Based on this finding, we selected miR-29c-5p as the mainly studied miRNA. Meanwhile, we found the binding sites between miR-29c-5p and LRP6 through TargetScan and Metascape databases. On this basis, we used various molecular techniques to conduct in-depth studies on its role and mechanism in the BBB after ischemic stroke, aiming to provide novel potential biomarkers for the clinical treatment of ischemic stroke.

2 Materials and methods

2.1 Clinical samples

Twenty patients with ischemic stroke and the matched healthy controls were included in this research. All of them were diagnosed based on a detailed stroke history and a physical examination using a professional clinical care provider. After obtaining informed consent from the patient or family members, the blood samples from the patients were collected for subsequent research. This study was approved by the Ethics Committee of Haian Hospital of Traditional Chinese Medicine.

2.2 Quantitative real-time PCR (qRT-PCR)

The expressions of miR-29c-5p, miR-29a-5p, miR-181-5p, and LRP6 in the blood samples of patients with ischemic stroke, and the LRP6 expression in astrocytes were determined using qRT-PCR. In brief, Trizol reagent (ThermoFisher Scientific, WA, USA) was used to extract the total RNAs, and the concentrations of RNAs were quantified by a NanoDrop spectrophotometer (Nanodrop Technologies, USA). To measure the LRP6 expression, High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) was used. To assess the expressions of miR-29c-5p, miR-29a-5p, and miR-181-5p, TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) was used. Subsequently, the real-time PCR was conducted on a 7500 Real-Time PCR system (Applied Biosystems, USA) with TaqMan Universal PCR Master Mix (Thermo Fisher Scientific). The expressions of miR-29c-5p, miR-29a-5p, and miR-181-5p were normalized to U6, and the LRP6 expression was normalized to GAPDH. The relative expression of the above molecules was determined by the 2−ΔΔCT method. All the primer sequences are exhibited in Table 1.

Table 1

The sequences of all primers used in qRT-PCR

Gene name Primer sequence (5′–3′)
miR-29c-5p Forward: TAGTAGTGGTTGTTTGTTTTTTTGA
Reverse: CCACTCTACTAAAAACTCCATCTCC
miR-29a-5p Forward: GCGGCGGACTGATTTCTTTTGGT
Reverse: ATCCAGTGCAGGGTCCGAGG
miR-181-5p Forward: ACACTCCAGCTGGGAACATTCAACGCTGTCGG
Reverse: TGGTGTCGTGGAGTCGA
LRP6 Forward: TCAACCCAGAGCTATTGCCTT
Reverse: TAACCACTGCCTGCCGATTT
U6 Forward: GCTTCGGCAGCACATATACTAAAAT
Reverse: CGCTTCACGAATTTGCGTGTCAT
GAPDH Forward: CTCTGACTTCAACAGCGAC
Reverse: CGTTGTCATACCAGGAAATGAG

2.3 Isolation and identification of primary astrocytes

Primary astrocytes were obtained from neonatal 1-day-old C57BL/6 mice [23,24]. In detail, the cortex was isolated from the mouse brain, and the meninges were removed. Subsequently, the cortex was digested at 37°C with 0.25 mg/mL trypsin and 0.1 mg/mL DNase for 20 min. The resuspended cells were collected and placed in a growth medium supplemented with high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Thermo Fisher Scientific) with 10% fetal bovine serum (FBS, Thermo Fisher Scientific) and 1% penicillin–streptomycin, and then placed in a polylysine-coated flask and grown at 37°C, in the presence of 5% CO2. The plastic flask was then placed on a shaker and gently shaken at 260 rpm to separate the microglia. The remaining adherent astrocytes were identified using immunofluorescence staining, and glial fibrillary acidic protein (GFAP) was used as a molecular marker, and more than 95% of the cells were positive for GFAP.

2.4 Cell culture and different treatments

Primary BMECs (5 × 105 cells) were purchased from Procell (Wuhan, China). The cells were put in 90% high-glucose DMEM containing 10% FBS and cultured at 37°C, in the presence of 5% CO2.

After washing the astrocytes twice with PBS, the cells were placed in oxygen-glucose deprivation (OGD) medium (glucose-free and serum-free DMEM with 10 μM hemin) and cultured in hypoxia (5% CO2 + 0.4% O2 + 95% N2) at 37°C for 4 h.

To initiate the coculture system of BMECs and astrocytes, primary astrocytes isolated from normal mice were treated with OGD for 3 h. Subsequently, BMECs were transferred to a medium containing primary astrocytes for coculture for 24 h [25].

2.5 Transepithelial electrical resistance (TEER) analysis

A Millicell-ERS instrument (Millipore, MA, USA) was used to detect the TEER values of BMECs. In detail, the isolated primary astrocytes (1 × 104 cells) were grown on six-well plates for 2 days. Then, the coculture inserts were placed at room temperature for 25 min. Subsequently, we detected the values of TEER immediately after changing the medium. Before calculating the final resistance, the background resistance was subtracted and the TEER value was expressed as Ω cm2.

2.6 Analysis of the penetration rate of sodium fluorescein (NaF)

To assess the barrier formation, we measured the exclusion of NaF daily for 4 days. In brief, we added 5 µM NaF (Sigma-Aldrich, Buchs, Switzerland) to the apical chamber and then added 1 mL standard medium to the basal chamber. After incubating for 2 h, we measured the NaF in basolateral samples by a microplate reader (Berthold Technologies GmbH, excitation 485 nm, emission 528 nm).

2.7 Cell transfection

miR-29a-5p inhibitor, negative control (NC)-inhibitor, miR-29a-5p mimic, NC-mimic, si-LRP6, and si-NC were synthesized from GenePharma (Shanghai, China).

