Startseite Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
Artikel Open Access

Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis

  • Rui Wang , Hongliu Liu , Mingqiang Dong , Dan Huang und Jun Yi EMAIL logo
Veröffentlicht/Copyright: 28. April 2022
Artikel downloaden (PDF)
Open Medicine
Aus der Zeitschrift Open Medicine Band 17 Heft 1

Abstract

This study aims to explore the function and mechanism of exosomal circ_0000519 in non-small cell lung cancer (NSCLC) development. Expression of circ_0000519, microRNA (miR)-1258, and Ras homolog gene family V (RHOV) in serum samples of NSCLC patients or cell lines were examined via quantitative reverse transcription-polymerase chain reaction and Western blotting. The function of circ_0000519 was evaluated through 5-ethynyl-2′-deoxyuridine (EdU) staining, colony formation, transwell, Western blotting, xenograft, and immunohistochemistry analyses. The binding relationship was evaluated by a dual-luciferase reporter assay and RNA pull-down assay. Results showed that circ_0000519 abundance was enhanced in the serum samples of NSCLC patients and cells. circ_0000519 knockdown suppressed the cell growth by decreasing the colony-formation ability and Cyclin D1 expression and inhibited cell metastasis via reducing migration, invasion, and levels of Vimentin and matrix metalloproteinase 9 (MMP9). circ_0000519 overexpression promoted cell growth and metastasis. circ_0000519 was carried by exosomes and knockdown of exosomal circ_0000519 suppressed the cell growth and metastasis. miR-1258 was downregulated in NSCLC cells and targeted by circ_0000519. RHOV was targeted by miR-1258 and upregulated in the NSCLC cells. miR-1258 knockdown or RHOV overexpression attenuated the influence of exosomal circ_0000519 knockdown on cell growth and metastasis. Exosomal circ_0000519 knockdown decreased xenograft tumor growth. Collectively, the knockdown of exosomal circ_0000519 repressed the cell growth and metastasis in NSCLC through the miR-1258/RHOV axis, which provided a new insight into NSCLC development and treatment.

Keywords: non-small cell lung cancer; exosome; hsa_circ_0000519; miR-1258; RHOV

1 Introduction

Lung cancer is a frequent tumor with 2.09 million newly diagnosed cases and 1.76 million deaths in 2018 globally [1]. Non-small cell lung cancer (NSCLC) is the major histological subtype of lung cancer accounting for ∼85% of cases, including lung adenocarcinoma, squamous cell carcinoma, and lung large cell carcinoma [2]. Significant progress has been gained in the diagnosis and treatment of NSCLC, but the 60-month survival of patients is poor, especially in the advanced stage [3]. Hence, new therapeutic strategies are needed to improve the outcomes of NSCLC.

Exosomes are single-membrane vesicles with a diameter of ∼30 to ∼200 nm, which can be secreted by most cells, and take part in cell-to-cell communication in human health and diseases [4,5]. Exosomes can transfer proteins, DNA, mRNA, and non-coding RNAs, which have important roles in tumor growth, metastasis, and angiogenesis [6,7]. The tumor-derived exosomes can be secreted in the tumor environment, thus affecting cancer growth, progression, metastasis, and drug resistance in NSCLC [8]. As reported, dendritic cell-derived exosomes can receive immune signals and use a cell-free vaccine for cancer immunotherapy [9]. Circular RNAs (circRNAs) are a type of important non-coding RNAs, which can be enriched in exosomes and dysregulated in human diseases, especially in cancers [10]. Moreover, circRNAs can participate in NSCLC progression via modulating microRNA (miRNA)/mRNA networks [11]. Additionally, exosomal circRNAs can regulate NSCLC growth, metastasis, and glycolysis, such as circRNA Rho GTPase-activating protein 10 (ARHGAP10) and mediator of cell motility 1 (MEMO1) [12,13]. A previous report founds that hsa_circ_0000519 (circ_0000519, also named hsa_circ_002178) is an upregulated circRNA in lung adenocarcinoma, as revealed by the GSE101684 and GSE101586 datasets, and it can be transferred by exosomes to be involved in immune therapy by regulating programmed death-ligand 1 (PDL1)/programmed cell death protein 1 (PD1) [14]. But, the exact role and mechanism of exosomal circ_0000519 in NSCLC development are unknown.

MiRNAs are short non-coding RNAs that regulate various processes such as growth, apoptosis, metastasis, differentiation, and metabolism, which have key roles in the progression, diagnosis, and therapy of NSCLC [15,16]. miR-1258 is a miRNA associated with the heparinase expression and suppresses cell invasion in NSCLC [17]. Furthermore, miR-1258 can inhibit cell proliferation and promote apoptosis in NSCLC by regulating growth-factor-receptor-bound protein 2 (GRB2) [18]. Nevertheless, whether the miRNA is regulated by circ_0000519 remains unknown. Additionally, Ras homolog gene family V (RHOV) is an overexpressed gene in NSCLC [19]. And, it may be related to the poor prognosis of NSCLC [20]. However, the function of RHOV in NSCLC has not been reported. The bioinformatics analysis predicts that both circ_0000519 and RHOV can bind with miR-1258, suggesting the potential competitive mechanism among the three. Yet, no study has clarified the network of circ_0000519/miR-1258/RHOV in NSCLC.

The purposes of our study were to analyze the function of exosomal circ_0000519 on NSCLC growth and metastasis and to confirm the network of circ_0000519/miR-1258/RHOV in NSCLC progression. This study might provide a novel mechanism for understanding the pathogenesis of NSCLC.

2 Methods

2.1 Bioinformatics analysis

The information of circ_0000519 was provided by circBase (http://circrna.org/). The downstream miRNAs of circ_0000519 were searched from circinteractome (https://circinteractome.nia.nih.gov/). The target mRNAs of miR-1258 were searched from TargetScan (http://www.targetscan.org/vert_71/).

2.2 Clinical samples

The serum samples were harvested from NSCLC patients (n = 59) in Jingmen No.1 People’s Hospital. Age- and gender-matched normal volunteers (n = 37) were used as controls.

  1. Ethical approval: The present study was approved by the ethical review committee of Jingmen No. 1 People’s Hospital. Written informed consent was obtained from all enrolled patients.

  2. Informed consent: Patients agree to participate in this work.

2.3 Cell culture

Lung squamous cell carcinoma cell line (H2170 cells), lung large cell carcinoma cell line (H1299 cells), and lung adenocarcinoma cell line (A549 cells) were purchased from Procell (Wuhan, China) and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, Grand Island, NY, USA) plus 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin/streptomycin (Gibco) at 37°C and 5% CO2. Human bronchial epithelioid cell line (BEAS-2B cells) was purchased from Procell and cultured in the specific Bronchial Epithelial Cell Growth Medium (Lonza, Hayward, CA, USA) at 37°C and 5% CO2.

