Home β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
Article Open Access

β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis

  • Xiaochun Yang , Xuegang Liang , Haohui Guo , Long Ma , Li Jian , Xin Zhao , Jian Wang , Lvlin Yang , Zhiqiang Meng and Qunhua Jin EMAIL logo
Published/Copyright: June 7, 2022
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 17 Issue 1

Abstract

An important causative factor in osteoarthritis (OA) is the abnormal mechanical stress-induced bone remodeling of the subchondral bone. β2-adrenergic receptor (Adrb2) plays a major role in mechanical stresses that induce bone remodeling. The medial tibial plateau (MTP) and lateral tibial plateau (LTP) of patients with varus Knee osteoarthritis (KO) bear different mechanical stresses. The present study aimed to investigate the expression of Adrb2 in medial tibial plateau subchondral bone (MTPSB) and lateral tibial plateau subchondral bone (LTPSB) in patients with varus KO. A total of 30 tibial plateau samples from patients undergoing total knee arthroplasty for varus KO and MTPSB and LTPSB were studied. Statistical analysis was performed using paired sample t-tests. Safranin O-Fast Green staining and Micro-computed tomography showed significant differences in the bone structure between MTPSB and LTPSB. Tartrate-resistant acid phosphatase (TRAP)-positive cell density in MTPSB was higher than that in LTPSB. Immunohistochemistry, reverse transcription-quantitative polymerase chain reaction, and Western blot analysis revealed that compared to LTPSB, the levels of Adrb2, tyrosine hydroxylase (TH), and osteocalcin increased significantly in MTPSB. Double-labeling immunofluorescence showed Adrb2 was present in the majority of TRAP-positive multinuclear cells of the MTPSB. The expression of Adrb2 and TH was significantly higher in MTPSB than in LTPSB, confirming the involvement of these molecules in the development of OA.

Keywords: osteoarthritis; β2-adrenergic receptor; mechanical stresses; subchondral bone; bone remodeling

1 Introduction

Osteoarthritis (OA) is the most common degenerative joint disease, affecting about 250 million people worldwide. It mainly affects weight-bearing joints, such as knee and hip, and is characterized by progressive cartilage degeneration and subchondral bone changes [1]. Abnormal subchondral bone remodeling plays a major role in the pathogenesis of OA. Subchondral bone is the mechanical support for articular cartilage and undergoes bone resorption and remodeling in response to changes in mechanical stresses [2].

Mammalian bones exhibit a sympathetic nervous system (SNS) that is regulated by autonomic and sensory nerves in response to mechanical stresses [3,4]. During normal bone remodeling, sympathetic nerves effectuate via catecholamine, a critical sympathetic nerve neurotransmitter norepinephrine that activates the β2-adrenergic receptor (Adrb2), which in turn inhibits osteoblast proliferation and differentiation and promotes osteoclast precursor maturation and bone resorption activity. In this process, tyrosine hydroxylase (TH) acts as the rate-limiting enzyme for norepinephrine biosynthesis [5,6]. In the orthodontic tooth movement (OTM), mechanical stresses induced Adrb2 activation in alveolar bone remodeling [7]. Sympathetic nerve fibers are detected in the subchondral bone of OA and in a rat temporomandibular experimental OA model [8]. Adrb2 antagonists inhibit subchondral bone loss and osteoclast activity, while Adrb2 agonists aggravate these reactions, and Adrb2 plays a critical role in mechanical stress-induced bone remodeling [9].

When normal walking on a healthy knee, the medial compartment experiences 60–80% weight bearing, and the lesions in the medial compartment of the knee are common due to significant stress and knee adductive torque during weight-bearing activities [10,11]. In the early stage of knee osteoarthritis (KO), mechanical stresses cause changes in the subchondral bone, and the progression of OA increases the varus deformity of the knee [12,13]. This phenomenon increases the mechanical stresses through the medial compartment, further aggravating the degree of OA and varus deformity [14]. However, the expression of Adrb2 in the subchondral bone of human KO has not yet been reported.

The present study selected the same patients with KO varus deformity of the medial tibial plateau (MTP) and the lateral tibia plateau (LTP) and conducted a paired comparison of the subchondral bone structure change to assess the differences in Adrb2 expression. Also, Adrb2 with KO was investigated with respect to the underlying mechanism to provide a reference for the treatment of KO.

2 Materials and methods

2.1 Sample collection

Specimens of the tibial plateau were obtained from patients with primary varus deformity KO who underwent total knee arthroplasty in the Department of Orthopedics, Ningxia Medical University General Hospital, Yinchuan, China, from 2019 to 2020. The cohort consisted of 30 cases, including 12 males and 18 females, aged 62–78 (mean age, 66.77 ± 3.48 years) years. The diagnosis of OA was based on the criteria of the American College of Rheumatology [15]. The patients with OA secondary to other diseases, such as trauma and connective tissue disease, were excluded and had no history of β-adrenergic receptor agonist and antagonist drug intake. The preoperative knee X-ray was taken. The measured varus angle was 12.0–25.5° (average: 17.6°). Most of the lesions occurred in the medial compartment (Figure 1a). The severity of OA knee was assessed using Kellgren–Lawrence (K–L) scale (1–4) on weight-bearing radiographs [16]. Of 30 knees, 12 knees were K–L grade 3 and 18 knees were K–L grade 4.

Figure 1 Radiographic, macroscopic observations and histological evaluation of the MTP and LTP. (a) Conventional long-leg radiograph: After standing, the mechanical shaft moves inward, and the stress concentrates on the inside of the knee joint; local magnification of the X-ray film showed that the medial joint space was significantly smaller than the lateral joint space, and the local osteosclerosis on the medial side of the joint was significantly greater than that on the lateral side. (b) Intraoperative gross pathological images: knee medial tibial plateau than the lateral cartilage defect is severe, and some bone is exposed, corresponding to the medial femoral condyle the same performance. The cartilage of the lateral femoral condyle of the knee joint is relatively complete with good gloss. (c) Safranin O/Fast Green staining. (d) OARSI score. Statistical analysis results: The difference between the MTP and LTP groups was statistically significant. Magnification ×50, scale bar 500 µm; magnification ×200, scale bar 100 µm; **** P < 0.0001.
Figure 1

Radiographic, macroscopic observations and histological evaluation of the MTP and LTP. (a) Conventional long-leg radiograph: After standing, the mechanical shaft moves inward, and the stress concentrates on the inside of the knee joint; local magnification of the X-ray film showed that the medial joint space was significantly smaller than the lateral joint space, and the local osteosclerosis on the medial side of the joint was significantly greater than that on the lateral side. (b) Intraoperative gross pathological images: knee medial tibial plateau than the lateral cartilage defect is severe, and some bone is exposed, corresponding to the medial femoral condyle the same performance. The cartilage of the lateral femoral condyle of the knee joint is relatively complete with good gloss. (c) Safranin O/Fast Green staining. (d) OARSI score. Statistical analysis results: The difference between the MTP and LTP groups was statistically significant. Magnification ×50, scale bar 500 µm; magnification ×200, scale bar 100 µm; **** P < 0.0001.

  1. Ethical approval and informed consent: This study was approved by the Ethics Committee of Ningxia Medical University General Hospital (No. 2020-985), and informed consent was obtained from each patient prior to inclusion in the study.

2.2 Sample processing

The tibial plateau material was obtained during surgery and placed on a clean table. Then, the bone and cartilage in the central bearing area of the MTP (n = 30) and LTP (n = 30) samples from each patient were selected and trimmed into blocks (2.0 cm3 × 2.0 cm3 × 1.0 cm3). The coronal sections were used to divide the bone and cartilage into two parts randomly. The part of the samples that contained cartilage and subchondral bone was immobilized in 4% paraformaldehyde for 48 h. After micro-computed tomography (CT) analysis, the samples were decalcified with 10% ethylenediaminetetraacetic acid at room temperature for 3 weeks and embedded in paraffin. Safranin O-fast green staining, tartrate-resistant acid phosphatase (TRAP) staining, immunohistochemistry, and immunofluorescence were performed in 4-µm-thick discontinuous sections. The other part removes cartilage, and the subchondral bone was wrapped in foil and stored at −80°C to measure the mRNA and protein levels subsequently.

2.3 Safranin O-fast green staining

The processes were described previously [17]. The sections were stained with hematoxylin (ZLI-9610, ZSGB-Bio, Beijing, China) for 3–5 min and washed with tap water for 10 min. The specimens were dyed with 0.3% solid green (F8130, Solarbio, Beijing, China) for 5 min and quickly washed with the weak acid solution for 10–15 s to remove the residual solid green. The slices were added into 1% Safranin staining solution (S8020, Solarbio, Beijing, China), soaked for 5 min, then rinsed three times with distilled water for 5 min, and dehydrated with 95% ethanol and absolute ethanol. Xylene was transparent and sealed with optical resin. The samples were examined using a microscope. The Image-Pro Plus 6.0 image analysis software (Media Cybernetics, Bethesda, MD, USA) was employed to assess the structural parameters of the cartilage and subchondral bone deduced with morphometric methods. The parameters included total articular cartilage (TAC; the perpendicular distance between the cartilage surface and cement line), subchondral bone plate (SCP) thickness (the distance from the cement line to the interface between the SCP and trabecular bone), and trabecular bone area/total area (BA/TA), which are calculated as follows: (trabecular bone area in the region of measurement)/(trabecular bone area + marrow cavity area) × 100.

Each section was evaluated using the Osteoarthritis Research Society International (OARSI) score [18]. The final score was based on the Safranin O/fast green staining results and the OARSI scoring items. The OARIS score was obtained by multiplying the histological grading of cartilage degeneration (in six grades) by the histological staging of cartilage degeneration (in five stages) following Safranin O/fast green staining.