The cell transfection was conducted using Lipofectamine 2000 (Thermo Fisher Scientific). In particular, the astrocytes (3 × 105 cells) were grown in six-well plates for 24 h. Subsequently, the miR-29a-5p inhibitor, miR-29a-5p mimic, si-LRP6, and their corresponding controls were transfected into astrocytes using Lipofectamine 2000. Forty-eight hours after transfection, we collected the astrocytes for subsequent studies.

2.8 Western blot assay

BMECs and primary astrocytes with different treatments were harvested and radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo Fisher Scientific) was used to isolate the total proteins. The same amount of protein samples were separated using 10% sodium dodecyl sulfonate-polyacrylamide gel electrophoresis and transferred onto membranes (Millipore, Massachusetts, USA). Then, the membranes were incubated with 5% skim milk for 1 h. The membranes were further incubated with anti-GFAP (Abcam, 1:10,000 dilution, ab7260), anti-GLP-1R (Abcam, 1:1,000 dilution, ab218532), anti-claudin-5 (Abcam, 1:1,000 dilution, ab131259), anti-occludin (Abcam, 1:1,000 dilution, ab216327), anti-ZO-1 (Abcam, 1:1,000 dilution, ab276131), anti-VEGF-A (Abcam, 1:1,000 dilution, ab214424), anti-MMP-9 (Abcam, 1:1,000 dilution, ab76003) and anti-β-actin (Abcam, 1 µg/mL, ab8226) at 4°C overnight. Then, the membranes were further incubated with the secondary antibodies (Abcam, 1:2,000 dilution, ab205718). Ultimately, the signal of protein level was visualized by an enhanced chemiluminescent reagent (Thermo Fisher Scientific), and the images were analyzed by using Image-Pro Plus 5.1 Image Analysis Software (Media Cybernetics, MD, USA).

2.9 Lactate dehydrogenase (LDH) release assay

Referring to the standard procedure from reagent manufacturers, LDH release assay was performed using an LDH Cytotoxicity Assay Kit (Abcam, Cambridge, UK). BMECs with different treatments (3 × 103 cells) were put in 96-well plates and cultured for 24 h. The cells were lysed using 0.2% Triton X-100 (Solarbio, Beijing, China). After centrifugation, the supernatants were collected and coincubated with LDH reaction solution. Subsequently, a microplate reader (Bio-Rad Co., Hercules, CA, USA) was conducted to detect the optical density (OD) value at 490 nm. The content of LDH in cell lysates was determined to assess the cellular injury.

2.10 Immunofluorescence staining assay

Based on the previously reported methods [26], the immunofluorescence staining was conducted to assess the expressions of TJPs claudin5, occludin, and ZO-1. The primary antibodies were anti-claudin5 (Abcam, Assay dependent, ab15106), anti-occludin (Abcam, 1:100 dilution, ab216327), anti-ZO-1 (Abcam, 1:100 dilution, ab221547), anti-VEGFA (Abcam, 1 µg/mL, ab39250), and anti-MMP-9 (Abcam, 1:500 dilution, ab76003). The secondary antibodies were Alexa Flur 488 mouse anti-rabbit IgG and tetraethyl rhodamine isothiocyanate goat anti-rabbit IgG. The nuclei were stained using 4′,6-Diamidino-2-phenylindole staining solution (Sigma-Aldrich). Ultimately, Vectra® Polaris™ Automated Quantitative Pathology Imaging System (PerkinElmer, USA) was used to analyze all images.

2.11 Enzyme-linked immunosorbent assay (ELISA)

The contents of inflammatory cytokines interleukin-1β (IL-1β), interleukin-6 (IL-6), Tumor Necrosis Factor Alpha (TNF-α), and Transforming growth factor β (TGF-β) in the cell culture supernatant of astrocytes were quantified by using ELISA. Briefly, astrocytes (3 × 103 cells) were put in 96-well plates. The ELISA kit (ThermoFisher Scientific) was conducted to detect the concentrations of IL-1β, IL-6, TNF-α, and TGF-β in the cell culture supernatant of astrocytes based on the instructions of the manufacturer. The OD at 450 nm was measured.

2.12 Dual-luciferase reporter gene assay

Before the cell transfection, the astrocytes were grown in six-well plates and cultured to 80% fusion. The pmirGLO reporter vector containing a wild type (WT) or mutant type (Mut) miR-29a-5p binding sites in the 3′-UTR of LRP6, and named LRP6 WT or LRP6 Mut, was synthesized by Ribobio (Guangdong, China). miR-29a-5p mimic and the above recombinant vector were cotransfected into astrocytes using Lipofectamine 2000. Forty-eight hours after the transfection, the dual-luciferase reporter assay system (Thermo Fisher Scientific) was used to measure the relative luciferase activity.

2.13 Statistical analysis

All data were presented as the mean ± standard deviation. When the differences between the control and experimental groups were assessed, an unpaired Student’s t-test was carried out; when the differences among more than two groups were assessed, one-way analysis of variance (ANOVA) followed by Tukey’s post-test was conducted. P < 0.05 was considered significant.

  1. Ethics approval and consent to participate: The experimental protocol was established, according to the ethical guidelines of the Helsinki Declaration and was approved by the Ethics Committee of Haian Hospital of Traditional Chinese Medicine.