2.4 RNase R and Actinomycin D assays

The circular structure of circ_0000519 was analyzed via RNase R and Actinomycin D assays. For the Actinomycin D assay, H2170, H1299, and A549 cells were incubated with 2 μg/mL Actinomycin D (Sigma, St. Louis, MO, USA) for different time points. Next, the cells were lysed for RNA isolation, and abundances of circ_0000519 and GAPDH were measured.

For RNase R assay, total RNA was exposed to 2 U/μg RNase R (Geneseed, Guangzhou, China) for 20 min and next used for the detection of circ_0000519 and GAPDH levels.

2.5 Cell transfection

The circ_0000519 overexpression vector was constructed via Geneseed, and the pCD5-ciR vector was regarded as a negative control (vector). RHOV overexpression vector (pcDNA3.1-RHOV) was constructed in our laboratory with a pcDNA3.1 vector (Thermo Fisher Scientific, Waltham, MA, USA) alone as a negative control. The small-interfering RNA (siRNA) for circ_0000519 (si-circ_0000519), siRNA negative control (si-NC), miR-1258 mimic, negative control of mimic (miR-NC), miR-1258 inhibitor (anti-miR-1258), and inhibitor negative control (anti-NC) were generated via Genomeditech (Shanghai, China). The oligonucleotide sequences are listed in Table 1. H2170, H1299, or A549 cells were incubated with 2 μg vectors or 20 nM oligonucleotides and 5 μL Lipofectamine 3000 (Thermo Fisher Scientific) for 12 h. Cells were harvested for further studies after 24 h post-transfection.

Table 1

The oligo sequences for transfection in this study

Name Sequence (5′–3′)
si-circ_0000519 ACGCACUCAGCUCCCCGAAGC
si-NC UGCGUGAGUCCUCCCCGAAGC
miR-1258 mimic AGUUAGGAUUAGGUCGUGGAA
miR-NC CGAUCGCAUCAGCAUCGAUUGC
anti-miR-1258 UUCCACGACCUAAUCCUAACU
anti-NC UGAGCUGCAUAGAGUAGUGAUUA

2.6 Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Total RNA was extracted with Trizol (Thermo Fisher Scientific) or an exosome RNA isolation kit (Norgen, Thorold, Canada) and reversely transcribed to cDNA using a miScript reverse transcription kit (Qiagen, Dusseldorf, Germany) or M-MLV Reverse Transcriptase kit (Thermo Fisher Scientific). The generated cDNA was diluted 10 times and used for qRT-PCR after being mixed with SYBR (Thermo Fisher Scientific) and specific primer pairs (Sangon, Shanghai, China). The qRT-PCR was conducted on the CFX96™ Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA). The primer sequences are designed and listed in Table 2. GAPDH (for circRNA or mRNA) and U6 (for miRNA) acted as controls. The relative RNA level was measured according to the 2−ΔΔCt method.

Table 2

The primer sequences for qRT-PCR in this study

Name Sequence (5′–3′)
Forward Reverse
miR-1258 GCCGAGAGTTAGGATTAGGTC AGTGCAGGGTCCGAGGTATT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
circ_0000519 GCCCTAACAGGGCTCTCC CAGACCTTCCCAAGGGACAT
RHOV CAGTCACCTCCGAGCAGTTT TCTCCAAATCGGGGTTGAGC
GAPDH AATGGGCAGCCGTTAGGAAA GCGCCCAATACGACCAAATC

2.7 5-Ethynyl-2′-deoxyuridine (EdU) staining

Cell proliferation was analyzed with a BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 594 (Beyotime, Shanghai, China). In brief, 4 × 104 H1299, H2170, or A549 cells were added to 24-well plates and incubated for 24 h. Next, the cells were interacted with 10 μM EdU for 2 h and treated with 4% paraformaldehyde (Beyotime) and 0.3% Triton X-100 (Beyotime), followed by incubating with the click reaction solution for 30 min. The nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Beyotime) for 10 min. The Edu-positive cells were observed with a fluorescence microscope (Olympus, Tokyo, Japan).

2.8 Colony formation assay

Cell growth was assessed via a colony formation assay. Briefly, 800 H2170, H1299, or A549 cells were added to 6-well plates. After 10 days of culture, the colonies were stained using 0.1% crystal violet (Solarbio, Beijing, China) followed by taking pictures and calculating.

2.9 Transwell analysis

Cell migration and invasion were analyzed with 24-well transwell chambers (Corning Inc., Corning, NY, USA). In brief, for the migration assay, 1 × 105 H2170, H1299, or A549 cells were resuspended in the non-serum RPMI-1640 medium and added to the upper chambers. The lower chambers were filled with RPMI-1640 medium plus 10% FBS as a chemoattractant. After a culture of 24 h, the cells in the lower chambers were dyed using 0.1% crystal violet and observed under a microscope (100× magnification; Olympus). For invasion analysis, the transwell chambers were pre-coated with Matrigel (Solarbio), and 5 × 105 H2170, H1299, or A549 cells were added to the upper chambers. Other protocols were the same as the migration assay. The migratory or invasive number of cells was analyzed using Image J v1.6 (NIH, Bethesda, MD, USA).

2.10 Western blotting

The protein was extracted using radioimmunoprecipitation assay buffer (Thermo Fisher Scientific). The samples were quantified using a bicinchoninic acid kit (Thermo Fisher Scientific), and 20 μg of samples were separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred on polyvinylidene fluoride membranes (Bio-Rad). The membranes were incubated in 3% bovine serum albumin for 1 h and next interacted with the primary antibodies Cyclin D1 (ab226977, 1:500 dilution, Abcam, Cambridge, UK), Vimentin (ab137321, 1:300 dilution, Abcam), matrix metalloproteinase 9 (MMP9) (ab76003, 1:3,000 dilution, Abcam), cluster of differentiation (CD) 63 (ab216130, 1:200 dilution, Abcam), CD81 (ab109201, 1:2,000 dilution, Abcam), RHOV (sc-515072, 1:500 dilution, Santa Cruz Biotechnology, Santa Cruz, CA, USA), and GAPDH (ab181603, 1:5,000 dilution, Abcam) overnight. GAPDH functioned as a normalized control. The blots were exposed to enhanced chemiluminescence (Beyotime) and evaluated with Image J v1.6.

2.11 Exosome isolation, validation, and incubation

After culturing for 48 h, the culture medium of H1299 cells was collected and centrifugated at 3,000×g for 15 min, followed via the use of exosome isolation with an exosome isolation kit (Thermo Fisher Scientific) following the instructions. To inhibit the secretion of exosomes, H1299 cells were pre-treated with 20 μM GW4869 (Sigma) for 2 h before exosome isolation. The exosome structure was confirmed via transmission electron microscope (TEM; JEOL, Tokyo, Japan). The particle size and concentration of the exosome were analyzed using ZetaView PMX 110 (Particle Metrix, Meerbusch, Germany). The specific exosomal markers CD63 and CD81 were measured by Western blotting. To investigate the role of exosomes, H2170 and A549 cells were incubated with 5 μg/mL exosomes for 24 h.