2.4 TRAP staining

The paraffin slices were immersed in xylene for 5 min each to remove paraffin and then re-hydrated in an alcohol series and distilled water for 5 min. Tissue sections were pre-incubated at 37°C for 20 min in TRAP buffer (0.1 M acetate buffer pH 5.0 and 50 mM sodium tartrate). The enzyme reactivity was visualized by incubating the sections in TRAP buffer containing 0.1 mg/mL naphthol AS-MX (N-4875, Sigma, USA) and 0.3 mg/mL fast red violet LB salt (F-3381, Sigma, USA) at 37°C for 1 h. The stained sections were rinsed in phosphate-buffered saline (PBS) and counterstained with hematoxylin (ZLI-9610, ZSGB-Bio, Beijing, China). The slices were dehydrated by placing them in 70, 80, 90, and 100% alcohol and xylene for 1 min each, then sealed with neutral glue, and covered with a coverslip. TRAP-positive osteoclasts were counted within 400 µm of the cement line in the osteochondral junction and divided by the length of the subchondral bone to provide an osteoclast density expressed as TRAP-positive cells per mm2 [19]. One dark purplish or reddish cell with ≥3 nuclei was counted as one osteoclast.

2.5 Micro-CT evaluation

The LTP and MTP samples were observed under a micro-CT scanner (SkyScan 1076, Bruker, Kontich, Belgium) with the following scanning parameters: 18 μm isotropic voxel size, 55 kV voltage, 109 μA current, 200 ms integration time, and 4,000 projections. The microstructure of the subchondral plate and trabecular bone was visible in the two-dimensional (2D) reconstructed images that were converted into discrete binary objects by the global thresholding and binarization procedures combined with image filtering such as despeckling to remove noise. Subsequently, the data were processed for three-dimensional (3D) measurement in SkyScan CTAn software. The surface-rendered 3D models were created for visualization using the SkyScan CTVol software [20]. For subchondral trabecular bone, a cubic region of interest of 10 mm3 × 10 mm3 × 2 mm3 was selected, and the parameters such as bone volume/total volume (BV/TV), bone mineral density (BMD), trabecular thickness/number/separation (Tb.Th, Tb.N, Tb.Sp), and structure model index (SMI) were calculated.

2.6 Immunohistochemistry staining

The paraffin sections were incubated at 65°C overnight, dewaxed by xylene, and rehydrated, followed by antigen retrieval with 0.1% trypsin for 20 min at 37°C. Subsequently, the sections were incubated with 3% hydrogen peroxide (H2O2) for 10 min to remove endogenous peroxidase and blocked with Goat serum for 20 min at 37°C. Next, the slides were incubated with primary antibodies, including rabbit anti-Adrb2 (13096-1, 1:300, Proteintech, Wuhan, China), rabbit anti-TH (25859-1-AP, 1:500, Proteintech, Wuhan, China), and rabbit anti-osteocalcin (OCN; 23418-1-AP, 1:300, Proteintech, Wuhan, China) overnight at 4°C. The following day, the sections were treated with horseradish peroxidase-conjugated streptavidin detection system (PV-9001, ZSGB-Bio, Beijing, China) to detect the immunoreactivity. The sections were visualized using 3,3′-diaminobenzidine (ZLI-9018, ZSGB-Bio, Beijing, China), while hematoxylin (ZLI-9610, ZSGB-Bio, Beijing, China) was used for counterstaining. Routine dehydration and mounting were performed. After image capture, the number of positively stained cells was quantified using Image-Pro Plus 6.0 (Media Cybernetics, Inc.) as described previously [21,22]. Then, the histological score was calculated as the average optical density of positively stained cells, which equals the ratio of the overall optical density of the positive cells to the positive area. Positive cells are those with clear brownish-yellow granules in the cytoplasm or nucleus.

2.7 Immunofluorescence

The procedure for the first day of the immunofluorescence protocol was the same as that used for immunohistochemistry (described above). The following day, the sections were incubated with goat anti-rabbit IgG-TRITC-conjugated secondary antibody (SA00007-2, 1:500, Proteintech, Wuhan, China) for 1 h at 37°C in the dark. To identify the cell morphology of the nuclei, the sections were counterstained with 4′6-diamidino-2-phenylindole (DAPI; Solarbio, Beijing, China) for 3 min followed by PBS washes.

For double-labeling immunofluorescence, primary antibodies of Adrb2 were used as described earlier. To detect osteoclast cell in the tibial plateau subchondral bone, anti-TRAP antibody (D-3) (1:300, sc-376875, Santa Cruz, Texas, USA) was used as a primary antibody. The mixture of rabbit anti-Adrb2 antibody and mouse anti-TRAP antibody was incubated overnight at 4°C, washed in PBS, and incubated with goat anti-rabbit IgG-TRITC-conjugated secondary antibody (SA00007-2, 1:500, Proteintech, Wuhan, China) and goat anti-mouse IgG-fluorescein isothiocyanate (FITC)-conjugated secondary antibody (SA00003-1, 1:500, Proteintech, Wuhan, China) for 1 h at 37°C in the dark. The sections were then incubated with DAPI and then stimulated under a fluorescent microscope.

All sections were mounted in a fluorescence microscope (DM4B, Leica Microsystems GmbH) for examination. For immunofluorescence analysis, in a place with high light intensity, under a 200× magnification, the optical density value was analyzed under the same area and was equal to the ratio of the overall optical density to the area.

2.8 Western blot analysis

From each patient, samples of the subchondral bone MTP and LTP were analyzed by Western blot to determine the protein levels. Briefly, the subchondral bone specimen was defrosted, weighed, and ground in liquid nitrogen, and the tissue was homogenized in cold RIPA lysis buffer (P0013B, Beyotime Biotechnology, Nantong, Jiangsu, China). The total protein sample kit (KGP250, KeyGen Biotech, Nanjing, China) was utilized according to the manufacturer’s instructions, and the protein concentration was determined by the bicinchoninic acid method. An equivalent amount of protein was separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (PG112, EpiZyme, Shanghai, China) and transferred to the polyvinylidene fluoride membrane (ISEQ00010, Millipore, Billerica, MA, USA). Then, the membrane was blocked with 5% skim milk for 1 h at room temperature and probed with rabbit polyclonal antibodies raised against Adrb2 (13096-1, 1:500, Proteintech, Wuhan, China), TH (25859-1-AP, 1:500, Proteintech, Wuhan, China), OCN (23418-1-AP, 1:500, Proteintech, Wuhan, China), or GAPDH (10494-1-AP, 1:2,000, Proteintech, Wuhan, China) overnight at 4°C. Subsequently, the membrane was incubated with horseradish peroxidase goat anti-rabbit IgG (ZB-2301, 1:2,000, ZSGB-Bio, Beijing, China) at room temperature for 1 h.

The immunoreactive bands were visualized by electrochemiluminescence on an ALS4000 gel image analysis system (GE Healthcare Life Sciences, Logan, UT, USA). Image J software (NIH, Bethesda, MD, USA) was used to quantify the protein band signal intensity and expressed as arbitrary units (a.u). The optical density was normalized to that of GAPDH to calculate the levels of the target protein.

2.9 Reverse transcription-quantitative PCR

The medial and lateral samples of subchondral bone were taken from the tibial plateau of each patient to evaluate the mRNA levels of the target genes. Briefly, the subchondral bone samples were thawed, weighed, and homogenized in liquid nitrogen. Subsequently, total RNA was extracted from the tissues using the RNA pure tissue kit (G3640, Wuhan Servicebio Technology, Wuhan, China), according to the manufacturer’s instructions. Total RNA amount and purity were determined by UV spectrophotometry. The primers for Adrb2, TH, and OCN were designed and synthesized by Servicebio Biotech (Table 1). Total RNA was reverse transcribed into cDNA using the RT First Strand cDNA Synthesis kit (G3331, Wuhan Servicebio Technology, Wuhan, China), according to the manufacturer’s instructions. A 25 µL quantitative polymerase chain reaction (qPCR) kit consisted of cDNA (0.5 µL), SYBR Green qPCR Master Mix (G3320, Wuhan Servicebio Technology, Wuhan, China) (12.5 µL), forward and reverse primers (0.5 µL each), and diethylpyrocarbonate-treated water (11 µL). The amplification was carried out at 50°C (20 min), 95°C (10 min), and 40 cycles at 95°C (15 s) and 60°C (60 s). Then, the mRNA level was calculated using the cycle threshold method (2−ΔΔCt) and normalized against that of GAPDH that was used as an internal control.

Table 1

Primer sequences used in RT-qPCR

Gene Accession no. T m (°C) Product size (bp) Forward Reverse
ADRB2 NM_000024.6 60 169 GGGTCTTTCAGGAGGCCAAA ATGCCTAACGTCTTGAGGGC
TH NM_000360.3 60 167 GACCCTGACCTGGACTTGGA AGCGTGGTGTAGACCTCCTTCC
OCN NM_199173.4 60 110 GGCGCTACCTGTATCAATGG GTGGTCAGCCAACTCGTCA
GAPDH NM_000360.3 60 168 GGAAGCTTGTCATCAATGGAAATC TGATGACCCTTTTGGCTCCC

T m, annealing temperature; Adrb2, β2-adrenergic receptors; TH, tyrosine hydroxylase; OCN, osteocalcin.

2.10 Statistical analysis

Statistical analysis was performed using SPSS version 20.0 software (IBM, Chicago, IL, USA). Graphs were drawn using GraphPad Prism version 8.0 software (GraphPad Software Inc., San Diego, USA). The data were presented as mean  ±  SD. The clinical, micro-CT, histology, and immunohistochemistry data were tested for normality using the Shapiro-Wilk Test. Paired sample t-test was used to compare the measurements. P < 0.05 was considered statistically significant.

3 Results

3.1 Macroscopic observations

The degeneration of MTP cartilage was more severe than that of LTP cartilage in all specimens. The surface of the MTP cartilage was rough, dull, and grayish-yellow, with extensive softening foci, huge fissures, exposed ivory-like subchondral bone covered by pannus tissue, and multiple osteophytes in the center and edge of the plateau. The surface of the LTP cartilage was flat and locally shiny, with scattered superficial ulcers and softening foci, rare fissure formation, no cartilage loss in the whole layer, no pannus tissue formation, and marginal osteophytes in some specimens (Figure 1b).