3 Results

3.1 OGD treatment of astrocytes increases the permeability of BMECs

BBB is essential for maintaining normal brain activity and is composed of BMECs arranged in blood vessels, and BMECs form a barrier to regulate the transportation of cells between the blood and the brain [27]. Moreover, the coculture of BMECs and astrocytes is commonly used as the in vitro model of BBB [18]. In this study, we isolated primary astrocytes from mice and identified them by immunofluorescence staining assay. GFAP was used as a molecular marker, and more than 95% of the cells were positive for GFAP (Figure 1a). Subsequently, the primary astrocytes treated with OGD were cocultured with BMECs. TEER analysis revealed that compared to the control group, OGD treatment increased the TEER of BMECs (Figure 1b). Similarly, compared to the control group, OGD treatment enhanced the ability of NaF to penetrate BMECs (Figure 1c). In general, OGD treatment of astrocytes enhanced the permeability of BMECs.

Figure 1 Influence of the OGD treatment of astrocytes on the permeability of BMECs. The primary astrocytes were isolated, and the primary astrocytes were treated with OGD for 3 h and then cocultured with primary brain microvascular epithelial cells (BMECs) for 24 h. (a) An immunofluorescence staining assay was performed to verify the isolated primary astrocytes (scale bar: 100 µm). (b) The TEER value of BMECs was determined using the Millicell-ERS instrument (Millipore, MA, USA). (c) Analysis of the penetration rate of NaF. OGD: oxygen-glucose deprivation, TEER: transepithelial electrical resistance, and NaF: sodium fluorescein. Data are presented as an average of three independent assays. **P < 0.01, ***P < 0.001 vs control.
Figure 1

Influence of the OGD treatment of astrocytes on the permeability of BMECs. The primary astrocytes were isolated, and the primary astrocytes were treated with OGD for 3 h and then cocultured with primary brain microvascular epithelial cells (BMECs) for 24 h. (a) An immunofluorescence staining assay was performed to verify the isolated primary astrocytes (scale bar: 100 µm). (b) The TEER value of BMECs was determined using the Millicell-ERS instrument (Millipore, MA, USA). (c) Analysis of the penetration rate of NaF. OGD: oxygen-glucose deprivation, TEER: transepithelial electrical resistance, and NaF: sodium fluorescein. Data are presented as an average of three independent assays. **P < 0.01, ***P < 0.001 vs control.

3.2 Low expression of miR-29c-5p reduces the high permeability of BMECs caused by OGD-treated astrocytes

We further detected the expressions of miR-29c-5p, miR-29a-5p, and miR-181-5p in the blood samples of patients with ischemic stroke, and the results indicated that only the miR-29c-5p was elevated, suggesting that miR-29c-5p might be related to the occurrence of ischemic stroke (Figure S1). Thus, miR-29c-5p was selected as the main miRNA for our subsequent studies.

Furthermore, we sought to explore whether miR-29c-5p mediated the high permeability of BMECs caused by OGD-treated astrocytes. Astrocytes transfected with miR-29c-5p inhibitor or NC-inhibitor were treated with OGD and then cocultured with BMECs. We detected the protein levels of astrocyte activation markers GFAP and glucagon-like peptide-1 receptor (GLP-1R) and found that compared to the NC-inhibitor group, the GFAP and GLP-1R protein levels were decreased in the miR-29c-5p inhibitor group (Figure 2a). Meanwhile, the TEER value in the miR-29c-5p inhibitor group was much lower than that in the NC-inhibitor group (Figure 2b). Similar to this finding, the ability of NaF to penetrate BMECs was weakened in the miR-29c-5p inhibitor group compared to the NC-inhibitor group (Figure 2c). Cell injury can be assessed through the LDH release assay [28]. As shown in Figure 2d, compared with the NC-inhibitor group, there was no remarkable change in the LDH release of BMECs in the miR-29c-5p inhibitor group. Together, the above results clarified that the miR-29c-5p knockdown decreased the high permeability of BMECs induced by OGD-treated astrocytes.

Figure 2 Effect of miR-29c-5p on the high permeability of BMECs caused by OGD-treated astrocytes. Astrocytes transfected with miR-29c-5p inhibitor or NC-inhibitor were treated with OGD for 3 h and then cocultured with BMECs for 24 h. (a) Western blot was performed to analyze the protein levels of astrocyte activation markers GFAP and GLP-1R. (b) Analysis of the TEER value of BMECs. (c) Detection of the ability of NaF to penetrate BMECs. (d) LDH release assay was performed to assess the injury of BMECs. NC: negative control, GLP-1R: glucagon-like peptide-1 receptor, and LDH: lactate dehydrogenase. Data are presented as an average of three independent assays. *P < 0.05, ***P < 0.001 vs NC-inhibitor.
Figure 2

Effect of miR-29c-5p on the high permeability of BMECs caused by OGD-treated astrocytes. Astrocytes transfected with miR-29c-5p inhibitor or NC-inhibitor were treated with OGD for 3 h and then cocultured with BMECs for 24 h. (a) Western blot was performed to analyze the protein levels of astrocyte activation markers GFAP and GLP-1R. (b) Analysis of the TEER value of BMECs. (c) Detection of the ability of NaF to penetrate BMECs. (d) LDH release assay was performed to assess the injury of BMECs. NC: negative control, GLP-1R: glucagon-like peptide-1 receptor, and LDH: lactate dehydrogenase. Data are presented as an average of three independent assays. *P < 0.05, ***P < 0.001 vs NC-inhibitor.