2.12 Dual-luciferase reporter and RNA pull-down assays

The wild-type (WT) sequence of circ_0000519 or RHOV 3′UTR with miR-1258 binding sites was cloned into the pmir-GLO vector (Promega, Madison, WI, USA), generating the circ_0000519 WT and RHOV 3′UTR WT vectors. The mutant (MUT) sequence containing the mutant sites was used to construct the circ_0000519 MUT and RHOV 3′UTR MUT vectors. The constructed vectors were co-transfected with miR-1258 mimic or miR-NC into H2170, H1299, or A549 cells with Lipofectamine 3000. After 24 h, luciferase activity was determined through a dual-luciferase reporter assay kit (Promega) following the instructions.

The RNA pull-down analysis was conducted with a Pierce™ Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific) following the instructions. In brief, the biotin-labeled miR-1258 (Bio-miR-1258) or Bio-miR-NC was generated by the RNA 3′ end desthiobiotinylation kit (Thermo Fisher Scientific) and transfected into H2170, H1299 or A549 cells for 24 h. Next, 1 × 107 cells were lysed and interacted with the streptavidin magnetic beads for 6 h. Then, enriched RNA was eluted, and circ_0000519 level was measured via qRT-PCR.

2.13 Xenograft model

The lentivirus-carrying short hairpin RNA (shRNA) for circ_0000519 (sh-circ_0000519) or negative control (sh-NC) was constructed by Genomeditech and transfected into H1299 cells according to the instructions. The exosomes were isolated from the transfected cells and named sh-NC-exo or sh-circ_0000519-exo. Five-week-old male BALB/c nude mice (Vital River, Beijing, China) were divided into two groups (n = 5/group), and subcutaneously injected with 5 × 106 H2170 cells. After 5 days, the mice were injected with 30 μg sh-NC-exo or sh-circ_0000519-exo twice a week at the tumor sites. Tumor volume was detected every week, and calculated with the formula (0.5 × length × width2). No unexpected deaths occurred during the study. After 30 days, mice were euthanized through inhalation anesthesia of 5% isoflurane (Sigma). Then tumors were harvested and weighed. circ_0000519, miR-1258, and RHOV levels in the tumors were detected. The procedures were permitted via the Animal Ethics Committee of Jingmen No.1 People’s Hospital.

2.14 Immunohistochemistry

The tumors were sectioned to 4 μm thickness, and the sections were blocked by 3% H2O2. The sections interacted with the primary antibody for Ki-67 (ab15580, 1:300 dilution, Abcam) overnight and horseradish peroxidase-labeled IgG (ab6721, 1:1,000 dilution, Abcam) for 2 h, followed by staining with diaminobenzidine (DAB; Beyotime). The sections were observed under a microscope.

2.15 Statistical analysis

The experiments were conducted three times. Data were shown as mean ± standard deviation (SD). The linear correlation of RNA levels in NSCLC patients was analyzed by the Pearson coefficient test. The difference was compared via Student t-test or one-way analysis of variance with the Tukey post hoc test, which was processed through GraphPad Prism 8 (GraphPad Inc., La Jolla, CA, USA). P < 0.05 predicted the significant difference.

3 Results

3.1 circ_0000519 level is elevated in NSCLC

To determine if circ_0000519 was involved in the NSCLC development, circ_0000519 expression was detected in NSCLC patients. The serum samples were harvested from 59 NSCLC patients and 37 normal subjects. circ_0000519 level was higher in the NSCLC patients than in the normal group (Figure 1a). Moreover, circ_0000519 abundance was enhanced in the H2170, H1299, and A549 cells when compared with the BEAS-2B cells (Figure 1b). The information of circ_0000519 was obtained from the circBase database, which showed that circ_0000519 was derived from the ribonuclease P RNA component H1 (RPPH1) gene at chr14: 20811436-20811534 by back-splicing (Figure 1c). Additionally, the circular structure of circ_0000519 was validated in H1299, H2170, and A549 cells via Actinomycin D and RNase R analyses. Results showed that the linear GAPDH was decreased by the treatment of Actinomycin D and RNase R, but circ_0000519 was resistant to Actinomycin D and Rnase R (Figure 1d and e, Figure A1). These results suggested that increased circ_0000519 was related to NSCLC.

Figure 1 circ_0000519 level is increased in NSCLC. (a) circ_0000519 level was measured via qRT-PCR in the serum samples of NSCLC patients (n = 59) or normal subjects (n = 37). (b) circ_0000519 abundance was detected via qRT-PCR in H2170, H1299, A549, and BEAS-2B cells. (c) The information of circ_0000519 was searched from circBase. (d) circ_0000519 and GAPDH levels were measured by qRT-PCR in H2170 and A549 cells after exposure to Actinomycin D for different time points. (e) circ_0000519 and GAPDH abundances were determined via qRT-PCR in H2170 and A549 cells after the incubation of RNase R. * P < 0.05, ** P < 0.01, and *** P < 0.001.
Figure 1

circ_0000519 level is increased in NSCLC. (a) circ_0000519 level was measured via qRT-PCR in the serum samples of NSCLC patients (n = 59) or normal subjects (n = 37). (b) circ_0000519 abundance was detected via qRT-PCR in H2170, H1299, A549, and BEAS-2B cells. (c) The information of circ_0000519 was searched from circBase. (d) circ_0000519 and GAPDH levels were measured by qRT-PCR in H2170 and A549 cells after exposure to Actinomycin D for different time points. (e) circ_0000519 and GAPDH abundances were determined via qRT-PCR in H2170 and A549 cells after the incubation of RNase R. * P < 0.05, ** P < 0.01, and *** P < 0.001.

3.2 circ_0000519 overexpression facilitates NSCLC cell growth and metastasis

To study the function of circ_0000519 in NSCLC development, H1299 cells were transfected with si-NC, si-circ_0000519, vector or circ_0000519 overexpression vector. The efficacy of si-circ_0000519 or circ_0000519 overexpression vector is validated in Figure 2a and b, which exhibited that circ_0000519 expression was markedly reduced by transfection of si-circ_0000519 and increased by the addition of circ_0000519 overexpression vector. Moreover, circ_0000519 silence evidently decreased cell growth, as revealed by EdU and colony formation assays (Figure 2c and d). Additionally, circ_0000519 interference significantly inhibited cell metastasis by decreasing the migratory and invasive abilities of H1299 cells (Figure 2e and f). Furthermore, the related protein levels were detected, and results showed that circ_0000519 knockdown led to obvious reductions of Cyclin D1, Vimentin, and MMP9 (Figure 2g). In addition, circ_0000519 overexpression increased the EdU-positive cells, colony formation ability, migration, invasion, and the expression of Cyclin D1, Vimentin, and MMP9 (Figure 2h–l). These data indicated that circ_0000519 overexpression contributed to NSCLC cell growth and metastasis.