3.2 Histological assessment

Cartilage damage was investigated by performing Safranin O/fast green staining. The results revealed no notable damage and mild damage in the LTP and severe damage in the MTP. In the MTP, some of the subchondral bone was no longer covered by cartilage, and the subchondral bone was completely exposed. Compared to the MTP, the subchondral trabecular bone of the LTP had thinner and smaller, the chondrocytes of the LTP were relatively normal in size and shape, and the cartilage matrix was stained uniformly. In the MTP sample, the ivory-like subchondral bone, the chondrocytes were abnormal in morphology, swollen, and reduced in number. The cartilage matrix was not stained. Some samples displayed cartilaginous deposits (triangle) among trabecular bones (Figure 1c). Cartilage damage was evaluated using the OARSI score (Table 2). The OARSI scores in the MTP were higher than that in the LTP. The analysis showed that there were statistically significant differences in OARSI score among groups (P < 0.0001) (Figure 1c). The TAC thickness of the MTP subchondral bone was significantly lower than that of the LTP, while BA/TA and SCP thickness were significantly higher than those of the LTP subchondral bone (P < 0.0001) (Table 2).

Table 2

Structural parameters of the cartilage and subchondral bone of the medial tibial plateau and the lateral tibial plateau of the knee joint were evaluated by Safranin O/Fast Green staining (mean ± SD)

Groups OARSI score BA/TA (%) TAC (µm) SCP (µm)
LTP 9.97 ± 3.19 22.42 ± 3.33 2277.69 ± 236.72 212.72 ± 33.81
MTP 21.73 ± 2.56 49.46 ± 3.06 148.38 ± 26.55 1268.78 ± 171.04
Statistic P < 0.0001 P < 0.0001 P < 0.0001 P < 0.0001

OARSI, osteoarthritis research society international; TAC, total articular cartilage; SCP, subchondral bone plate; BA/TA, trabecular bone area/total area; MTP, medial tibial plateau; LTP, medial tibial plateau.

3.3 Micro-CT evaluation

The micro-CT 2D images revealed that the MTP subchondral bone had increased bone mass and reduced porosity compared to the LTP subchondral bone. The micro-CT 3D images show significant thickening of the SCP in the MTP compared to the LTP (Figure 2a). The measurement of bone structural parameters showed that BV/TV, Tb.N, and Tb.Th of the medial subchondral bone were significantly increased compared to those of the LTP subchondral bone, while SMI and Tb.SP were significantly decreased (P < 0.0001; Figure 2b and c).

Figure 2 Micro-CT evaluation of the MTP and LTP of subchondral bone. (a) 2D and 3D micro-CT images. (b and c) Quantitative micro-CT analysis of tibial subchondral bone of bone volume fraction (BV/TV), bone mineral density (BMD), trabecular thickness/number/separation (Tb.Th, Tb.N, Tb.Sp), and structure model index (SMI). The difference between the MTP and LTP groups was statistically significant. **** P < 0.0001.
Figure 2

Micro-CT evaluation of the MTP and LTP of subchondral bone. (a) 2D and 3D micro-CT images. (b and c) Quantitative micro-CT analysis of tibial subchondral bone of bone volume fraction (BV/TV), bone mineral density (BMD), trabecular thickness/number/separation (Tb.Th, Tb.N, Tb.Sp), and structure model index (SMI). The difference between the MTP and LTP groups was statistically significant. **** P < 0.0001.

3.4 TRAP staining

TRAP-positive multinucleated osteoclasts are observed at the bone surface of the subchondral bone (Figure 3). In the MTP, subchondral bone TRAP-positive cells were widely distributed (Figure 3a), mainly distributed in the subchondral bone resorption pit region (Figure 3b). In the lateral tibia platform, subchondral bone TRAP-positive cells were rarely distributed (Figure 3a), mainly distributed in the junction between cartilage and subchondral bone (Figure 3b). The density of osteoclasts in the subchondral bone in the MTP was significantly higher than in the LTP (P < 0.0001; Figure 3c).

Figure 3 Comparison of TRAP-positive osteoclasts in the subchondral bone of LTP and MTP. (a) A large number of TRAP-positive cells were distributed in the MTP subchondral bone. In the LTP subchondral bone, TRAP-positive cells were rarely distributed. (b) TRAP-positive cells mainly distributed in the MTP subchondral bone absorption pit region. TRAP-positive cells mainly distributed at the junction of cartilage and subchondral bone in the LTP. (c) TRAP-positive osteoclasts were significantly higher with MTP compared to LTP. (a) Magnification ×100, scale bar 200 µm; (b) magnification × 200, scale bar 100 µm; **** P < 0.0001.
Figure 3

Comparison of TRAP-positive osteoclasts in the subchondral bone of LTP and MTP. (a) A large number of TRAP-positive cells were distributed in the MTP subchondral bone. In the LTP subchondral bone, TRAP-positive cells were rarely distributed. (b) TRAP-positive cells mainly distributed in the MTP subchondral bone absorption pit region. TRAP-positive cells mainly distributed at the junction of cartilage and subchondral bone in the LTP. (c) TRAP-positive osteoclasts were significantly higher with MTP compared to LTP. (a) Magnification ×100, scale bar 200 µm; (b) magnification × 200, scale bar 100 µm; **** P < 0.0001.

3.5 Adrb2, OCN, and TH levels detected by immunohistochemistry

Adrb2 is expressed in both osteoblasts and osteoclasts, but mainly in the cell membrane. The MTP subchondral bone Adrb2-positive cells are multinucleated clusters, primarily distributed in the trabecular bone edge and the subchondral bone resorption pits. The LTP subchondral bone Adrb2-positive cells constitute the distribution channel in bone cartilage and subchondral bone edge (Figure 4a). The MTP subchondral bone Adrb2-positive cell density was significantly higher than that of the LTP subchondral bone (P < 0.0001; Figure 4d). The TH-positive cells were also partially expressed in cartilage, but mainly distributed in the subchondral bone resorption pits and bone marrow cavities (Figure 4b). The MTP subchondral bone density was significantly higher than TH-positive cells in the LTP subchondral bone (P < 0.001; Figure 4d). OCN is mainly expressed in the cell membrane and intercellular space of osteoblasts, with a scattered gritty distribution (Figure 4c). The LTP subchondral bone OCN-positive cell density was significantly lower than that of the MTP subchondral bone (P < 0.0001; Figure 4d).

Figure 4 Immunohistochemistry analysis of Adrb2, TH and OCN expression in subchondral bone of LTP and MTP (a–c) Representative images of Adrb2, TH, and OCN expression in the subchondral bone of LTP and MTP. (d) Bar graphs show semiquantitative evaluation of Adrb2, TH, and OCN immunohistochemistry. Magnification ×200, scale bar 100 µm; *** P < 0.001, **** P < 0.0001.
Figure 4

Immunohistochemistry analysis of Adrb2, TH and OCN expression in subchondral bone of LTP and MTP (a–c) Representative images of Adrb2, TH, and OCN expression in the subchondral bone of LTP and MTP. (d) Bar graphs show semiquantitative evaluation of Adrb2, TH, and OCN immunohistochemistry. Magnification ×200, scale bar 100 µm; *** P < 0.001, **** P < 0.0001.

3.6 Adrb2, OCN, and TH levels detected by immunofluorescence

Immunofluorescence staining was performed using TRITC, which is excited at 550 nm and emits red light, and then images of the samples were captured using a 40X fluorescence microscope. The results of Adrb2 (Figure 5a), TH (Figure 5b), and OCN (Figure 5c) expression were observed and statistically analyzed (Figure 5d). The differences in Adrb2, TH, and OCN expression were statistically significant between the MTP subchondral bone and LTP subchondral bone by analyzing the mean optical density (P < 0.0001, P < 0.001, and P < 0.0001, respectively).

Figure 5 Immunofluorescence analysis of Adrb2, TH, and OCN expression in subchondral bone of LTP and MTP. (a) In the subchondral bone of MTP, Adrb2 (red) is mainly expressed on the cell membrane of multinucleated cells. In the subchondral bone of LTP, Adrb2 was mainly expressed on the membrane of multinucleated cells at the edge of the subchondral bone. (b) TH (red) is mainly distributed in the edge of the subchondral bone and the bone marrow cavity. (c) OCN (red) is distributed on the edge of the subchondral bone and is mainly expressed in the cell membrane and intercellular space of osteoblasts, presenting granular distribution. Nuclei were stained with DAPI (blue). (d) Bar graphs show semiquantitative evaluation of Adrb2, TH, and OCN immunofluorescence. Magnification × 200, scale bar 50 µm; magnification ×400, scale bar 20 µm; *** P < 0.001, **** P < 0.0001.
Figure 5

Immunofluorescence analysis of Adrb2, TH, and OCN expression in subchondral bone of LTP and MTP. (a) In the subchondral bone of MTP, Adrb2 (red) is mainly expressed on the cell membrane of multinucleated cells. In the subchondral bone of LTP, Adrb2 was mainly expressed on the membrane of multinucleated cells at the edge of the subchondral bone. (b) TH (red) is mainly distributed in the edge of the subchondral bone and the bone marrow cavity. (c) OCN (red) is distributed on the edge of the subchondral bone and is mainly expressed in the cell membrane and intercellular space of osteoblasts, presenting granular distribution. Nuclei were stained with DAPI (blue). (d) Bar graphs show semiquantitative evaluation of Adrb2, TH, and OCN immunofluorescence. Magnification × 200, scale bar 50 µm; magnification ×400, scale bar 20 µm; *** P < 0.001, **** P < 0.0001.