3.3 miR-29c-5p knockdown ameliorates TJP destruction of BMECs induced by OGD-treated astrocytes

Earlier studies indicate that one of the biochemical features of BBB injury is the decreased expression of TJPs, mainly including claudin-5, occludin, and ZO-1 [2,29]. Astrocytes transfected with miR-29c-5p inhibitor or NC-inhibitor were treated with OGD and then cocultured with BMECs. Western blot analysis authenticated that claudin-5, occludin, and ZO-1 were upregulated after the miR-29c-5p knockdown (Figure 3a). Immunofluorescence staining assay further confirmed that claudin-5, occludin, and ZO-1 expressions were increased in the miR-29c-5p inhibitor group (Figure 3b). In general, the interference with miR-29c-5p relieved the TJP destruction of BMECs caused by OGD-treated astrocytes.

Figure 3 Influence of miR-29c-5p on the TJP destruction of BMECs caused by OGD-treated astrocytes. Astrocytes transfected with miR-29c-5p inhibitor or NC-inhibitor were treated with OGD for 3 h, and the cells were cocultured with BMECs for 24 h. (a) The protein levels of TJPs claudin-5, occludin, and ZO-1 were determined using Western blot. (b) Immunofluorescence staining assay was applied to quantify the claudin-5, occludin, and ZO-1 expressions (scale bar: 100 µm). Data are presented as an average of three independent assays. **P < 0.01, ***P < 0.001 vs NC-inhibitor.
Figure 3

Influence of miR-29c-5p on the TJP destruction of BMECs caused by OGD-treated astrocytes. Astrocytes transfected with miR-29c-5p inhibitor or NC-inhibitor were treated with OGD for 3 h, and the cells were cocultured with BMECs for 24 h. (a) The protein levels of TJPs claudin-5, occludin, and ZO-1 were determined using Western blot. (b) Immunofluorescence staining assay was applied to quantify the claudin-5, occludin, and ZO-1 expressions (scale bar: 100 µm). Data are presented as an average of three independent assays. **P < 0.01, ***P < 0.001 vs NC-inhibitor.

3.4 Interference with miR-29c-5p relieves inflammation induced by OGD-treated astrocytes

Based on the above findings, we attempted to clarify whether miR-29c-5p mediated the inflammation induced by OGD-treated astrocytes. As exhibited in Figure 4a, the miR-29c-5p knockdown reduced the concentrations of IL-1β, IL-6, TNF-α, and TGF-β. Inflammatory factors such as vascular endothelial growth factor (VEGF-A) and matrix metalloproteinase-9 (MMP-9) directly or indirectly aggravate BBB [30,31]. As shown in Figure 4b, compared with the NC-inhibitor group, the protein levels of VEGF-A and MMP-9 were decreased in the miR-29c-5p inhibitor group. Furthermore, the immunofluorescence results showed the same trend (Figure 4c). Together, the miR-29c-5p knockdown reduced the inflammation caused by OGD-treated astrocytes.

Figure 4 Effect of miR-29c-5p on the inflammation caused by OGD-treated astrocytes. Astrocytes transfected with miR-29c-5p inhibitor or NC-inhibitor were treated with OGD for 3 h. (a) ELISA was performed to test the concentrations of inflammatory cytokines IL-1β, IL-6, TNF-α, and TGF-β in cell culture supernatant of astrocytes. (b) The protein levels of inflammatory factors VEGF-A and MMP-9 were tested using Western blot. (c) An immunofluorescence assay was performed to assess the expressions of VEGF-A and MMP-9 (scale bar: 100 µm). Data are presented as an average of three independent assays. **P < 0.01, ***P < 0.001 vs NC-inhibitor.
Figure 4

Effect of miR-29c-5p on the inflammation caused by OGD-treated astrocytes. Astrocytes transfected with miR-29c-5p inhibitor or NC-inhibitor were treated with OGD for 3 h. (a) ELISA was performed to test the concentrations of inflammatory cytokines IL-1β, IL-6, TNF-α, and TGF-β in cell culture supernatant of astrocytes. (b) The protein levels of inflammatory factors VEGF-A and MMP-9 were tested using Western blot. (c) An immunofluorescence assay was performed to assess the expressions of VEGF-A and MMP-9 (scale bar: 100 µm). Data are presented as an average of three independent assays. **P < 0.01, ***P < 0.001 vs NC-inhibitor.

3.5 MiR-29c-5p targets LRP6

Recent studies have confirmed that the activation of the Wnt/β-catenin signaling by protective astrocytes repairs BBB injury [32], and miRNAs exert regulatory functions by targeting the 3′-UTR of mRNAs [33]. Thus, we applied bioinformatic databases (TargetScan and Metascape) to predict the possible downstream regulatory targets of miR-29c-5p and screened out the targets that participated in the regulation of the Wnt pathway. The results showed that there were binding sites between miR-29c-5p and LRP6 (Figure 5a and b). To verify this combination, we performed the dual-luciferase reporter gene assay, and the results confirmed that the transfection of miR-29c-5p mimic reduced the relative luciferase activity of LRP6 WT, and had no obvious changes on the relative luciferase activity of LRP6 MUT, implying that there was an interaction between miR-29c-5p and LRP6 (Figure 5c). Subsequently, we transfected miR-29c-5p mimic into astrocytes to investigate the regulation of miR-29c-5p on the LRP6 expression. The results authenticated that the transfection of miR-29c-5p mimic decreased the LRP6 expression (Figure 5d). Meanwhile, the LRP6 expression was evaluated, and the data confirmed that LRP6 was lowly expressed in the blood samples of patients with ischemic stroke (Figure 5e). To sum up, miR-29c-5p bound to LRP6 and negatively regulated the expression of LRP6 in astrocytes.