Figure 2 circ_0000519 promotes NSCLC cell growth and metastasis. (a and b) circ_0000519 abundance was examined via qRT-PCR in the H1299 cells with transfection of si-NC, si-circ_0000519, vector or circ_0000519 overexpression vector. (c and d) Cell growth was analyzed using EdU staining and colony formation assays in the H1299 cells transfected with si-NC or si-circ_0000519. (e and f) Cell migration and invasion were measured by a transwell assay in H1299 cells transfected with si-NC or si-circ_0000519. (g) Cyclin D1, Vimentin, and MMP9 levels were measured via Western blotting in the H1299 cells transfected with si-NC or si-circ_0000519. (h and i) Cell growth was detected with EdU staining and colony formation assays in the H1299 cells transfected with vector or circ_0000519 overexpression vector. (j and k) Cell migration and invasion were measured via the transwell analysis in the H1299 cells with transfection of vector or circ_0000519 overexpression vector. (l) Cyclin D1, Vimentin, and MMP9 abundances were determined with Western blotting in the H1299 cells transfected with vector or circ_0000519 overexpression vector. *** P < 0.001.
Figure 2

circ_0000519 promotes NSCLC cell growth and metastasis. (a and b) circ_0000519 abundance was examined via qRT-PCR in the H1299 cells with transfection of si-NC, si-circ_0000519, vector or circ_0000519 overexpression vector. (c and d) Cell growth was analyzed using EdU staining and colony formation assays in the H1299 cells transfected with si-NC or si-circ_0000519. (e and f) Cell migration and invasion were measured by a transwell assay in H1299 cells transfected with si-NC or si-circ_0000519. (g) Cyclin D1, Vimentin, and MMP9 levels were measured via Western blotting in the H1299 cells transfected with si-NC or si-circ_0000519. (h and i) Cell growth was detected with EdU staining and colony formation assays in the H1299 cells transfected with vector or circ_0000519 overexpression vector. (j and k) Cell migration and invasion were measured via the transwell analysis in the H1299 cells with transfection of vector or circ_0000519 overexpression vector. (l) Cyclin D1, Vimentin, and MMP9 abundances were determined with Western blotting in the H1299 cells transfected with vector or circ_0000519 overexpression vector. *** P < 0.001.

3.3 H1299 cells can release exosomes

To explore if circ_0000519 could be transmitted by exosomes, the release of exosomes was analyzed in the H1299 cell medium. The morphology of exosomes was confirmed via TEM, which showed the typical oval-shaped extracellular vesicles (Figure 3a). Moreover, the diameters of exosomes were mainly in the range of 50–200 nm (Figure 3b). Additionally, specific exosomal markers were detected. High levels of CD63 and CD81 were measured in the exosomes from the H1299 cell medium but not detected in the cells with pre-treatment of exosome release inhibitor (GW4869) (Figure 3c). These results suggested that H1299 cells could secrete exosomes.

Figure 3 The exosomes are secreted by H1299 cells. Exosomes were isolated from the culture medium of H1299 cells. (a) The exosomes were confirmed by TEM. Scale bar: 200 nm. (b) The diameter of exosomes was analyzed. (c) CD63 and CD81 levels were detected via Western blotting in the exosomes from the culture medium of H1299 cells with or without pre-treatment of 20 μM GW4869 for 2 h.
Figure 3

The exosomes are secreted by H1299 cells. Exosomes were isolated from the culture medium of H1299 cells. (a) The exosomes were confirmed by TEM. Scale bar: 200 nm. (b) The diameter of exosomes was analyzed. (c) CD63 and CD81 levels were detected via Western blotting in the exosomes from the culture medium of H1299 cells with or without pre-treatment of 20 μM GW4869 for 2 h.

3.4 Exosome-carried circ_0000519 modulates NSCLC cell growth and metastasis

The exosomal circ_0000519 expression was markedly decreased in the culture medium of H1299 cells transfected with si-circ_0000519 (Figure 4a). To analyze whether exosomal circ_0000519 could affect the NSCLC development, the exosomes from the medium of si-NC or si-circ_0000519-transfected H1299 cells (named si-NC-exo or si-circ_0000519-exo) were exposed to H2170 and A549 cells. circ_0000519 levels were decreased in the H2170 and A549 cells incubated with si-circ_0000519-exo compared with these cells treated with si-NC-exo (Figure 4b). The EdU-positive cells and colony-formation abilities of H2170 and A549 cells were markedly decreased in the si-circ_0000519-exo-treated group compared with the si-NC-exo-treated group (Figure 4c and d). Additionally, cell migration and invasion were evidently reduced in the H2170 and A549 cells treated with si-circ_0000519-exo in comparison to these cells treated with si-NC-exo (Figure 4e and f). Moreover, the levels of Cyclin D1, Vimentin, and MMP9 were evidently downregulated in the cells treated with si-circ_0000519-exo compared with these cells treated with si-NC-exo (Figure 4g and h). These results suggested that exosomal circ_0000519 could regulate NSCLC cell growth and metastasis.

Figure 4 Exosome-carried circ_0000519 regulates NSCLC cell growth and metastasis. (a) circ_0000519 expression was measured using qRT-PCR in the exosomes of H1299 cells transfected with si-NC or si-circ_0000519. The exosomes were isolated from the H1299 cells transfected with si-NC or si-circ_0000519 and then co-incubated with H2170 and A549 cells. (b) circ_0000519 level was measured with qRT-PCR in H2170 and A549 cells after the co-incubation of exosomes. (c and d) Cell growth was analyzed using EdU staining and colony formation assays in H2170 and A549 cells after co-incubation of exosomes. (e and f) Cell migration and invasion were examined through the transwell analysis in H2170 and A549 cells after co-incubation of exosomes. (g and h) Cyclin D1, Vimentin, and MMP9 levels were measured via Western blotting in H2170 and A549 cells after co-incubation of exosomes. *** P < 0.001.
Figure 4

Exosome-carried circ_0000519 regulates NSCLC cell growth and metastasis. (a) circ_0000519 expression was measured using qRT-PCR in the exosomes of H1299 cells transfected with si-NC or si-circ_0000519. The exosomes were isolated from the H1299 cells transfected with si-NC or si-circ_0000519 and then co-incubated with H2170 and A549 cells. (b) circ_0000519 level was measured with qRT-PCR in H2170 and A549 cells after the co-incubation of exosomes. (c and d) Cell growth was analyzed using EdU staining and colony formation assays in H2170 and A549 cells after co-incubation of exosomes. (e and f) Cell migration and invasion were examined through the transwell analysis in H2170 and A549 cells after co-incubation of exosomes. (g and h) Cyclin D1, Vimentin, and MMP9 levels were measured via Western blotting in H2170 and A549 cells after co-incubation of exosomes. *** P < 0.001.