3.7 Evaluation of Adrb2 and TRAP co-expression by double-labeling immunofluorescence

To further observe Adrb2 and TRAP co-expression levels in osteoclasts from the subchondral bone, double-labeling immunofluorescence staining was used. In the double-labeling immunofluorescence staining, TRAP expression was performed using FITC, which is excited at 500 nm and emits green light, while Adrb2 expression was the same as before, and then images of the samples were captured using a 40X fluorescence microscope. Adrb2 and TRAP were detected in both MTP and LTP subchondral bones. Double-labeling immunofluorescence showed that Adrb2 was present in the majority of TRAP-positive multinuclear cells of the MTP subchondral bone (Figure 6a). By analyzing the mean optical density, the difference in Adrb2 and TRAP co-expression was statistically significant between MTP and LTP subchondral bone (P < 0.0001; Figure 6b).

Figure 6 Immunofluorescence double-labeling staining analysis of Adrb2 and TRAP co-expression in subchondral bone of LTP and MTP. (a) Distribution of Adrb2 and TRAP in the subchondral bone of LTP and MTP. Double immunofluorescence of Adrb2 (red)/TRAP (green) labeled multinucleated cells. Nuclei were stained with DAPI (blue). (b) Bar graphs show semiquantitative evaluation of Adrb2 and TRAP co-expression immunofluorescence. Magnification ×400, scale bar 20 µm; **** P < 0.0001.
Figure 6

Immunofluorescence double-labeling staining analysis of Adrb2 and TRAP co-expression in subchondral bone of LTP and MTP. (a) Distribution of Adrb2 and TRAP in the subchondral bone of LTP and MTP. Double immunofluorescence of Adrb2 (red)/TRAP (green) labeled multinucleated cells. Nuclei were stained with DAPI (blue). (b) Bar graphs show semiquantitative evaluation of Adrb2 and TRAP co-expression immunofluorescence. Magnification ×400, scale bar 20 µm; **** P < 0.0001.

3.8 Adrb2, OCN, and TH protein levels in subchondral bone determined by Western blot analysis

Western blot results showed the protein levels of Adrb2, OCN, and TH in subchondral bone of MTP and LTP by the gray scale of the bands (Figure 7a). The densities of the bands were numerically quantified and compared. Compared to the values obtained from the LTP subchondral bone samples, the protein levels of Adrb2, OCN, and TH of the MTP subchondral bone samples increased (P < 0.0001; Figure 7b).

Figure 7 The expression levels of Adrb2, TH, and OCN in the subchondral bone of MTP and LTP. (a) Representative Western blots showing the expression of Adrb2, TH, and OCN. (b) Relative expression of Adrb2, TH, and OCN protein levels in the subchondral bone of MTP and LTP of knee osteoarthritis. GAPDH was used for normalization. (c) Semiquantitative reverse transcription PCR analysis of Adrb2, TH, and OCN in MTP and LTP subchondral bone in knee osteoarthritis. *** P < 0.001, **** P < 0.0001.
Figure 7

The expression levels of Adrb2, TH, and OCN in the subchondral bone of MTP and LTP. (a) Representative Western blots showing the expression of Adrb2, TH, and OCN. (b) Relative expression of Adrb2, TH, and OCN protein levels in the subchondral bone of MTP and LTP of knee osteoarthritis. GAPDH was used for normalization. (c) Semiquantitative reverse transcription PCR analysis of Adrb2, TH, and OCN in MTP and LTP subchondral bone in knee osteoarthritis. *** P < 0.001, **** P < 0.0001.

3.9 Adrb2, OCN, and TH mRNA levels in subchondral bone

Compared to the expression obtained from the LTP subchondral bone samples, the mRNA levels of Adrb2, OCN, and TH of the MTP subchondral bone samples increased (P < 0.0001, P < 0.001, and P < 0.0001, respectively; Figure 7c).

4 Discussion

In this study, we investigated changes in subchondral bone remodeling, microstructure, and their association with cartilage degradation in KO varus deformity patients. We found that MTP had abnormal bone remodeling and microstructural deterioration and cartilage severe damage. In addition, the level of OCN in the MTP subchondral bone was higher than that in the LTP, which was consistent with the positive correlation between increased subchondral osteogenesis and the progression of OA reported previously [23]. The results of micro-CT also showed significant differences in the bone structure between medial and lateral subchondral bone, which was consistent with the results of the study by Finnilä et al. [24]. These findings indicated that the severe the OA, the obvious the degree of subchondral bone hyperplasia and osteosclerosis.

In this study, we selected the tibial plateau with varus deformity of KO and found that the mechanical stresses of the MTP were higher than that of the LTP, and the lower limb mechanical stresses and mechanical axis of the lower limb were correlated with the local BMD [25]. The adduction moment of the knee is a major determinant of medial to lateral load distribution and also the cause of the biomechanical abnormality of KO in the medial compartment [11,26]. Intriguingly, lower limb dynamic load and tibial KO disease severity have been reported, and adduction torque increase might affect the medial tibial platform structure of OA and cause varus deformity [27]. Varus alignment increases the risk of progression of medial ventricular OA in KO [28]. The knee adductive moment reflects the dynamic load in the medial joint compartment and predicts the progression of radiographic OA [27,29]. Therefore, for patients with varus deformity of KO, medial OA is severe than lateral OA because the mechanical loading on the MTP is greater than that on LTP.

The SNS distributed in the periosteum, bone trabecula, bone marrow, and subchondral bone strongly affects bone remodeling [5,30]. In this study, we detected TH through testing the subchondral bone in MTP and LTP and illustrated that the sympathetic nerve is involved in the subchondral bone of bone remodeling. The previous animal model studies have shown that SNS suppresses bone formation by activating Adrb2 on osteoblasts, directly or indirectly accelerates osteoclast generation, and promotes bone loss [7,9]. The present study demonstrated Adrb2 in the human KO subchondral bone, and as far as we know, it was also the first report. To avoid differences in the results due to individual factors (such as hormone levels, weight, age, and occupation), we took the same knee joint on the medial and lateral sides of the tibial plateau for a paired comparison study. Interestingly, the expression of Adrb2 in the MTP subchondral bone with high bone mass, and obviously, osteosclerosis was higher than that in LTP and was mainly distributed in the subchondral bone absorption socket.

It has been reported that Adrb2 was expressed in both osteoblasts and osteoclasts [31]. To determine whether Adrb2 expression originated in osteoclasts, immunofluorescence and TRAP staining were performed. Immunofluorescence showed that Adrb2 was mainly expressed in multinucleated osteoclasts. TRAP staining showed that the number of osteoclasts in MTP subchondral bone was significantly higher than that of LTP, and they were mainly distributed in the subchondral bone absorption pit, which was similar to the distribution of Adrb2. Our study revealed that TRAP and Adrb2 were co-expressed in multinucleated cells by immunofluorescence double-label detection, and the expression level of MTP was higher than that of LTP. In this study, we did not use in vitro cell cultures for the detection of Adrb2 because Adrb2 serves as hormone receptors, and the properties of these cells change when they are removed from their environment. Thus, we inferred that Adrb2 on MTP with high mechanical stress is mainly expressed on osteoclasts. A comparative study on the medial sclerotic area and the lateral nonsclerotic area of the tibial plateau in patients with KO found that the number and the activity of osteoclasts in the sclerotic area were significantly higher than that in the nonsclerotic area [32]. The increased activity of osteoclasts in the sclerotic area of the bone indicated that the activity of bone formation and resorption were increased in human KO, but no coupling was observed.

Sympathetic mediator catechins induce differentiation of osteoclast precursors and stimulate osteoclast activity by binding to Adrb2 [33]. Since Adrb2 is a hormone receptor, the subchondral bone of the MTP and LTP of the knee of the same patient was used to conduct a paired experiment, suggesting that there were differences in topical catecholamines in the subchondral bone between MTP and LTP. This suggests that mechanical stress is the main cause of upregulation of Adrb2 in the subchondral bone, inducing osteoclast generation and participating in subchondral bone remodeling. Wnt signal promotes the proliferation and differentiation of osteoblasts [34]. Mature osteoclasts can reduce the Wnt signaling pathway inhibitor osteosclerosis protein expression and through the secretion of Wnt10b and BMP6 promoting osteoclast areas of osteoblast differentiation and bone formation [35]. Our research team has previously reported that the severity of KO is negatively correlated with the expression of sclerostin in the subchondral bone [36]. Recent studies have shown that osteoclasts downregulate the expression of sclerostin in the trabecular bone [37], which can explain the fact that the sclerotic MTP has high osteogenic activity and high osteoclast density in this study.

Pain is the main cause of disability in KO patients [38], and subchondral bone is the main cause of KO pain [39,40]. In overweight and obese KO patients, knee pressure and pain can be reduced by weight loss [41]. Similarly, high tibial osteotomy improved the mechanical axis of the lower limbs and relieved the load of the medial compartment of the knee, thus alleviating pain [42,43]. These studies suggest a positive correlation between intraarticular mechanical stresses and pain [44]. In studies on symptomatic KO, it was found that the increased nerve growth factor and osteoclast density in osteochondral channels seem to be key factors leading to KO bone pain [45]. In this study, we selected patients who underwent total knee arthroplasty due to medial knee pain. Therefore, we speculated that the MTP with high mechanical stress might elevate the number of osteoclasts through the high expression of β2-adrenergic receptor in the subchondral bone, leading to joint pain. In another study, β-adrenergic receptor inhibitors reduced the need for opioids in patients with joint pain and OA [46], which indirectly supports our view. However, a further study of the role of mechanical stress through the activation of subchondral bone osteoblasts by Adrb2 to regulate osteoblasts in OA, animal model experiments is still needed.