Figure 5 Verification of the interaction between miR-29c-5p and LRP6: (a and b) Bioinformatic databases, TargetScan and Metascape, were applied to predict the possible downstream regulatory targets of miR-29c-5p and screen out the targets that participated in regulating the Wnt pathway. (c) The binding of miR-29c-5p to LRP6 was proved by dual-luciferase reporter gene assay. (d) miR-29c-5p mimic or NC-mimic was transfected into astrocytes. QRT-PCR was carried out to quantify the LRP6 expression. (e) A total of 20 patients with ischemic stroke and 20 matched healthy controls were included, and the blood samples were isolated from them. The expression of LRP6 was analyzed by qRT-PCR. Data are presented as an average of three independent assays. ***P < 0.001 vs NC mimic.
Figure 5

Verification of the interaction between miR-29c-5p and LRP6: (a and b) Bioinformatic databases, TargetScan and Metascape, were applied to predict the possible downstream regulatory targets of miR-29c-5p and screen out the targets that participated in regulating the Wnt pathway. (c) The binding of miR-29c-5p to LRP6 was proved by dual-luciferase reporter gene assay. (d) miR-29c-5p mimic or NC-mimic was transfected into astrocytes. QRT-PCR was carried out to quantify the LRP6 expression. (e) A total of 20 patients with ischemic stroke and 20 matched healthy controls were included, and the blood samples were isolated from them. The expression of LRP6 was analyzed by qRT-PCR. Data are presented as an average of three independent assays. ***P < 0.001 vs NC mimic.

3.6 Rescue assay investigates the function of the miR-29c-5p/LRP6 axis in the TJP destruction of BMECs and inflammation caused by OGD-treated astrocytes

We further investigated whether miR-29c-5p regulated the inflammation and TJP destruction of BMECs induced by OGD-treated astrocytes via LRP6. Astrocytes transfected with miR-29c-5p inhibitor and/or si-LRP6 were treated with OGD. As shown in Figure 6a, the interference with miR-29c-5p reduced the concentrations of IL-1β, IL-6, TNF-α, and TGF-β, and this reduction was compensated by the interference with LRP6. Similarly, the miR-29c-5p knockdown downregulated the protein levels of VEGF-A and MMP-9, whereas the LRP6 knockdown partially reversed this trend (Figure 6b). Furthermore, astrocytes transfected with miR-29c-5p inhibitor and si-LRP6 were treated with OGD and then cocultured with BMECs. From the results of Western blot, we found that the transfection of miR-29c-5p inhibitor downregulated the GFAP and GLP-1R protein levels, and this downregulation was partially reversed by the transfection of si-LRP6 (Figure 6c). Moreover, the interference with miR-29c-5p increased the protein levels of claudin-5, occludin, and ZO-1, whereas the interference with LRP6 partially reversed this increase (Figure 6d). Overall, the interference with miR-29c-5p ameliorated the inflammation and TJP destruction of BMECs induced by OGD-treated astrocytes by increasing LRP6.

Figure 6 Verification of the regulatory function of the miR-29c-5p/LRP6 axis in the TJP destruction of BMECs and inflammation caused by OGD-treated astrocytes: (a) Astrocytes transfected with miR-29c-5p inhibitor and si-LRP6 were treated with OGD for 3 h. The concentrations of IL-1β, IL-6, TNF-α, and TGF-β in the cell culture supernatant of astrocytes were measured by ELISA. (b) Western blot was carried out to test the protein levels of VEGF-A and MMP-9. (c) Astrocytes transfected with miR-29c-5p inhibitor and si-LRP6 were treated with OGD for 3 h and then cocultured with BMECs for 24 h. The protein levels of GFAP and GLP-1R were quantified using Western blot. (d) Analysis of the claudin-5, occludin, and ZO-1 protein levels using Western blot. Data are presented as an average of three independent assays. ***P < 0.001 vs NC-inhibitor + Si-NC. # P < 0.05, ## P < 0.01, ### P < 0.001 vs miR-29c-5p inhibitor + si-NC.
Figure 6

Verification of the regulatory function of the miR-29c-5p/LRP6 axis in the TJP destruction of BMECs and inflammation caused by OGD-treated astrocytes: (a) Astrocytes transfected with miR-29c-5p inhibitor and si-LRP6 were treated with OGD for 3 h. The concentrations of IL-1β, IL-6, TNF-α, and TGF-β in the cell culture supernatant of astrocytes were measured by ELISA. (b) Western blot was carried out to test the protein levels of VEGF-A and MMP-9. (c) Astrocytes transfected with miR-29c-5p inhibitor and si-LRP6 were treated with OGD for 3 h and then cocultured with BMECs for 24 h. The protein levels of GFAP and GLP-1R were quantified using Western blot. (d) Analysis of the claudin-5, occludin, and ZO-1 protein levels using Western blot. Data are presented as an average of three independent assays. ***P < 0.001 vs NC-inhibitor + Si-NC. # P < 0.05, ## P < 0.01, ### P < 0.001 vs miR-29c-5p inhibitor + si-NC.

4 Discussion

The previous study demonstrates that the miR-181 and miR-29 families are abnormally expressed in cerebral ischemia astrocytes [34]. Based on this, this study further verified the expressions of miR-181 family and miR-29 family in clinical blood samples from patients with ischemic stroke and authenticated that only miR-29c-5p was remarkably overexpressed. Thus, we focused on the mechanism of miR-29c-5p in ischemic stroke in the current study. Here, we demonstrated that the interference with miR-29c-5p decreased the high permeability and the TJP destruction of BMECs and the inflammation induced by OGD-treated astrocytes. Mechanism research results confirmed that miR-29c-5p interacted with LRP6 and negatively regulated LRP6 expression in astrocytes. Moreover, the rescue assays indicated that the interference with miR-29c-5p ameliorated the TJP destruction of BMECs and inflammation caused by OGD-treated astrocytes by upregulating LRP6 expression. Thus, our study might provide a novel regulatory axis for ischemic stroke: miR-29c-5p/LRP6.