3.5 miR-1258 is sponged by circ_0000519

To reveal the potential mechanism modulated by circ_0000519, the downstream miRNAs were predicted by the circinteractome database. The predicted sites of circ_0000519 within miR-1258 are displayed in Figure 5a, suggesting that miR-1258 might be targeted by circ_0000519. miR-1258 expression was decreased in NSCLC patients when compared with normal subjects (Figure 5b). Moreover, the miR-1258 level was markedly reduced in H2170, H1299, and A549 cells when compared with the BEAS-2B cells (Figure 5c). To validate the association of circ_0000519 and miR-1258 in H2170, H1299, and A549 cells, the circ_0000519 WT or circ_0000519 MUT luciferase reporter vectors were constructed. miR-1258 mimic effectively decreased the luciferase activity of circ_0000519 WT but had no significant effect on the activity of circ_0000519 MUT (Figure 5d–f). Furthermore, a high level of circ_0000519 was enriched by Bio-miR-1258 in the three cell lines (Figure 5g). In addition, miR-1258 abundance in NSCLC patients was negatively related to circ_0000519 expression (r = −0.6289, P = 0.0075) (Figure 5h). These data showed that circ_0000519 could target miR-1258.

Figure 5 miR-1258 is sponged by circ_0000519. (a) The binding sites of miR-1258 and circ_0000519 were predicted by circinteractome. (b) miR-1258 expression was examined via qRT-PCR in the serum samples of NSCLC patients (n = 59) or normal subjects (n = 37). (c) miR-1258 abundance was measured via qRT-PCR in H2170, H1299, A549 and BEAS-2B cells. (d–f) Luciferase activity was detected in the H1299, H2170 and A549 cells transfected with circ_0000519 WT or circ_0000519 MUT and miR-NC or miR-1258 mimic. (g) circ_0000519 level was determined via qRT-PCR in cells after RNA pull-down analysis. (h) The linear correlation of miR-1258 and circ_0000519 levels in NSCLC patients. *** P < 0.001.
Figure 5

miR-1258 is sponged by circ_0000519. (a) The binding sites of miR-1258 and circ_0000519 were predicted by circinteractome. (b) miR-1258 expression was examined via qRT-PCR in the serum samples of NSCLC patients (n = 59) or normal subjects (n = 37). (c) miR-1258 abundance was measured via qRT-PCR in H2170, H1299, A549 and BEAS-2B cells. (d–f) Luciferase activity was detected in the H1299, H2170 and A549 cells transfected with circ_0000519 WT or circ_0000519 MUT and miR-NC or miR-1258 mimic. (g) circ_0000519 level was determined via qRT-PCR in cells after RNA pull-down analysis. (h) The linear correlation of miR-1258 and circ_0000519 levels in NSCLC patients. *** P < 0.001.

3.6 RHOV is targeted by miR-1258

To further explore the downstream of miR-1258, the targets of miR-1258 were predicted by the TargetScan online database. The target sequence of miR-1258 on RHOV is shown in Figure 6a. Moreover, the RHOV expression was significantly enhanced in NSCLC patients (Figure 6b and c). Additionally, the RHOV level was evidently increased in H2170, H1299, and A549 cells when compared with the BEAS-2B cells (Figure 6d and e). To identify the relationship between miR-1258 and RHOV, the RHOV 3′UTR WT and RHOV 3′UTR MUT luciferase reporter vectors were constructed. miR-1258 overexpression caused obvious inhibition of luciferase activity of RHOV 3′UTR WT, while the luciferase activity of RHOV 3′UTR MUT had no response to miR-1258 introduction (Figure 6f–h). Furthermore, miR-1258 level in NSCLC patients was negatively correlated with RHOV expression (r = −0.5875, P = 0.0005) (Figure 6i). These results showed that miR-1258 could target RHOV.

Figure 6 RHOV is targeted via miR-1258. (a) The binding sites of miR-1258 and RHOV were predicted by TargetScan. (b and c) RHOV abundance was detected using qRT-PCR and Western blotting in the serum samples of NSCLC patients or normal subjects. (d and e) RHOV abundance was measured via qRT-PCR and Western blotting in H2170, H1299, A549, and BEAS-2B cells. (f–h) Luciferase activity was detected in the H1299, H2170, and A549 cells transfected with RHOV 3′UTR WT or RHOV 3′UTR MUT and miR-NC or miR-1258 mimic. (i) The linear correlation of miR-1258 and RHOV levels in NSCLC patients. *** P < 0.001.
Figure 6

RHOV is targeted via miR-1258. (a) The binding sites of miR-1258 and RHOV were predicted by TargetScan. (b and c) RHOV abundance was detected using qRT-PCR and Western blotting in the serum samples of NSCLC patients or normal subjects. (d and e) RHOV abundance was measured via qRT-PCR and Western blotting in H2170, H1299, A549, and BEAS-2B cells. (f–h) Luciferase activity was detected in the H1299, H2170, and A549 cells transfected with RHOV 3′UTR WT or RHOV 3′UTR MUT and miR-NC or miR-1258 mimic. (i) The linear correlation of miR-1258 and RHOV levels in NSCLC patients. *** P < 0.001.

3.7 miR-1258 knockdown reverses the influence of exosomal circ_0000519 downregulation on NSCLC cell growth and metastasis

To analyze if miR-1258 was associated with exosomal circ_0000519-mediated NSCLC development, H2170 and A549 cells were transfected with anti-NC or anti-miR-1258 and then incubated with the exosomes from si-NC or si-circ_0000519-transfected H1299 cells (named si-NC-exo or si-circ_0000519-exo). The transfection of anti-miR-1258 effectively decreased the miR-1258 abundance in H2170 and A549 cells (Figure 7a). Moreover, miR-1258 knockdown attenuated the si-circ_0000519-exo-mediated inhibition of EdU-positive ratio and colony-formation ability (Figure 7b and c). Furthermore, miR-1258 silence mitigated the suppressive effect of exosomal circ_0000519 reduction on cell migration and invasion (Figure 7d and e). Additionally, miR-1258 knockdown alleviated the decreases of Cyclin D1, Vimentin, and MMP9 levels induced by si-circ_0000519-exo (Figure 7f and g). These data indicated that exosomal circ_0000519 downregulation inhibited the NSCLC cell growth and metastasis via regulating miR-1258.

Figure 7 miR-1258 knockdown attenuates the influence of exosomal circ_0000519 downregulation on NSCLC cell growth and metastasis. H2170 and A549 cells were transfected with anti-NC or anti-miR-1258, and then, the transfected or non-transfected cells were incubated with the exosomes from the H1299 cells transfected with si-NC or si-circ_0000519. (a) miR-1258 expression was detected by qRT-PCR in the transfected cells. (b and c) Cell growth was evaluated via EdU staining and colony formation assays in the treated cells. (d and e) Cell migration and invasion were examined via transwell analysis in the treated cells. (f and g) Cyclin D1, Vimentin and MMP9 abundances were examined via Western blotting in the treated cells. *** P < 0.001.
Figure 7

miR-1258 knockdown attenuates the influence of exosomal circ_0000519 downregulation on NSCLC cell growth and metastasis. H2170 and A549 cells were transfected with anti-NC or anti-miR-1258, and then, the transfected or non-transfected cells were incubated with the exosomes from the H1299 cells transfected with si-NC or si-circ_0000519. (a) miR-1258 expression was detected by qRT-PCR in the transfected cells. (b and c) Cell growth was evaluated via EdU staining and colony formation assays in the treated cells. (d and e) Cell migration and invasion were examined via transwell analysis in the treated cells. (f and g) Cyclin D1, Vimentin and MMP9 abundances were examined via Western blotting in the treated cells. *** P < 0.001.