The current research related to the pathogenesis of KO of the most common animal models includes destabilization of medial meniscus and anterior cruciate ligament transection, etc., which are posttraumatic OA models and cannot objectively reflect abnormal subchondral bone remodeling of OA caused by mechanical stresses. The alveolar bone has a strong remodeling ability after mechanical stimulation, such as bite force, which is considered an ideal model for studying the bone mechanical response. In the OTM, mechanically modulating Adrb2 induces and promotes osteoclast generation and regulates alveolar bone remodeling [7]. In a model of OA of the temporomandibular joint, increased osteoclast activity by intraperitoneal injection of Adrb2 agonist caused bone loss following increased mechanical stresses [9]. Adrb2 is a G protein-coupled receptor [47], a signal converter that converts extracellular signals into intracellular signals; plays a key role in bone development, remodeling, and diseases; and is the primary drug target of human diseases [48]. It provides a new target for treating OA and alleviating symptoms.

In summary, we compared the MTP subchondral bone with the LTP subchondral bone in patients with varus knee deformity using a number of experimental methods. The bone structure of the MTP subchondral bone was significantly different from that of the LTP subchondral bone, showing increased bone mass and obvious sclerosis. However, the density of osteoclasts and OCN in the MTP subchondral bone were higher than that in the LTP subchondral bone, indicating that there was no coupling between bone formation and resorption. Furthermore, it is reported for the first time that the expression of Adrb2 in the MTP subchondral bone with high mechanical stresses is higher than that in the LTP subchondral bone, indicating that the signal transduction of Adrb2 plays an important role in mechanical stress-induced subchondral bone remodeling. However, the mechanism of Adrb2 in the whole pathogenesis of OA needs to be further studied, which may provide a new target for the treatment of OA and the reduction of symptoms.

List of abbreviations

Adrb2

activates the β2-adrenergic receptor

BCA

bicinchoninic acid

BMD

bone mineral density

BV

bone volume

DAB

diaminobenzidine

EDTA

ethylene diamine tetra acetic acid

GAPDH

glyceraldehyde phosphate dehydrogenase

HTO

High tibial osteotomy

KO

knee osteoarthritis

LTP

lateral tibial plateau

MTP

medial tibial plateau

NE

neurotransmitter norepinephrine

OA

osteoarthritis

OCN

osteocalcin

OTM

orthodontic tooth movement

PBS

phosphate-buffered saline

SCP

subchondral bone plate

SD

standard deviation

SEM

standard error of the mean

SMI

structure model index

SNS

sympathetic nervous system

TAC

total articular cartilage

TH

tyrosine hydroxylase

TMJ

temporomandibular joint

TRAP

tartrate-resistant acid phosphatase

tel: +86-13895086690

Acknowledgments

The authors would like to thank all study participants who were enrolled in this study.

  1. Funding information: The present study was supported by the National Natural Science Foundation of China (grant no. 8186090221).

  2. Author contributions: XC.Y., XG.L., and HH.G. carried out the studies, participated in collecting data, and drafted the manuscript. L.M., L.J., X.Z., and J.W. performed the statistical analysis and participated in its design. LL.Y., ZQ.M., and QH.J. participated in acquisition, analysis, or interpretation of data and draft the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Hunter J, Bierma-zeinstra S. Osteoarthritis. Lancet. 2019;393(10182):1745–59.10.1016/S0140-6736(19)30417-9Search in Google Scholar

[2] Burr DB, Gallant MA. Bone remodelling in osteoarthritis. Nat Rev Rheumatol. 2012;8(11):665–73.10.1038/nrrheum.2012.130Search in Google Scholar PubMed

[3] Hill EL, Elde R. Distribution of CGRP-, VIP-, D beta H-, SP-, and NPY-immunoreactive nerves in the periosteum of the rat. Cell Tissue Res. 1991;264(3):469–80.10.1007/BF00319037Search in Google Scholar PubMed

[4] Qiao Y, Wang Y, Zhou Y, Jiang F, Huang T, Chen L, et al. The role of nervous system in adaptive response of bone to mechanical loading. J Cell Physiol. 2019;234(6):7771–80.10.1002/jcp.27683Search in Google Scholar PubMed

[5] Elefteriou F, Campbell P, Ma Y. Control of bone remodeling by the peripheral sympathetic nervous system. Calcif Tissue Int. 2014;94(1):140–51.10.1007/s00223-013-9752-4Search in Google Scholar PubMed PubMed Central

[6] Courties A, Sellam J, Berenbaum F. Role of the autonomic nervous system in osteoarthritis. Best Pract Res Clin Rheumatol. 2017;31(5):661–75.10.1016/j.berh.2018.04.001Search in Google Scholar PubMed

[7] Cao H, Kou X, Yang R, Liu D, Wang X, Song Y, et al. Force-induced Adrb2 in periodontal ligament cells promotes tooth movement. J Dental Res. 2014;93(11):1163–9.10.1177/0022034514551769Search in Google Scholar PubMed PubMed Central

[8] Pongratz G, Straub RH. Role of peripheral nerve fibres in acute and chronic inflammation in arthritis. Nat Rev Rheumatol. 2013;9(2):117–26.10.1038/nrrheum.2012.181Search in Google Scholar PubMed

[9] Jiao K, Niu LN, Li QH, Ren GT, Zhao CM, Liu YD, et al. β2-Adrenergic signal transduction plays a detrimental role in subchondral bone loss of temporomandibular joint in osteoarthritis. Sci Rep. 2015;5:12593.10.1038/srep12593Search in Google Scholar PubMed PubMed Central

[10] Dayal N, Chang A, Dunlop D, Hayes K, Chang R, Cahue S, et al. The natural history of anteroposterior laxity and its role in knee osteoarthritis progression. Arthritis Rheumatism. 2005;52(8):2343–9.10.1002/art.21277Search in Google Scholar PubMed

[11] Schipplein OD, Andriacchi TP. Interaction between active and passive knee stabilizers during level walking. J Orthopaedic Res Off Publ Orthopaedic Res Soc. 1991;9(1):113–9.10.1002/jor.1100090114Search in Google Scholar PubMed

[12] Hügle T, Geurts J. What drives osteoarthritis? -synovial versus subchondral bone pathology. Rheumatol (Oxford, Engl). 2017;56(9):1461–71.10.1093/rheumatology/kew389Search in Google Scholar

[13] Palmer JS, Jones LD, Monk AP, Nevitt M, Lynch J, Beard DJ, et al. Varus alignment of the proximal tibia is associated with structural progression in early to moderate varus osteoarthritis of the knee. Knee Surgery Sports Traumatol Arthroscopy Off J ESSKA. 2020;28(10):3279–86.10.1007/s00167-019-05840-5Search in Google Scholar PubMed PubMed Central

[14] Hunt MA, Charlton JM, Esculier JF. Osteoarthritis year in review 2019: mechanics. Osteoarthr Cartil. 2020;28(3):267–74.10.1016/j.joca.2019.12.003Search in Google Scholar PubMed

[15] Altman R, Asch E, Bloch D, Bole G, Borenstein D, Brandt K, et al. Development of criteria for the classification and reporting of osteoarthritis. Classification of osteoarthritis of the knee. Diagnostic and therapeutic criteria committee of the american rheumatism association. Arthritis Rheumatism. 1986;29(8):1039–49.10.1002/art.1780290816Search in Google Scholar PubMed

[16] Kellgren JH, Lawrence JS. Radiological assessment of osteo-arthrosis. Ann Rheumatic Dis. 1957;16(4):494–502.10.1136/ard.16.4.494Search in Google Scholar PubMed PubMed Central

[17] Grogan SP, Barbero A, Winkelmann V, Rieser F, Fitzsimmons JS, O'driscoll S, et al. Visual histological grading system for the evaluation of in vitro-generated neocartilage. Tissue Eng. 2006;12(8):2141–9.10.1089/ten.2006.12.2141Search in Google Scholar PubMed

[18] Pritzker KP, Gay S, Jimenez SA, Ostergaard K, Pelletier JP, Revell PA, et al. Osteoarthritis cartilage histopathology: grading and staging. Osteoarthr Cartil. 2006;14(1):13–29.10.1016/j.joca.2005.07.014Search in Google Scholar PubMed

[19] Nwosu LN, Allen M, Wyatt L, Huebner JL, Chapman V, Walsh DA, et al. Pain prediction by serum biomarkers of bone turnover in people with knee osteoarthritis: an observational study of TRAcP5b and cathepsin K in OA. Osteoarthr Cartil. 2017;25(6):858–65.10.1016/j.joca.2017.01.002Search in Google Scholar PubMed

[20] Wen CY, Chen Y, Tang HL, Yan CH, Lu WW, Chiu KY. Bone loss at subchondral plate in knee osteoarthritis patients with hypertension and type 2 diabetes mellitus. Osteoarthr Cartil. 2013;21(11):1716–23.10.1016/j.joca.2013.06.027Search in Google Scholar PubMed

[21] Zhen G, Wen C, Jia X, Li Y, Crane JL, Mears SC, et al. Inhibition of TGF-β signaling in mesenchymal stem cells of subchondral bone attenuates osteoarthritis. Nat Med. 2013;19(6):704–12.10.1038/nm.3143Search in Google Scholar PubMed PubMed Central

[22] Wang T, Wen CY, Yan CH, Lu WW, Chiu KY. Spatial and temporal changes of subchondral bone proceed to microscopic articular cartilage degeneration in guinea pigs with spontaneous osteoarthritis. Osteoarthr Cartil. 2013;21(4):574–81.10.1016/j.joca.2013.01.002Search in Google Scholar

[23] Nevitt MC, Zhang Y, Javaid MK, Neogi T, Curtis JR, Niu J, et al. High systemic bone mineral density increases the risk of incident knee OA and joint space narrowing, but not radiographic progression of existing knee OA: the MOST study. Ann Rheumatic Dis. 2010;69(1):163–8.10.1136/ard.2008.099531Search in Google Scholar

[24] Finnilä MAJ, Thevenot J, Aho OM, Tiitu V, Rautiainen J, Kauppinen S, et al. Association between subchondral bone structure and osteoarthritis histopathological grade. J Orthopaedic Res. 2017;35(4):785–92.10.1002/jor.23312Search in Google Scholar