Accumulated evidence suggest that BBB dysfunction is the pathogenesis of many neurological diseases, including ischemic stroke [35]. Various factors contribute to BBB dysfunction, including the major components of BBB: BMECs and astrocytes [6,36]. As reported, an in vitro BBB model composed of BMECs and primary culture of astrocytes has been used to elucidate the mechanisms of BBB and to develop novel therapeutic strategies [12]. Similarly, we obtained primary astrocytes from normal C57BL/6 mice and established a coculture system of BMECs and OGD-treated astrocytes. Our study confirmed that OGD treatment of astrocytes enhanced the permeability of BMECs. Based on this finding, we would continue investigating the potential mechanism of BMECs–astrocyte interaction under the pathological condition of BBB dysfunction after ischemic stroke.

Increasing studies illustrate that those different mechanisms, including miRNAs, are related to the pathogenesis of BBB dysfunction after ischemic stroke. For instance, Chen et al. identified a double-negative feedback loop: let-7i/TGF-βR1 in ischemic stroke, providing a potential therapeutic target for ischemic stroke [37]; Ma et al. indicated that the deletion of miR-15a/16-1 gene in endothelial cells represses BBB dysfunction after ischemic stroke, suggesting that miR-15a/16-1 mediates BBB dysfunction to alleviate ischemic stroke [38]. Similarly, our study illustrated that miR-29c-5p was elevated in clinical blood samples from patients with ischemic stroke, implying that miR-29c-5p might be related to the occurrence and development of ischemic stroke. Our functional study further clarified that the miR-29c-5p knockdown reduced the high permeability and the TJP destruction of BMECs and the inflammation induced by OGD-treated astrocytes.

As an essential member of the LRP family, LRP6 has been proved to exert an important regulatory function in the occurrence of ischemic stroke [21,39]. Interestingly, our research found that there were binding sites between miR-29c-5p and LRP6 through TargetScan and Metascape databases. Based on these findings, we further confirmed that miR-29c-5p bound to LRP6, and the expression of LRP6 in astrocytes was negatively regulated by miR-29c-5p, and LRP6 was lowly expressed in clinical blood samples from patients with ischemic stroke. Meanwhile, the rescue assays illustrated that the interference with miR-29c-5p ameliorated the TJP destruction of BMECs and inflammation caused by OGD-treated astrocytes by elevating LRP6.

In summary, our results provided evidence that miR-29c-5p improved the TJP destruction of BMECs and inflammation caused by OGD-treated astrocytes by upregulating LRP6. This study might provide a novel regulatory axis for ischemic stroke: miR-29c-5p/LRP6. Besides, there might also be other targets for miR-29C-5p, and we would continue to explore in-depth to further enrich the content of this study.

Qijun Dai, Jian Sun, and Tianyi Dai contributed equally to the article.

Acknowledgments

Not applicable.

  1. Funding information: This work was supported by the 2020 Nantong Science and technology plan project (MSZ20084).

  2. Author contributions: Yueqin Ding conceived and designed the study. Qijun Dai, JianSun, and Tianyi Dai performed the literature search and data extraction. Peipei Jiang, Qin Xu, and Pei Xu drafted the manuscript. All authors read and approved the final manuscript.

  3. Competing interests: The authors declare that they have no conflicts of interest.

  4. Consent for publication: The authors agree to the publication of the article in the journal.

  5. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Qin C, Zhou LQ, Ma XT, Hu ZW, Yang S, Chen M, et al. Dual functions of microglia in ischemic stroke. Neurosci Bull. 2019;35(5):921–33.10.1007/s12264-019-00388-3Search in Google Scholar PubMed PubMed Central

[2] Abdullahi W, Tripathi D, Ronaldson PT. Blood-brain barrier dysfunction in ischemic stroke: targeting tight junctions and transporters for vascular protection. Am J Physiol Cell Physiol. 2018;315(3):C343–56.10.1152/ajpcell.00095.2018Search in Google Scholar PubMed PubMed Central

[3] Schoknecht K, David Y, Heinemann U. The blood-brain barrier-gatekeeper to neuronal homeostasis: clinical implications in the setting of stroke. SemCell Developmental Biol. 2015;38:35–42.10.1016/j.semcdb.2014.10.004Search in Google Scholar PubMed

[4] Shah K, Abbruscato T. The role of blood-brain barrier transporters in pathophysiology and pharmacotherapy of stroke. Curr Pharm Des. 2014;20(10):1510–22.10.2174/13816128113199990465Search in Google Scholar PubMed

[5] Jiang X, Andjelkovic AV, Zhu L, Yang T, Bennett MVL, Chen J, et al. Blood-brain barrier dysfunction and recovery after ischemic stroke. Prog Neurobiol. 2018;163–164:144–71.10.1016/j.pneurobio.2017.10.001Search in Google Scholar PubMed PubMed Central

[6] Srivastava K, Shao B, Bayraktutan U. PKC-β exacerbates in vitro brain barrier damage in hyperglycemic settings via regulation of RhoA/Rho-kinase/MLC2 pathway. J Cereb Blood Flow Metabolism: Off J Int Soc Cereb Blood Flow Metab. 2013;33(12):1928–36.10.1038/jcbfm.2013.151Search in Google Scholar PubMed PubMed Central

[7] Liu LR, Liu JC, Bao JS, Bai QQ, Wang GQ. Interaction of microglia and astrocytes in the neurovascular unit. Front immunology. 2020;11:1024.10.3389/fimmu.2020.01024Search in Google Scholar PubMed PubMed Central