3.8 RHOV upregulation attenuates the influences of exosomal circ_0000519 downregulation on NSCLC cell growth and metastasis

To analyze if RHOV participated in the exosomal circ_0000519-modulated NSCLC development, H2170 and A549 cells were transfected with pcDNA3.1 or pcDNA3.1-RHOV, and then, the transfected or non-transfected cells were incubated with the exosomes from si-NC or si-circ_0000519-transfected H1299 cells (named as si-NC-exo or si-circ_0000519-exo). The overexpression efficacy of pcDNA3.1-RHOV is confirmed in Figure 8a, which induced a higher level of RHOV. Furthermore, RHOV overexpression attenuated the si-circ_0000519-exo-modulated inhibition of EdU-positive ratio and colony-formation ability (Figure 8b and c). Additionally, RHOV upregulation mitigated the inhibitory effects of exosomal circ_0000519 downregulation on cell migration and invasion (Figure 8d and e). Moreover, RHOV restoration alleviated the decreases of Cyclin D1, Vimentin, and MMP9 levels caused via the addition of si-circ_0000519-exo (Figure 8f and g). These results suggested that the exosomal circ_0000519 downregulation repressed the NSCLC cell growth and metastasis by modulating RHOV.

Figure 8 RHOV overexpression relieved the influence of exosomal circ_0000519 downregulation on NSCLC cell growth and metastasis. H2170 and A549 cells were transfected with pcDNA3.1 or pcDNA3.1-RHOV, and then the transfected or non-transfected cells were incubated with the exosomes from H1299 cells transfected with si-NC or si-circ_0000519. (a) RHOV expression was measured via Western blotting in transfected cells. (b and c) Cell growth was analyzed using EdU staining and colony formation assays in the treated cells. (d and e) Cell migration and invasion were examined by a transwell assay in the treated cells. (f and g) Cyclin D1, Vimentin and MMP9 abundances were determined using Western blotting in the treated cells. *** P < 0.001.
Figure 8

RHOV overexpression relieved the influence of exosomal circ_0000519 downregulation on NSCLC cell growth and metastasis. H2170 and A549 cells were transfected with pcDNA3.1 or pcDNA3.1-RHOV, and then the transfected or non-transfected cells were incubated with the exosomes from H1299 cells transfected with si-NC or si-circ_0000519. (a) RHOV expression was measured via Western blotting in transfected cells. (b and c) Cell growth was analyzed using EdU staining and colony formation assays in the treated cells. (d and e) Cell migration and invasion were examined by a transwell assay in the treated cells. (f and g) Cyclin D1, Vimentin and MMP9 abundances were determined using Western blotting in the treated cells. *** P < 0.001.

3.9 Exosomal circ_0000519 downregulation reduces xenograft tumor growth

To test the role of exosomal circ_0000519, H2170 cells were subcutaneously injected into nude mice to establish the murine xenograft model; after 5 days, the tumors were treated with the exosomes from H1299 cells transfected with sh-NC or sh-circ_0000519 (named sh-NC-exo or sh-circ_0000519-exo). And, the mice were divided into sh-NC-exo and sh-circ_0000519-exo groups (n = 5 per group). As presented in Figure 9a and b, tumor volume and weight were lower in the sh-circ_0000519-exo group than in the sh-NC-exo group. Moreover, the immunohistochemistry results showed that the Ki-67 level was clearly decreased in the sh-circ_0000519-exo group (Figure 9c). Additionally, circ_0000519, miR-1258, and RHOV levels were measured in the tumors. Results showed that circ_0000519 and RHOV levels were markedly decreased, and the miR-1258 level was elevated in the sh-circ_0000519-exo group when compared with the sh-NC-exo group (Figure 9d and e). These data suggested that exosomal circ_0000519 downregulation reduced the NSCLC cell growth in the xenograft model.

Figure 9 Exosomal circ_0000519 regulates xenograft tumor growth. The murine xenograft model was induced by injection of H2170 cells, and tumors were treated with the exosomes from H1299 cells transfected with sh-NC or sh-circ_0000519 (named sh-NC-exo or sh-circ_0000519-exo) after 5 days. (a and b) Tumor volume and weight were examined in each group. n = 5. (c) The Ki-67 level was detected by an immunohistochemistry assay. (d and e) circ_0000519, miR-1258, and RHOV abundances were examined via qRT-PCR and Western blotting in each group. *** P < 0.001.
Figure 9

Exosomal circ_0000519 regulates xenograft tumor growth. The murine xenograft model was induced by injection of H2170 cells, and tumors were treated with the exosomes from H1299 cells transfected with sh-NC or sh-circ_0000519 (named sh-NC-exo or sh-circ_0000519-exo) after 5 days. (a and b) Tumor volume and weight were examined in each group. n = 5. (c) The Ki-67 level was detected by an immunohistochemistry assay. (d and e) circ_0000519, miR-1258, and RHOV abundances were examined via qRT-PCR and Western blotting in each group. *** P < 0.001.

4 Discussion

NSCLC is the most frequent lung cancer with high mortality worldwide [21]. Although the prevention and detection of NSCLC have gained great advances, the majority of the cases are diagnosed with advanced or metastatic diseases with a poor prognosis [22]. Exosomes are important molecular vehicles that are involved in various processes and are associated with the carcinogenesis and therapy of NSCLC [23]. circRNAs are a type of cargoes delivered via exosomes, which have important roles in cell proliferation, apoptosis, metastasis, and resistance in cancers [24]. Moreover, the circRNA/miRNA/mRNA network is an important mechanism addressed by circRNA [11]. In our research, we first confirmed that exosomal circ_0000519 regulated NSCLC growth and metastasis and found that the inner mechanism was related to the miR-1258/RHOV axis.

According to the GSE101123 dataset, Zhao et al. reported that circ_0000519 was upregulated and was likely associated with tumor development and therapy in breast cancer [25]. Moreover, according to the GSE101684 and GSE101586 datasets, Wang et al. found that circ_0000519 was enhanced in NSCLC and regulated the PDL1/PD1 expression [14]. Similarly, we also confirmed that circ_0000519 was elevated in NSCLC tissues and cells, and we first found the oncogenic function of this circRNA in NSCLC by increasing cell growth and metastasis. Furthermore, Wang et al. also showed that circ_0000519 was secreted by exosomes in NSCLC [14]. The tumor-derived exosomes could take part in the NSCLC development [8], such as circRNA ARHGAP10, circRNA MEMO1, and hsa_circ_0002130 [12,13,26]. Here, we found that circ_0000519 secreted by H1299 cells could affect cell growth and metastasis in H2170 and A549 cells, indicating the tumor-derived exosomal circ_0000519 might promote NSCLC development via regulating tumor cell communication.