[25] Wada M, Maezawa Y, Baba H, Shimada S, Sasaki S, Nose Y. Relationships among bone mineral densities, static alignment and dynamic load in patients with medial compartment knee osteoarthritis. Rheumatol (Oxford, Engl). 2001;40(5):499–505.10.1093/rheumatology/40.5.499Search in Google Scholar

[26] Andriacchi TP. Dynamics of knee malalignment. Orthopedic Clin North Am. 1994;25(3):395–403.10.1016/S0030-5898(20)31924-6Search in Google Scholar

[27] Miyazaki T, Wada M, Kawahara H, Sato M, Baba H, Shimada S. Dynamic load at baseline can predict radiographic disease progression in medial compartment knee osteoarthritis. Ann Rheumatic Dis. 2002;61(7):617–22.10.1136/ard.61.7.617Search in Google Scholar PubMed PubMed Central

[28] Sharma L, Song J, Felson DT, Cahue S, Shamiyeh E, Dunlop DD. The role of knee alignment in disease progression and functional decline in knee osteoarthritis. JAMA. 2001;286(2):188–95.10.1001/jama.286.2.188Search in Google Scholar PubMed

[29] Garcia SA, Vakula MN, Holmes SC, Pamukoff DN. The influence of body mass index and sex on frontal and sagittal plane knee mechanics during walking in young adults. Gait Posture. 2021;83:217–22.10.1016/j.gaitpost.2020.10.010Search in Google Scholar PubMed

[30] Sseur R, Sabatier JP, Potrel-Burgot C, Lecoq B, Creveuil C, Marcelli C. Sympathetic nervous system as transmitter of mechanical loading in bone. Jt Bone Spine. 2003;70(6):515–9.10.1016/j.jbspin.2003.07.006Search in Google Scholar PubMed

[31] Togari A. Adrenergic regulation of bone metabolism: possible involvement of sympathetic innervation of osteoblastic and osteoclastic cells. Microscopy Res Tech. 2002;58(2):77–84.10.1002/jemt.10121Search in Google Scholar PubMed

[32] Geurts J, Patel A, Hirschmann MT, Pagenstert GI, Müller-Gerbl M, Valderrabano V, et al. Elevated marrow inflammatory cells and osteoclasts in subchondral osteosclerosis in human knee osteoarthritis. J Orthopaedic Res Off Publ Orthopaedic Res Soc. 2016;34(2):262–9.10.1002/jor.23009Search in Google Scholar PubMed

[33] Frediani U, Becherini L, Lasagni L, Tanini A, Brandi ML. Catecholamines modulate growth and differentiation of human preosteoclastic cells. Osteoporos Int J Established Result Cooperation Eur Found Osteoporos Natl Osteoporos Found USA. 1996;6(1):14–21.10.1007/BF01626532Search in Google Scholar PubMed

[34] Khosla S, Westendorf JJ, Oursler MJ. Building bone to reverse osteoporosis and repair fractures. J Clin Investigation. 2008;118(2):421–8.10.1172/JCI33612Search in Google Scholar PubMed PubMed Central

[35] Pederson L, Ruan M, Westendorf JJ, Khosla S, Oursler MJ. Regulation of bone formation by osteoclasts involves Wnt/BMP signaling and the chemokine sphingosine-1-phosphate. Proc Natl Acad Sci U S A. 2008;105(52):20764–9.10.1073/pnas.0805133106Search in Google Scholar PubMed PubMed Central

[36] Wu L, Guo H, Sun K, Zhao X, Ma T, Jin Q. Sclerostin expression in the subchondral bone of patients with knee osteoarthritis. Int J Mol Med. 2016;38(5):1395–402.10.3892/ijmm.2016.2741Search in Google Scholar PubMed PubMed Central

[37] Koide M, Yamashita T, Murakami K, Uehara S, Nakamura K, Nakamura M, et al. Sclerostin expression in trabecular bone is downregulated by osteoclasts. Sci Rep. 2020;10(1):13751.10.1038/s41598-020-70817-1Search in Google Scholar PubMed PubMed Central

[38] Neogi T. The epidemiology and impact of pain in osteoarthritis. Osteoarthr Cartil. 2013;21(9):1145–53.10.1016/j.joca.2013.03.018Search in Google Scholar PubMed PubMed Central

[39] Aso K, Shahtaheri SM, McWilliams DF, Walsh DA. Association of subchondral bone marrow lesion localization with weight-bearing pain in people with knee osteoarthritis: data from the Osteoarthritis Initiative. Arthritis Res Ther. 2021;23(1):35.10.1186/s13075-021-02422-0Search in Google Scholar PubMed PubMed Central

[40] Driban JB, Price L, Lo GH, Pang J, Hunter DJ, Miller E, et al. Evaluation of bone marrow lesion volume as a knee osteoarthritis biomarker--longitudinal relationships with pain and structural changes: data from the Osteoarthritis Initiative. Arthritis Res Ther. 2013;15(5):R112.10.1186/ar4292Search in Google Scholar PubMed PubMed Central

[41] Messier SP, Mihalko SL, Legault C, Miller GD, Nicklas BJ, DeVita P, et al. Effects of intensive diet and exercise on knee joint loads, inflammation, and clinical outcomes among overweight and obese adults with knee osteoarthritis: the IDEA randomized clinical trial. JAMA. 2013;310(12):1263–73.10.1001/jama.2013.277669Search in Google Scholar PubMed PubMed Central

[42] Liu X, Chen Z, Gao Y, Zhang J, Jin Z. High Tibial Osteotomy: Review of Techniques and Biomechanics. J Healthc Eng. 2019;2019:8363128.10.1155/2019/8363128Search in Google Scholar PubMed PubMed Central

[43] He M, Zhong X, Li Z, Shen K, Zeng W. Progress in the treatment of knee osteoarthritis with high tibial osteotomy: a systematic review. Syst Rev. 2021;10(1):56.10.1186/s13643-021-01601-zSearch in Google Scholar PubMed PubMed Central

[44] Christensen P, Henriksen M, Bartels EM, Leeds AR, Meinert Larsen T, Gudbergsen H, et al. Long-term weight-loss maintenance in obese patients with knee osteoarthritis: a randomized trial. Am J Clin Nutr. 2017;106(3):755–63.10.3945/ajcn.117.158543Search in Google Scholar PubMed

[45] Aso K, Shahtaheri SM, Hill R, Wilson D, McWilliams DF, Walsh DA. Associations of symptomatic knee osteoarthritis with histopathologic features in subchondral bone. Arthritis Rheumatol (Hoboken, NJ). 2019;71(6):916–24.10.1002/art.40820Search in Google Scholar PubMed

[46] Nakafero G, Grainge M, Valdes A, Townsend N, Mallen C, Zhang W, et al. Do β-adrenoreceptor blocking drugs associate with reduced risk of symptomatic osteoarthritis and total joint replacement in the general population? A primary care-based, prospective cohort study using the Clinical Practice Research Datalink. BMJ Open. 2019;9(8):e032050.10.1136/bmjopen-2019-032050Search in Google Scholar PubMed PubMed Central

[47] Luo J, Sun P, Siwko S, Liu M, Xiao J. The role of GPCRs in bone diseases and dysfunctions. Bone Res. 2019;7:19.10.1038/s41413-019-0059-6Search in Google Scholar PubMed PubMed Central

[48] Sriram K, Insel PA. G protein-coupled receptors as targets for approved drugs: how many targets and how many drugs? Mol Pharmacol. 2018;93(4):251–8.10.1124/mol.117.111062Search in Google Scholar PubMed PubMed Central

Received: 2021-09-28
Revised: 2022-05-05
Accepted: 2022-05-09
Published Online: 2022-06-07