[8] Lok J, Wang XS, Xing CH, Maki TK, Wu LM, Guo SZ, et al. Targeting the neurovascular unit in brain trauma. CNS Neurosci Therapeutics. 2015;21(4):304–8.10.1111/cns.12359Search in Google Scholar PubMed PubMed Central

[9] Liu Z, Chopp M. Astrocytes, therapeutic targets for neuroprotection and neurorestoration in ischemic stroke. Prog Neurobiol. 2016;144:103–20.10.1016/j.pneurobio.2015.09.008Search in Google Scholar PubMed PubMed Central

[10] Strazielle N, Ghersi-Egea JF. Physiology of blood-brain interfaces in relation to brain disposition of small compounds and macromolecules. Mol Pharmaceutics. 2013;10(5):1473–91.10.1021/mp300518eSearch in Google Scholar PubMed

[11] Pan Q, He C, Liu H, Liao X, Dai B, Chen Y, et al. Microvascular endothelial cells-derived microvesicles imply in ischemic stroke by modulating astrocyte and blood brain barrier function and cerebral blood flow. Mol Brain. 2016;9(1):63.10.1186/s13041-016-0243-1Search in Google Scholar PubMed PubMed Central

[12] Li C, Wang X, Cheng F, Du X, Yan J, Zhai C, et al. Geniposide protects against hypoxia/reperfusion-induced blood-brain barrier impairment by increasing tight junction protein expression and decreasing inflammation, oxidative stress, and apoptosis in an in vitro system. Eur J Pharmacology. 2019;854:224–31.10.1016/j.ejphar.2019.04.021Search in Google Scholar PubMed

[13] Saliminejad K, Khorram Khorshid HR, Soleymani Fard S, Ghaffari SH. An overview of microRNAs: Biology, functions, therapeutics, and analysis methods. J Cell Physiol. 2019;234(5):5451–65.10.1002/jcp.27486Search in Google Scholar PubMed

[14] Wang F, Liang R, Tandon N, Matthews ER, Shrestha S, Yang J, et al. H19X-encoded miR-424(322)/-503 cluster: emerging roles in cell differentiation, proliferation, plasticity and metabolism. Cell Mol Life Sciences: CMLS. 2019;76(5):903–20.10.1007/s00018-018-2971-0Search in Google Scholar PubMed PubMed Central

[15] Engin AB. MicroRNA and adipogenesis. Adv Exp Med Biol. 2017;960:489–509.10.1007/978-3-319-48382-5_21Search in Google Scholar PubMed

[16] Zuo X, Lu J, Manaenko A, Qi X, Tang J, Mei Q, et al. MicroRNA-132 attenuates cerebral injury by protecting blood-brain-barrier in MCAO mice. Exp Neurol. 2019;316:12–9.10.1016/j.expneurol.2019.03.017Search in Google Scholar PubMed

[17] Zhang T, Tian C, Wu J, Zhang Y, Wang J, Kong Q, et al. MicroRNA-182 exacerbates blood-brain barrier (BBB) disruption by downregulating the mTOR/FOXO1 pathway in cerebral ischemia. FASEB Journal: Off Publ Federation Am Societies Exp Biol. 2020;34(10):13762–75.10.1096/fj.201903092RSearch in Google Scholar PubMed

[18] Wu J, He J, Tian X, Luo Y, Zhong J, Zhang H, et al. microRNA-9-5p alleviates blood-brain barrier damage and neuroinflammation after traumatic brain injury. J neurochemistry. 2020;153(6):710–26.10.1111/jnc.14963Search in Google Scholar PubMed PubMed Central

[19] Chang L, Hu L, Wei C, Zhang H, Liu S. Chinese medicine Tongxinluo capsule protects against blood-brain barrier disruption after ischemic stroke by inhibiting the low-density lipoprotein receptor-related protein 1 pathway in mice. J Stroke Cerebrovasc Diseases: Off J Natl Stroke Assoc. 2020;29(9):105071.10.1016/j.jstrokecerebrovasdis.2020.105071Search in Google Scholar PubMed

[20] Acebron SP, Niehrs C. β-Catenin-independent roles of Wnt/LRP6 signaling. Trends Cell Biol. 2016;26(12):956–67.10.1016/j.tcb.2016.07.009Search in Google Scholar PubMed

[21] Harriott AM, Heckman MG, Rayaprolu S, Soto-Ortolaza AI, Diehl NN, Kanekiyo T, et al. Low density lipoprotein receptor related protein 1 and 6 gene variants and ischaemic stroke risk. Eur J Neurol. 2015;22(8):1235–41.10.1111/ene.12735Search in Google Scholar PubMed PubMed Central

[22] Abe T, Zhou P, Jackman K, Capone C, Casolla B, Hochrainer K, et al. Lipoprotein receptor-related protein-6 protects the brain from ischemic injury. Stroke. 2013;44(8):2284–91.10.1161/STROKEAHA.113.001320Search in Google Scholar PubMed PubMed Central

[23] Arai K, Lo EH. Astrocytes protect oligodendrocyte precursor cells via MEK/ERK and PI3K/Akt signaling. J Neurosci Res. 2010;88(4):758–63.10.1002/jnr.22256Search in Google Scholar PubMed PubMed Central

[24] Kim SK, Yang H, Pascual JM, De Vivo DC. Valproic acid enhances glucose transport in the cultured brain astrocytes of glucose transporter 1 heterozygous mice. J Child Neurol. 2013;28(1):70–6.10.1177/0883073812440044Search in Google Scholar PubMed