Given that circ_0000519 was mostly located in the cytoplasm of NSCLC cells, and the circRNA/miRNA/mRNA networks were the main mechanism for circ_0000519 [14]; here, we wanted to explore another network except for the circ_0000519/miR-34a/PDL1 axis. We first confirmed that circ_0000519 could sponge miR-1258 in NSCLC cells. Zhang et al. reported that miR-1258 could repress cell growth, invasion, and epithelial-to-mesenchymal transition by targeting specific protein 1 (SP1) in oral squamous cell carcinoma [27]. Hwang et al. suggested that miR-1258 could inhibit cell proliferation and migration in colorectal cancer by decreasing cyclin-dependent kinase regulatory subunit 1B (CKS1B) [28]. Moreover, miR-1258 was reported to restrain cell proliferation, migration, and invasion in papillary thyroid cancer via regulating transmembrane protease serine 4 (TMPRSS4) [29]. Additionally, miR-1258 could constrain cell proliferation, migration, and invasion, and regulate stem-like cell properties in breast cancer via regulating lysine demethylases 7A (KDM7A) [30]. These all suggested the anti-growth and anti-metastatic roles of miR-1258 in human tumors. More importantly, Jiang et al. reported that miR-1258 was downregulated in NSCLC and inhibited cell proliferation, migration and angiogenesis by targeting GRB2 [18], indicating the inhibitive influences of miR-1258 on the growth and metastasis of NSCLC. In the present work, miR-1258 was lowly expressed in NSCLC tissues and cells and negatively correlated with circ_0000519 in NSCLC tissues. Further, we found that the exosomal circ_0000519 could affect the NSCLC development by modulating miR-1258.

Next, we explored the downstream of miR-1258 and first confirmed that RHOV was targeted by miR-1258. RHOV is an atypical member of Rho GTPases and plays important roles in the cell cycle, cell adhesion, and migration [31]. A previous study showed that RHOV was associated with tumor growth in prostate cancer [32]. Moreover, RHOV was upregulated in NSCLC, and the NSCLC patients with high expression of RHOV had poor outcomes [19,20]. As described by Zhang et al., RHOV could promote lung cancer cell proliferation, migration, and invasion through the JNK/c-Jun pathway [33]. We also found the increased RHOV in NSCLC tissues and cells, which was also consistent with the data from the Gene Expression Profiling Interactive Analysis (GEPIA; http://gepia.cancer-pku.cn/detail.php). Besides, RHOV expression was negatively correlated with miR-1258 expression in NSCLC tissues. Furthermore, we confirmed that the exosomal circ_0000519 could control the NSCLC development by regulating RHOV. Additionally, we confirmed the role of exosomal circ_0000519 in NSCLC in vivo.

In conclusion, the exosomal circ_0000519 downregulation inhibited the cell growth and metastasis in NSCLC, possibly via regulating miR-1258 and RHOV. This research provided a new mechanism for understanding the pathology of NSCLC and identified a new target for the therapy of NSCLC.

tel: +86-0724-2305710

Acknowledgement

Not applicable.

  1. Funding information: No funding was received.

  2. Conflict of interest: The authors declare that they have no competing interests.

  3. Data availability statement: The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.

Appendix

Figure A1 The circular structure of circ_0000519 was identified by Actinomycin D and RNase R treatment assays. **P < 0.01, and ***P < 0.001.
Figure A1

The circular structure of circ_0000519 was identified by Actinomycin D and RNase R treatment assays. **P < 0.01, and ***P < 0.001.

References

[1] Bade BC, Dela Cruz CS. Lung cancer 2020: epidemiology, etiology, and prevention. Clin Chest Med. 2020;41:1–24.10.1016/j.ccm.2019.10.001Suche in Google Scholar PubMed

[2] Herbst RS, Morgensztern D, Boshoff C. The biology and management of non-small cell lung cancer. Nature. 2018;553:446–54.10.1038/nature25183Suche in Google Scholar PubMed

[3] Duma N, Santana-Davila R, Molina JR. Non-small cell lung cancer: epidemiology, screening, diagnosis, and treatment. Mayo Clin Proc. 2019;94:1623–40.10.1016/j.mayocp.2019.01.013Suche in Google Scholar PubMed

[4] Pegtel DM, Gould SJ. Exosomes. Annu Rev Biochem. 2019;88:487–514.10.1146/annurev-biochem-013118-111902Suche in Google Scholar PubMed

[5] Salimi L, Akbari A, Jabbari N, Mojarad B, Vahhabi A, Szafert S, et al. Synergies in exosomes and autophagy pathways for cellular homeostasis and metastasis of tumor cells. Cell Biosci. 2020;10:64.10.1186/s13578-020-00426-ySuche in Google Scholar PubMed PubMed Central

[6] Dai J, Su Y, Zhong S, Cong L, Liu B, Yang J, et al. Exosomes: key players in cancer and potential therapeutic strategy. Signal Transduct Target Ther. 2020;5:145.10.1038/s41392-020-00261-0Suche in Google Scholar PubMed PubMed Central

[7] Zhang Y, Liu Y, Liu H, Tang WH. Exosomes: biogenesis, biologic function and clinical potential. Cell Biosci. 2019;9:19.10.1186/s13578-019-0282-2Suche in Google Scholar PubMed PubMed Central

[8] Zheng H, Zhan Y, Liu S, Lu J, Luo J, Feng J, et al. The roles of tumor-derived exosomes in non-small cell lung cancer and their clinical implications. J Exp Clin Cancer Res. 2018;37:226.10.1186/s13046-018-0901-5Suche in Google Scholar PubMed PubMed Central

[9] Nikfarjam S, Rezaie J, Kashanchi F, Jafari R. Dexosomes as a cell-free vaccine for cancer immunotherapy. J Exp Clin Cancer Res. 2020;39:258.10.1186/s13046-020-01781-xSuche in Google Scholar PubMed PubMed Central

[10] Guo X, Tan W, Wang C. The emerging roles of exosomal circRNAs in diseases. Clin Transl Oncol. 2021;23:1020–33.10.1007/s12094-020-02485-6Suche in Google Scholar PubMed PubMed Central

[11] Cai X, Lin L, Zhang Q, Wu W, Su A. Bioinformatics analysis of the circRNA-miRNA-mRNA network for non-small cell lung cancer. J Int Med Res. 2020;48:300060520929167.10.1177/0300060520929167Suche in Google Scholar PubMed PubMed Central