© 2022 Xiaochun Yang et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
https://doi.org/10.1515/med-2022-0498
Keywords for this article
osteoarthritis; β2-adrenergic receptor; mechanical stresses; subchondral bone; bone remodeling
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. AMBRA1 attenuates the proliferation of uveal melanoma cells
  3. A ceRNA network mediated by LINC00475 in papillary thyroid carcinoma
  4. Differences in complications between hepatitis B-related cirrhosis and alcohol-related cirrhosis
  5. Effect of gestational diabetes mellitus on lipid profile: A systematic review and meta-analysis
  6. Long noncoding RNA NR2F1-AS1 stimulates the tumorigenic behavior of non-small cell lung cancer cells by sponging miR-363-3p to increase SOX4
  7. Promising novel biomarkers and candidate small-molecule drugs for lung adenocarcinoma: Evidence from bioinformatics analysis of high-throughput data
  8. Plasmapheresis: Is it a potential alternative treatment for chronic urticaria?
  9. The biomarkers of key miRNAs and gene targets associated with extranodal NK/T-cell lymphoma
  10. Gene signature to predict prognostic survival of hepatocellular carcinoma
  11. Effects of miRNA-199a-5p on cell proliferation and apoptosis of uterine leiomyoma by targeting MED12
  12. Does diabetes affect paraneoplastic thrombocytosis in colorectal cancer?
  13. Is there any effect on imprinted genes H19, PEG3, and SNRPN during AOA?
  14. Leptin and PCSK9 concentrations are associated with vascular endothelial cytokines in patients with stable coronary heart disease
  15. Pericentric inversion of chromosome 6 and male fertility problems
  16. Staple line reinforcement with nebulized cyanoacrylate glue in laparoscopic sleeve gastrectomy: A propensity score-matched study
  17. Retrospective analysis of crescent score in clinical prognosis of IgA nephropathy
  18. Expression of DNM3 is associated with good outcome in colorectal cancer
  19. Activation of SphK2 contributes to adipocyte-induced EOC cell proliferation
  20. CRRT influences PICCO measurements in febrile critically ill patients
  21. SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis
  22. lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells
  23. circ_AKT3 knockdown suppresses cisplatin resistance in gastric cancer
  24. Prognostic value of nicotinamide N-methyltransferase in human cancers: Evidence from a meta-analysis and database validation
  25. GPC2 deficiency inhibits cell growth and metastasis in colon adenocarcinoma
  26. A pan-cancer analysis of the oncogenic role of Holliday junction recognition protein in human tumors
  27. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer
  28. Association between preventable risk factors and metabolic syndrome
  29. miR-29c-5p knockdown reduces inflammation and blood–brain barrier disruption by upregulating LRP6
  30. Cardiac contractility modulation ameliorates myocardial metabolic remodeling in a rabbit model of chronic heart failure through activation of AMPK and PPAR-α pathway
  31. Quercitrin protects human bronchial epithelial cells from oxidative damage
  32. Smurf2 suppresses the metastasis of hepatocellular carcinoma via ubiquitin degradation of Smad2
  33. circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury
  34. Sonoclot’s usefulness in prediction of cardiopulmonary arrest prognosis: A proof of concept study
  35. Four drug metabolism-related subgroups of pancreatic adenocarcinoma in prognosis, immune infiltration, and gene mutation
  36. Decreased expression of miR-195 mediated by hypermethylation promotes osteosarcoma
  37. LMO3 promotes proliferation and metastasis of papillary thyroid carcinoma cells by regulating LIMK1-mediated cofilin and the β-catenin pathway
  38. Cx43 upregulation in HUVECs under stretch via TGF-β1 and cytoskeletal network
  39. Evaluation of menstrual irregularities after COVID-19 vaccination: Results of the MECOVAC survey
  40. Histopathologic findings on removed stomach after sleeve gastrectomy. Do they influence the outcome?
  41. Analysis of the expression and prognostic value of MT1-MMP, β1-integrin and YAP1 in glioma
  42. Optimal diagnosis of the skin cancer using a hybrid deep neural network and grasshopper optimization algorithm
  43. miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells
  44. Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis
  45. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8
  46. miR-22-5p regulates the self-renewal of spermatogonial stem cells by targeting EZH2
  47. hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling
  48. circ_0085296 inhibits the biological functions of trophoblast cells to promote the progression of preeclampsia via the miR-942-5p/THBS2 network
  49. TCD hemodynamics findings in the subacute phase of anterior circulation stroke patients treated with mechanical thrombectomy
  50. Development of a risk-stratification scoring system for predicting risk of breast cancer based on non-alcoholic fatty liver disease, non-alcoholic fatty pancreas disease, and uric acid
  51. Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway
  52. circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis
  53. Human amniotic fluid as a source of stem cells
  54. lncRNA NONRATT013819.2 promotes transforming growth factor-β1-induced myofibroblastic transition of hepatic stellate cells by miR24-3p/lox
  55. NORAD modulates miR-30c-5p-LDHA to protect lung endothelial cells damage
  56. Idiopathic pulmonary fibrosis telemedicine management during COVID-19 outbreak
  57. Risk factors for adverse drug reactions associated with clopidogrel therapy
  58. Serum zinc associated with immunity and inflammatory markers in Covid-19
  59. The relationship between night shift work and breast cancer incidence: A systematic review and meta-analysis of observational studies
  60. LncRNA expression in idiopathic achalasia: New insight and preliminary exploration into pathogenesis
  61. Notoginsenoside R1 alleviates spinal cord injury through the miR-301a/KLF7 axis to activate Wnt/β-catenin pathway
  62. Moscatilin suppresses the inflammation from macrophages and T cells
  63. Zoledronate promotes ECM degradation and apoptosis via Wnt/β-catenin
  64. Epithelial-mesenchymal transition-related genes in coronary artery disease
  65. The effect evaluation of traditional vaginal surgery and transvaginal mesh surgery for severe pelvic organ prolapse: 5 years follow-up
  66. Repeated partial splenic artery embolization for hypersplenism improves platelet count
  67. Low expression of miR-27b in serum exosomes of non-small cell lung cancer facilitates its progression by affecting EGFR
  68. Exosomal hsa_circ_0000519 modulates the NSCLC cell growth and metastasis via miR-1258/RHOV axis
  69. miR-455-5p enhances 5-fluorouracil sensitivity in colorectal cancer cells by targeting PIK3R1 and DEPDC1
  70. The effect of tranexamic acid on the reduction of intraoperative and postoperative blood loss and thromboembolic risk in patients with hip fracture
  71. Isocitrate dehydrogenase 1 mutation in cholangiocarcinoma impairs tumor progression by sensitizing cells to ferroptosis
  72. Artemisinin protects against cerebral ischemia and reperfusion injury via inhibiting the NF-κB pathway
  73. A 16-gene signature associated with homologous recombination deficiency for prognosis prediction in patients with triple-negative breast cancer
  74. Lidocaine ameliorates chronic constriction injury-induced neuropathic pain through regulating M1/M2 microglia polarization
  75. MicroRNA 322-5p reduced neuronal inflammation via the TLR4/TRAF6/NF-κB axis in a rat epilepsy model
  76. miR-1273h-5p suppresses CXCL12 expression and inhibits gastric cancer cell invasion and metastasis
  77. Clinical characteristics of pneumonia patients of long course of illness infected with SARS-CoV-2
  78. circRNF20 aggravates the malignancy of retinoblastoma depending on the regulation of miR-132-3p/PAX6 axis
  79. Linezolid for resistant Gram-positive bacterial infections in children under 12 years: A meta-analysis
  80. Rack1 regulates pro-inflammatory cytokines by NF-κB in diabetic nephropathy
  81. Comprehensive analysis of molecular mechanism and a novel prognostic signature based on small nuclear RNA biomarkers in gastric cancer patients
  82. Smog and risk of maternal and fetal birth outcomes: A retrospective study in Baoding, China
  83. Let-7i-3p inhibits the cell cycle, proliferation, invasion, and migration of colorectal cancer cells via downregulating CCND1
  84. β2-Adrenergic receptor expression in subchondral bone of patients with varus knee osteoarthritis
  85. Possible impact of COVID-19 pandemic and lockdown on suicide behavior among patients in Southeast Serbia
  86. In vitro antimicrobial activity of ozonated oil in liposome eyedrop against multidrug-resistant bacteria
  87. Potential biomarkers for inflammatory response in acute lung injury
  88. A low serum uric acid concentration predicts a poor prognosis in adult patients with candidemia
  89. Antitumor activity of recombinant oncolytic vaccinia virus with human IL2
  90. ALKBH5 inhibits TNF-α-induced apoptosis of HUVECs through Bcl-2 pathway
  91. Risk prediction of cardiovascular disease using machine learning classifiers
  92. Value of ultrasonography parameters in diagnosing polycystic ovary syndrome
  93. Bioinformatics analysis reveals three key genes and four survival genes associated with youth-onset NSCLC
  94. Identification of autophagy-related biomarkers in patients with pulmonary arterial hypertension based on bioinformatics analysis
  95. Protective effects of glaucocalyxin A on the airway of asthmatic mice
  96. Overexpression of miR-100-5p inhibits papillary thyroid cancer progression via targeting FZD8
  97. Bioinformatics-based analysis of SUMOylation-related genes in hepatocellular carcinoma reveals a role of upregulated SAE1 in promoting cell proliferation
  98. Effectiveness and clinical benefits of new anti-diabetic drugs: A real life experience
  99. Identification of osteoporosis based on gene biomarkers using support vector machine
  100. Tanshinone IIA reverses oxaliplatin resistance in colorectal cancer through microRNA-30b-5p/AVEN axis
  101. miR-212-5p inhibits nasopharyngeal carcinoma progression by targeting METTL3
  102. Association of ST-T changes with all-cause mortality among patients with peripheral T-cell lymphomas
  103. LINC00665/miRNAs axis-mediated collagen type XI alpha 1 correlates with immune infiltration and malignant phenotypes in lung adenocarcinoma
  104. The perinatal factors that influence the excretion of fecal calprotectin in premature-born children
  105. Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study
  106. Does the use of 3D-printed cones give a chance to postpone the use of megaprostheses in patients with large bone defects in the knee joint?
  107. lncRNA HAGLR modulates myocardial ischemia–reperfusion injury in mice through regulating miR-133a-3p/MAPK1 axis
  108. Protective effect of ghrelin on intestinal I/R injury in rats
  109. In vivo knee kinematics of an innovative prosthesis design
  110. Relationship between the height of fibular head and the incidence and severity of knee osteoarthritis
  111. lncRNA WT1-AS attenuates hypoxia/ischemia-induced neuronal injury during cerebral ischemic stroke via miR-186-5p/XIAP axis
  112. Correlation of cardiac troponin T and APACHE III score with all-cause in-hospital mortality in critically ill patients with acute pulmonary embolism
  113. LncRNA LINC01857 reduces metastasis and angiogenesis in breast cancer cells via regulating miR-2052/CENPQ axis