[25] Hollmann EK, Bailey AK, Potharazu AV, Neely MD, Bowman AB, Lippmann ES. Accelerated differentiation of human induced pluripotent stem cells to blood-brain barrier endothelial cells. Fluids Barriers CNS. 2017;14(1):9.10.1186/s12987-017-0059-0Search in Google Scholar PubMed PubMed Central

[26] Wang F, Li R, Tu P, Chen J, Zeng K, Jiang Y. Total glycosides of cistanche deserticola promote neurological function recovery by inducing neurovascular regeneration via Nrf-2/Keap-1 pathway in MCAO/R Rats. Front Pharmacology. 2020;11:236.10.3389/fphar.2020.00236Search in Google Scholar PubMed PubMed Central

[27] Canfield SG, Stebbins MJ, Morales BS, Asai SW, Vatine GD, Svendsen CN, et al. An isogenic blood-brain barrier model comprising brain endothelial cells, astrocytes, and neurons derived from human induced pluripotent stem cells. J neurochemistry. 2017;140(6):874–88.10.1111/jnc.13923Search in Google Scholar PubMed PubMed Central

[28] Hu S, Wu Y, Zhao B, Hu H, Zhu B, Sun Z, et al. Panax notoginseng saponins protect cerebral microvascular endothelial cells against oxygen-glucose deprivation/reperfusion-induced barrier dysfunction via activation of PI3K/Akt/Nrf2 antioxidant signaling pathway. Molecules (Basel, Switzerland). 2018;23(11):2781–98.10.3390/molecules23112781Search in Google Scholar PubMed PubMed Central

[29] Jiao H, Wang Z, Liu Y, Wang P, Xue Y. Specific role of tight junction proteins claudin-5, occludin, and ZO-1 of the blood-brain barrier in a focal cerebral ischemic insult. J Mol Neuroscience: MN. 2011;44(2):130–9.10.1007/s12031-011-9496-4Search in Google Scholar PubMed

[30] Argaw AT, Asp L, Zhang J, Navrazhina K, Pham T, Mariani JN, et al. Astrocyte-derived VEGF-A drives blood-brain barrier disruption in CNS inflammatory disease. J Clin investigation. 2012;122(7):2454–68.10.1172/JCI60842Search in Google Scholar PubMed PubMed Central

[31] Wiese S, Karus M, Faissner A. Astrocytes as a source for extracellular matrix molecules and cytokines. Front Pharmacology. 2012;3:120.10.3389/fphar.2012.00120Search in Google Scholar PubMed PubMed Central

[32] Song S, Huang H, Guan X, Fiesler V, Bhuiyan MIH, Liu R, et al. Activation of endothelial Wnt/β-catenin signaling by protective astrocytes repairs BBB damage in ischemic stroke. Prog Neurobiol. 2021;199:101963.10.1016/j.pneurobio.2020.101963Search in Google Scholar PubMed PubMed Central

[33] Xi T, Jin F, Zhu Y, Wang J, Tang L, Wang Y, et al. miR-27a-3p protects against blood-brain barrier disruption and brain injury after intracerebral hemorrhage by targeting endothelial aquaporin-11. J Biol Chem. 2018;293(52):20041–50.10.1074/jbc.RA118.001858Search in Google Scholar PubMed PubMed Central

[34] Ouyang YB, Xu L, Liu S, Giffard RG. Role of astrocytes in delayed neuronal death: GLT-1 and its novel regulation by MicroRNAs. Adv Neurobiol. 2014;11:171–88.10.1007/978-3-319-08894-5_9Search in Google Scholar PubMed PubMed Central

[35] Zhao Z, Nelson AR, Betsholtz C, Zlokovic BV. Establishment and dysfunction of the blood-brain barrier. Cell. 2015;163(5):1064–78.10.1016/j.cell.2015.10.067Search in Google Scholar PubMed PubMed Central

[36] Xia YP, He QW, Li YN, Chen SC, Huang M, Wang Y, et al. Recombinant human sonic hedgehog protein regulates the expression of ZO-1 and occludin by activating angiopoietin-1 in stroke damage. PLoS one. 2013;8(7):e68891.10.1371/journal.pone.0068891Search in Google Scholar PubMed PubMed Central

[37] Chen D, Li L, Wang Y, Xu R, Peng S, Zhou L, et al. Ischemia-reperfusion injury of brain induces endothelial-mesenchymal transition and vascular fibrosis via activating let-7i/TGF-βR1 double-negative feedback loop. FASEB J: Off Publ Federation Am Societies Exp Biol. 2020;34(5):7178–91.10.1096/fj.202000201RSearch in Google Scholar PubMed

[38] Ma F, Sun P, Zhang X, Hamblin MH, Yin KJ. Endothelium-targeted deletion of the miR-15a/16-1 cluster ameliorates blood-brain barrier dysfunction in ischemic stroke. Sci Signal. 2020;13(626):eaay5686.10.1126/scisignal.aay5686Search in Google Scholar PubMed PubMed Central

[39] Ren H, Luo JQ, Ouyang F, Cheng L, Chen XP, Zhou HH, et al. WNT3A rs752107(C > T) polymorphism is associated with an increased risk of essential hypertension and related cardiovascular diseases. Front Cardiovascular Med. 2021;8:675222.10.3389/fcvm.2021.675222Search in Google Scholar PubMed PubMed Central

Received: 2021-08-12
Revised: 2022-01-17
Accepted: 2022-01-19
Published Online: 2022-02-22

© 2022 Qijun Dai et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0438
Keywords for this article
ischemic stroke; blood–brain barrier; brain microvascular endothelial cells; astrocytes; miRNA
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 17.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0438/html
Scroll to top button