[12] Fang K, Chen X, Qiu F, Xu J, Xiong H, Zhang Z. Serum-derived exosomes-mediated circular RNA ARHGAP10 modulates the progression of non-small-cell lung cancer through the miR-638/FAM83F axis. Cancer Biother Radiopharm. 2022;37:96–110.10.1089/cbr.2019.3534Suche in Google Scholar PubMed

[13] Ding C, Xi G, Wang G, Cui D, Zhang B, Wang H, et al. Exosomal circ-MEMO1 promotes the progression and aerobic glycolysis of non-small cell lung cancer through targeting miR-101-3p/KRAS axis. Front Genet. 2020;11:962.10.3389/fgene.2020.00962Suche in Google Scholar PubMed PubMed Central

[14] Wang J, Zhao X, Wang Y, Ren F, Sun D, Yan Y, et al. circRNA-002178 act as a ceRNA to promote PDL1/PD1 expression in lung adenocarcinoma. Cell Death Dis. 2020;11:32.10.1038/s41419-020-2230-9Suche in Google Scholar PubMed PubMed Central

[15] Uddin A, Chakraborty S. Role of miRNAs in lung cancer. J Cell Physiol. 2018.10.1002/jcp.26607Suche in Google Scholar PubMed

[16] Ahn YH, Ko YH. Diagnostic and therapeutic implications of micrornas in non-small cell lung cancer. Int J Mol Sci. 2020;21:8782.10.3390/ijms21228782Suche in Google Scholar PubMed PubMed Central

[17] Liu H, Chen X, Gao W, Jiang G. The expression of heparanase and microRNA-1258 in human non-small cell lung cancer. Tumour Biol. 2012;33:1327–34.10.1007/s13277-012-0380-9Suche in Google Scholar PubMed

[18] Jiang W, Wei K, Pan C, Li H, Cao J, Han X, et al. MicroRNA-1258 suppresses tumour progression via GRB2/Ras/Erk pathway in non-small-cell lung cancer. Cell Prolif. 2018;51:e12502.10.1111/cpr.12502Suche in Google Scholar PubMed PubMed Central

[19] Shepelev MV, Korobko IV. The RHOV gene is overexpressed in human non-small cell lung cancer. Cancer Genet. 2013;206:393–7.10.1016/j.cancergen.2013.10.006Suche in Google Scholar PubMed

[20] Zhang Y, Zhang X, Lv X, Zhang M, Gao X, Liu J, et al. Development and validation of a seven-gene signature for predicting the prognosis of lung adenocarcinoma. Biomed Res Int. 2020;2020:1836542.10.1155/2020/1836542Suche in Google Scholar PubMed PubMed Central

[21] Reck M, Rabe KF. Precision diagnosis and treatment for advanced non-small-cell lung cancer. N Engl J Med. 2017;377:849–61.10.1056/NEJMra1703413Suche in Google Scholar PubMed

[22] Balata H, Fong KM, Hendriks LE, Lam S, Ostroff JS, Peled N, et al. Prevention and early detection for NSCLC: advances in thoracic oncology 2018. J Thorac Oncol. 2019;14:1513–27.10.1016/j.jtho.2019.06.011Suche in Google Scholar PubMed

[23] Liu S, Zhan Y, Luo J, Feng J, Lu J, Zheng H, et al. Roles of exosomes in the carcinogenesis and clinical therapy of non-small cell lung cancer. Biomed Pharmacother. 2019;111:338–46.10.1016/j.biopha.2018.12.088Suche in Google Scholar PubMed

[24] Seimiya T, Otsuka M, Iwata T, Shibata C, Tanaka E, Suzuki T, et al. Emerging roles of exosomal circular RNAs in cancer. Front Cell Dev Biol. 2020;8:568366.10.3389/fcell.2020.568366Suche in Google Scholar PubMed PubMed Central

[25] Zhao CH, Qu L, Zhang H, Qu R. Identification of breast cancer-related circRNAs by analysis of microarray and RNA-sequencing data: an observational study. Medicine (Baltimore). 2019;98:e18042.10.1097/MD.0000000000018042Suche in Google Scholar PubMed PubMed Central

[26] Ma J, Qi G, Li L. A novel serum exosomes-based biomarker hsa_circ_0002130 facilitates osimertinib-resistance in non-small cell lung cancer by sponging miR-498. Onco Targets Ther. 2020;13:5293–307.10.2147/OTT.S243214Suche in Google Scholar PubMed PubMed Central

[27] Zhang H, Jiang S, Guo L, Li X. MicroRNA-1258, regulated by c-Myb, inhibits growth and epithelial-to-mesenchymal transition phenotype via targeting SP1 in oral squamous cell carcinoma. J Cell Mol Med. 2019;23:2813–21.10.1111/jcmm.14189Suche in Google Scholar PubMed PubMed Central

[28] Hwang JS, Jeong EJ, Choi J, Lee YJ, Jung E, Kim SK, et al. MicroRNA-1258 inhibits the proliferation and migration of human colorectal cancer cells through suppressing CKS1B expression. Genes (Basel). 2019;10:912.10.3390/genes10110912Suche in Google Scholar PubMed PubMed Central

[29] Wang LJ, Cai HQ. miR-1258: a novel microRNA that controls TMPRSS4 expression is associated with malignant progression of papillary thyroid carcinoma. Endokrynol Pol. 2020;71:146–52.10.5603/EP.a2020.0009Suche in Google Scholar PubMed

[30] Li W, Yang X, Shi C, Zhou Z. Hsa_circ_002178 promotes the growth and migration of breast cancer cells and maintains cancer stem-like cell properties through regulating miR-1258/KDM7A Axis. Cell Transplant. 2020;29:963689720960174.10.1177/0963689720960174Suche in Google Scholar PubMed PubMed Central

[31] Hodge RG, Ridley AJ. Regulation and functions of RhoU and RhoV. Small GTPases. 2020;11:8–15.10.1080/21541248.2017.1362495Suche in Google Scholar PubMed PubMed Central

[32] Peng YB, Zhou J, Gao Y, Li YH, Wang H, Zhang M, et al. Normal prostate-derived stromal cells stimulate prostate cancer development. Cancer Sci. 2011;102:1630–5.10.1111/j.1349-7006.2011.02008.xSuche in Google Scholar PubMed

[33] Zhang D, Jiang Q, Ge X, Shi Y, Ye T, Mi Y, et al. RHOV promotes lung adenocarcinoma cell growth and metastasis through JNK/c-Jun pathway. Int J Biol Sci. 2021;17:2622–32.10.7150/ijbs.59939Suche in Google Scholar PubMed PubMed Central

Received: 2021-09-12
Revised: 2021-12-07
Accepted: 2022-01-03
Published Online: 2022-04-28

© 2022 Rui Wang et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0428
Schlagwörter für diesen Artikel
non-small cell lung cancer; exosome; hsa_circ_0000519; miR-1258; RHOV
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 9.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0428/html
Button zum nach oben scrollen