  114. Endothelial cell-specific molecule 1 (ESM1) promoted by transcription factor SPI1 acts as an oncogene to modulate the malignant phenotype of endometrial cancer
  115. SELENBP1 inhibits progression of colorectal cancer by suppressing epithelial–mesenchymal transition
  116. Visfatin is negatively associated with coronary artery lesions in subjects with impaired fasting glucose
  117. Treatment and outcomes of mechanical complications of acute myocardial infarction during the Covid-19 era: A comparison with the pre-Covid-19 period. A systematic review and meta-analysis
  118. Neonatal stroke surveillance study protocol in the United Kingdom and Republic of Ireland
  119. Oncogenic role of TWF2 in human tumors: A pan-cancer analysis
  120. Mean corpuscular hemoglobin predicts the length of hospital stay independent of severity classification in patients with acute pancreatitis
  121. Association of gallstone and polymorphisms of UGT1A1*27 and UGT1A1*28 in patients with hepatitis B virus-related liver failure
  122. TGF-β1 upregulates Sar1a expression and induces procollagen-I secretion in hypertrophic scarring fibroblasts
  123. Antisense lncRNA PCNA-AS1 promotes esophageal squamous cell carcinoma progression through the miR-2467-3p/PCNA axis
  124. NK-cell dysfunction of acute myeloid leukemia in relation to the renin–angiotensin system and neurotransmitter genes
  125. The effect of dilution with glucose and prolonged injection time on dexamethasone-induced perineal irritation – A randomized controlled trial
  126. miR-146-5p restrains calcification of vascular smooth muscle cells by suppressing TRAF6
  127. Role of lncRNA MIAT/miR-361-3p/CCAR2 in prostate cancer cells
  128. lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2
  129. Noninvasive diagnosis of AIH/PBC overlap syndrome based on prediction models
  130. lncRNA FAM230B is highly expressed in colorectal cancer and suppresses the maturation of miR-1182 to increase cell proliferation
  131. circ-LIMK1 regulates cisplatin resistance in lung adenocarcinoma by targeting miR-512-5p/HMGA1 axis
  132. LncRNA SNHG3 promoted cell proliferation, migration, and metastasis of esophageal squamous cell carcinoma via regulating miR-151a-3p/PFN2 axis
  133. Risk perception and affective state on work exhaustion in obstetrics during the COVID-19 pandemic
  134. lncRNA-AC130710/miR-129-5p/mGluR1 axis promote migration and invasion by activating PKCα-MAPK signal pathway in melanoma
  135. SNRPB promotes cell cycle progression in thyroid carcinoma via inhibiting p53
  136. Xylooligosaccharides and aerobic training regulate metabolism and behavior in rats with streptozotocin-induced type 1 diabetes
  137. Serpin family A member 1 is an oncogene in glioma and its translation is enhanced by NAD(P)H quinone dehydrogenase 1 through RNA-binding activity
  138. Silencing of CPSF7 inhibits the proliferation, migration, and invasion of lung adenocarcinoma cells by blocking the AKT/mTOR signaling pathway
  139. Ultrasound-guided lumbar plexus block versus transversus abdominis plane block for analgesia in children with hip dislocation: A double-blind, randomized trial
  140. Relationship of plasma MBP and 8-oxo-dG with brain damage in preterm
  141. Identification of a novel necroptosis-associated miRNA signature for predicting the prognosis in head and neck squamous cell carcinoma
  142. Delayed femoral vein ligation reduces operative time and blood loss during hip disarticulation in patients with extremity tumors
  143. The expression of ASAP3 and NOTCH3 and the clinicopathological characteristics of adult glioma patients
  144. Longitudinal analysis of factors related to Helicobacter pylori infection in Chinese adults
  145. HOXA10 enhances cell proliferation and suppresses apoptosis in esophageal cancer via activating p38/ERK signaling pathway
  146. Meta-analysis of early-life antibiotic use and allergic rhinitis
  147. Marital status and its correlation with age, race, and gender in prognosis of tonsil squamous cell carcinomas
  148. HPV16 E6E7 up-regulates KIF2A expression by activating JNK/c-Jun signal, is beneficial to migration and invasion of cervical cancer cells
  149. Amino acid profiles in the tissue and serum of patients with liver cancer
  150. Pain in critically ill COVID-19 patients: An Italian retrospective study
  151. Immunohistochemical distribution of Bcl-2 and p53 apoptotic markers in acetamiprid-induced nephrotoxicity
  152. Estradiol pretreatment in GnRH antagonist protocol for IVF/ICSI treatment
  153. Long non-coding RNAs LINC00689 inhibits the apoptosis of human nucleus pulposus cells via miR-3127-5p/ATG7 axis-mediated autophagy
  154. The relationship between oxygen therapy, drug therapy, and COVID-19 mortality
  155. Monitoring hypertensive disorders in pregnancy to prevent preeclampsia in pregnant women of advanced maternal age: Trial mimicking with retrospective data
  156. SETD1A promotes the proliferation and glycolysis of nasopharyngeal carcinoma cells by activating the PI3K/Akt pathway
  157. The role of Shunaoxin pills in the treatment of chronic cerebral hypoperfusion and its main pharmacodynamic components
  158. TET3 governs malignant behaviors and unfavorable prognosis of esophageal squamous cell carcinoma by activating the PI3K/AKT/GSK3β/β-catenin pathway
  159. Associations between morphokinetic parameters of temporary-arrest embryos and the clinical prognosis in FET cycles
  160. Long noncoding RNA WT1-AS regulates trophoblast proliferation, migration, and invasion via the microRNA-186-5p/CADM2 axis
  161. The incidence of bronchiectasis in chronic obstructive pulmonary disease
  162. Integrated bioinformatics analysis shows integrin alpha 3 is a prognostic biomarker for pancreatic cancer
  163. Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway
  164. Comparison of hospitalized patients with severe pneumonia caused by COVID-19 and influenza A (H7N9 and H1N1): A retrospective study from a designated hospital
  165. lncRNA ZFAS1 promotes intervertebral disc degeneration by upregulating AAK1
  166. Pathological characteristics of liver injury induced by N,N-dimethylformamide: From humans to animal models
  167. lncRNA ELFN1-AS1 enhances the progression of colon cancer by targeting miR-4270 to upregulate AURKB
  168. DARS-AS1 modulates cell proliferation and migration of gastric cancer cells by regulating miR-330-3p/NAT10 axis
  169. Dezocine inhibits cell proliferation, migration, and invasion by targeting CRABP2 in ovarian cancer
  170. MGST1 alleviates the oxidative stress of trophoblast cells induced by hypoxia/reoxygenation and promotes cell proliferation, migration, and invasion by activating the PI3K/AKT/mTOR pathway
  171. Bifidobacterium lactis Probio-M8 ameliorated the symptoms of type 2 diabetes mellitus mice by changing ileum FXR-CYP7A1
  172. circRNA DENND1B inhibits tumorigenicity of clear cell renal cell carcinoma via miR-122-5p/TIMP2 axis
  173. EphA3 targeted by miR-3666 contributes to melanoma malignancy via activating ERK1/2 and p38 MAPK pathways
  174. Pacemakers and methylprednisolone pulse therapy in immune-related myocarditis concomitant with complete heart block
  175. miRNA-130a-3p targets sphingosine-1-phosphate receptor 1 to activate the microglial and astrocytes and to promote neural injury under the high glucose condition
  176. Review Articles
  177. Current management of cancer pain in Italy: Expert opinion paper
  178. Hearing loss and brain disorders: A review of multiple pathologies
  179. The rationale for using low-molecular weight heparin in the therapy of symptomatic COVID-19 patients
  180. Amyotrophic lateral sclerosis and delayed onset muscle soreness in light of the impaired blink and stretch reflexes – watch out for Piezo2
  181. Interleukin-35 in autoimmune dermatoses: Current concepts
  182. Recent discoveries in microbiota dysbiosis, cholangiocytic factors, and models for studying the pathogenesis of primary sclerosing cholangitis
  183. Advantages of ketamine in pediatric anesthesia
  184. Congenital adrenal hyperplasia. Role of dentist in early diagnosis
  185. Migraine management: Non-pharmacological points for patients and health care professionals
  186. Atherogenic index of plasma and coronary artery disease: A systematic review
  187. Physiological and modulatory role of thioredoxins in the cellular function
  188. Case Reports
  189. Intrauterine Bakri balloon tamponade plus cervical cerclage for the prevention and treatment of postpartum haemorrhage in late pregnancy complicated with acute aortic dissection: Case series
  190. A case of successful pembrolizumab monotherapy in a patient with advanced lung adenocarcinoma: Use of multiple biomarkers in combination for clinical practice
  191. Unusual neurological manifestations of bilateral medial medullary infarction: A case report
  192. Atypical symptoms of malignant hyperthermia: A rare causative mutation in the RYR1 gene
  193. A case report of dermatomyositis with the missed diagnosis of non-small cell lung cancer and concurrence of pulmonary tuberculosis
  194. A rare case of endometrial polyp complicated with uterine inversion: A case report and clinical management
  195. Spontaneous rupturing of splenic artery aneurysm: Another reason for fatal syncope and shock (Case report and literature review)
  196. Fungal infection mimicking COVID-19 infection – A case report
  197. Concurrent aspergillosis and cystic pulmonary metastases in a patient with tongue squamous cell carcinoma
  198. Paraganglioma-induced inverted takotsubo-like cardiomyopathy leading to cardiogenic shock successfully treated with extracorporeal membrane oxygenation
  199. Lineage switch from lymphoma to myeloid neoplasms: First case series from a single institution
  200. Trismus during tracheal extubation as a complication of general anaesthesia – A case report
  201. Simultaneous treatment of a pubovesical fistula and lymph node metastasis secondary to multimodal treatment for prostate cancer: Case report and review of the literature
  202. Two case reports of skin vasculitis following the COVID-19 immunization
  203. Ureteroiliac fistula after oncological surgery: Case report and review of the literature
  204. Synchronous triple primary malignant tumours in the bladder, prostate, and lung harbouring TP53 and MEK1 mutations accompanied with severe cardiovascular diseases: A case report
  205. Huge mucinous cystic neoplasms with adhesion to the left colon: A case report and literature review
  206. Commentary
  207. Commentary on “Clinicopathological features of programmed cell death-ligand 1 expression in patients with oral squamous cell carcinoma”
  208. Rapid Communication
  209. COVID-19 fear, post-traumatic stress, growth, and the role of resilience
  210. Erratum
  211. Erratum to “Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway”
  212. Erratum to “Effect of femoral head necrosis cystic area on femoral head collapse and stress distribution in femoral head: A clinical and finite element study”
  213. Erratum to “lncRNA NORAD promotes lung cancer progression by competitively binding to miR-28-3p with E2F2”
  214. Retraction
  215. Expression and role of ABIN1 in sepsis: In vitro and in vivo studies
  216. Retraction to “miR-519d downregulates LEP expression to inhibit preeclampsia development”
  217. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part II
  218. Usefulness of close surveillance for rectal cancer patients after neoadjuvant chemoradiotherapy
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 9.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0498/html
Scroll to top button